Skip to main content
Virology Journal logoLink to Virology Journal
. 2009 Oct 25;6:171. doi: 10.1186/1743-422X-6-171

Molecular characterization of the Great Lakes viral hemorrhagic septicemia virus (VHSV) isolate from USA

Arun Ammayappan 1,2, Vikram N Vakharia 1,✉
PMCID: PMC2771013  PMID: 19852863

Abstract

Background

Viral hemorrhagic septicemia virus (VHSV) is a highly contagious viral disease of fresh and saltwater fish worldwide. VHSV caused several large scale fish kills in the Great Lakes area and has been found in 28 different host species. The emergence of VHS in the Great Lakes began with the isolation of VHSV from a diseased muskellunge (Esox masquinongy) caught from Lake St. Clair in 2003. VHSV is a member of the genus Novirhabdovirus, within the family Rhabdoviridae. It has a linear single-stranded, negative-sense RNA genome of approximately 11 kbp, with six genes. VHSV replicates in the cytoplasm and produces six monocistronic mRNAs. The gene order of VHSV is 3'-N-P-M-G-NV-L-5'. This study describes molecular characterization of the Great Lakes VHSV strain (MI03GL), and its phylogenetic relationships with selected European and North American isolates.

Results

The complete genomic sequences of VHSV-MI03GL strain was determined from cloned cDNA of six overlapping fragments, obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of MI03GL comprises 11,184 nucleotides (GenBank GQ385941) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. The first 4 nucleotides at the termini of the VHSV genome are complementary and identical to other novirhadoviruses genomic termini. Sequence homology and phylogenetic analysis show that the Great Lakes virus is closely related to the Japanese strains JF00Ehi1 (96%) and KRRV9822 (95%). Among other novirhabdoviruses, VHSV shares highest sequence homology (62%) with snakehead rhabdovirus.

Conclusion

Phylogenetic tree obtained by comparing 48 glycoprotein gene sequences of different VHSV strains demonstrate that the Great Lakes VHSV is closely related to the North American and Japanese genotype IVa, but forms a distinct genotype IVb, which is clearly different from the three European genotypes. Molecular characterization of the Great Lakes isolate will be helpful in studying the pathogenesis of VHSV using a reverse genetics approach and developing efficient control strategies.

Background

Viral hemorrhagic septicemia virus (VHSV) is a rhabdoviral fish pathogen, which constitute one of the major threats to the development of the aquaculture industry worldwide. VHSV causes disease not only in salmonids, but also in many other marine species as well [1-5]. The virus usually causes severe hemorrhages on the skin, the kidney and the liver, with mortality rates as high as 90%. VHSV is a member of the genus Novirhabdovirus within the family Rhabdoviridae [6]. It possess a non-segmented negative-strand RNA genome of approximately 11 kbp with a coding capacity for five structural proteins; nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), RNA polymerase (L), and a nonstructural protein (NV) [7-9]. The gene order of VHSV is 3'-leader-N-P-M-G-NV-L-trailer-5'. The negative-strand RNA genome is connected tightly with the nucleoprotein N and forms the core structure of virion. This encapsidated genomic RNA is also associated with the phosphoprotein P and polymerase protein L, which are involved in viral protein synthesis and replication.

The complete nucleotide sequence of VHSV has been determined initially for VHSV Fi13 strain [9] and coding regions of several other strains of VHSV have been determined later [10]. In this study, we characterized the entire genome of the Great Lakes VHSV isolate MI03GL from muskellunge, Esox masquinongy (Mitchill), caught from the NW region of Lake St. Clair, Michigan, USA in 2003 [11]. Affected fish exhibited congestion of internal organs; the inner wall of the swim bladder was thickened and contained numerous budding, fluid-filled vesicles. Lake St. Clair is a major lake in the Great Lakes system that has historically supported an economically and socially important sport fishery for many species of fish [11,12]. VHSV has a very broad host-range, including numerous taxonomic families of fish. The Great Lakes VHSV has been found in 28 different host species, including muskellunge, yellow perch, smallmouth bass, northern pike, whitefish, walleye, bluegill, drum, round gobies, and some sucker species http://dnr.wi.gov/fish/vhs/. It is a serious threat to all aquaculture species, including salmonids such as trout and salmon. To understand the molecular characteristics of the Great Lakes VHSV strain MI03GL, we thoroughly analyzed the entire genomic sequences and compared it with other VHSV strains and rhabdoviruses.

Methods

RT-PCR amplification of the VHSV genome

The genomic RNA of VHSV strain MI03GL was kindly provided by Dr. Gael Kurath, U.S. Geological Survey, Western Fisheries Research Center, Seattle, WA, and was used as a template. The consensus PCR primers were designed based on the available VHSV genome sequences (Genbank accession numbers AB179621; NC_000855; AB490792) from the National Center for Biotechnology Information (NCBI). The complete genome sequences were aligned; highly conserved sequence segments identified, and used to design overlapping primers. The oligonucleotide primers used in this study are listed in Table 1. First strand synthesis was carried out in a tube containing 5 μl of RNA, which was denatured at 70°C for 10 min in the presence of DMSO (3 μl), 1 μl forward gene-specific primer, 1 μl of 25 mM dNTPs, and snap-cooled on ice for 1 min. The reaction mixture containing 2 μl of 10× RT buffer, 2 μl of 0.1 M DTT, 4 μl of 25 mM MgCl2, 1 μl of Superscript III RT™, and 1 μl of RNase OUT™ was incubated at 50°C for 1 h. PCR amplifications were carried out using a pfx50™ PCR kit (Invitrogen, CA), according to manufacturer's instructions. Briefly, the following mixture was used for PCR amplification: 3 μ1 of cDNA, 2 μl of primer mix; 5 μl of 10× PCR buffer [100 mM Tris-HCl (pH 9.0), 500 mM KC1, 1% Triton X-100], 2 μ1 of 25 mM MgCl2, 0.5 ul of pfx50 polymerase, and 37 μ1 of DEPC water, to make a final volume of 50 μ1. Reaction was carried out in a thermal cycler (MJ Research Inc., Waltham, MA), using the following program: denaturation at 94°C for 30 sec; annealing for 30 sec at 60°C; and extension at 68°C for 2 min. The RT-PCR products were separated by agarose gel electrophoresis and purified using a QIAquick gel extraction kit (Qiagen, CA).

Table 1.

Oligonucleotides used for cloning and sequencing of the VHSV genome

VHSV primers Sequences Position
VHSV 1F GTATCATAAAATATGATGAGT 1-21

VHSV 1R CAACTTGAACTTCTTCATGGC 2028-2008

VHSV 2F AAGAAGACCGACAACATACTCT 1858-1879

VHSV 2R GACGAAACTTTGAGAGGAGAAA 3993-3972

VHSV 3F ATCTCATTACCAACATGGCTCAAA 3892-3915

VHSV 3R TTGTTCGCTTCTCCCCTAATTGT 5932-5910

VHSV 4F TGCCATAGACCTACTCAAGTTAT 5814-5835

VHSV 4R CTGATCCATGGTGGCTATGTGAT 8042-8020

VHSV 5F AGATGATTGTCTCCACCATGAA 7846-7867

VHSV 5R GAGATCCGCTCTCGTTCATCAA 10027-10006

VHSV 6F GACAAGAAAGCTGGGAAGAGA 9787-9807

VHSV 6R GTATAGAAAATAATACATACCA 11183-11162

VHSV 850R ACAGTCCAATCATGGTCATTC 851-831

VHSV 1MF GGACAAAATGATCAAGTACATC 595-616

VHSV 2MF CCATTCTCTGTGAAGATCAACAT 2456-2478

VHSV 3MF TGTGAGACAGAAAGATGACGAT 4566-4587

VHSV 4MF GACACCACCGAGAAGAGACTAC 6429-6450

VHSV 5MF GAAGAGAAGGAAGCACACCAA 8424-8444

VHSV 5'End1 GTGGCATCCGTCTTTCTCAA 10599-10618

VHSV 5'End2 CGCTCATCACTCTCCTCGAA 10660-10679

Oligo (dT) GCGGCCGCTTTTTTTTTTTTTTTTTTTTT

In order to identify the 3'-terminal region of the genomic RNA, poly (A) tail was added to the 3'-end with poly (A) polymerase enzyme, according to manufactures' instruction (Applied Biosystems, USA). Tailing reaction was carried in a tube containing 30 μl of RNA, 26 μl of nuclease-free water, 20 μl of 5× poly (A) polymerase buffer, 10 μl of 25 mM MnCl2, 10 μl of 10 mM ATP, and 4 μl of E. coli poly (A) polymerase. The reaction mixture was incubated at 37°C for 1 hr and then RNA was purified using a Qiagen RNAeasy kit, according to manufacturer's instructions. The cDNA synthesis and polymerase chain reaction were conducted as described above, using an oligo (dT) primer (5'-GCGGCCGCTTTTTTTTTTTTTTTTTTTTT-3') for the first-strand synthesis, followed by PCR with the VHSV-specific primer 850R (5'-ACAGTCCAATCATGGTCATTC-3'). The 5'-terminal of genomic RNA was identified by rapid amplification of the 5'-end, using a 5'RACE kit (Invitrogen, USA), according to manufacturer's instructions.

Cloning and sequencing

The purified RT-PCR products were cloned into a pCR2.1 TOPO® TA vector (Invitrogen, CA). Plasmid DNA from various clones was sequenced by dideoxy chain termination method, using an automated DNA sequencer (Applied Biosystems, CA). Three independent clones were sequenced for each amplicon to exclude errors that can occur from RT and PCR reactions.

Sequence and phylogenetic tree analysis

The assembly of contiguous sequences and multiple sequence alignments were performed with the GeneDoc software [13]. The pair-wise nucleotide identity and comparative sequence analyses were conducted using Vector NTI Advance 10 software (Invitrogen, CA) and BLAST search from NCBI. Phylogenetic analyses were conducted using the MEGA4 software [14]. Construction of a phylogenetic tree was performed using the ClustalW multiple alignment algorithm and Neighbor-Joining method with 1000 bootstrap replicates.

Database accession numbers

The complete genome sequence of the VHSV MI03GL strain was submitted to the GenBank (accession number GQ385941). The accession numbers of other viral sequences used for sequence comparison and phylogenetic analysis are listed in Table 2.

Table 2.

Information about the viral hemorrhagic septicemia virus (VHSV) isolates used in this study for comparison and phylogenetic analysis

S. No Strain Country Host GenBank no.
N protein

1. 07-71 France VHSV-infected cell line EPC D00687

2. Makah USA Coho salmon X59241

P protein

3. 07-71 France rainbow trout U02624

4. Makah USA Coho salmon U02630

M protein

5. Makah USA Coho salmon U03503

6. 07-71 France rainbow trout U03502

G protein

7. NO-2007-50-385 Denmark rainbow trout EU547740

8. Dwb97-04 Germany rainbow trout EU708816

9. Datt107 Germany rainbow trout EU708734

10. Au917-04 Austria rainbow trout EU708733

11. Au28-95 Austria rainbow trout EU708729

12. JF00Ehi1 Japan Japanese flounder AB490792

13. BC99-001 Canada Pacific sardine DQ401195

14. BC99-010 Canada Pacific herring DQ401194

15. ME03 Canada Atlantic herring DQ401192

16. JP99Obama25 Japan Japanese flounder DQ401191

17. JP96KRRV9601 Japan Japanese flounder DQ401190

18. WA91Clearwater USA coho salmon DQ401189

19. BC99-292 Canada Atlantic salmon DQ401188

20. BC93-372 Canada Pacific herring DQ401186

21. BC98-250 Canada Atlantic salmon DQ401187

22. KRRV9822 Japan Japanese flounder AB179621

23. UK-MLA98/6PT11 North Sea Norway pout AY546632

24. UK-MLA98/6HE1 North Sea herring AY546631

25. UK-H17/5/93 North Sea, E. Shetland cod AY546630

26. UK-H17/2/95 North Sea, E. Shetland haddock AY546629

27. UK-860/94 Gigha, W Scotland turbot AY546628

28. SE-SVA32 Kattegat Bottom-living* AY546627

29. SE-SVA31 Kattegat herring AY546626

30. NO-A16368G Norway rainbow trout AY546621

31. IR-F13.02.97 Ireland turbot AY546620

32. GE-1.2 Georgia rainbow trout AY546619

33. FR-L59X France Eel AY546618

34. FR-2375 France rainbow trout AY546617

35. FI-ka422 Gulf of Bothnia rainbow trout AY546615

36. DK-200079-1 Denmark rainbow trout AY546613

37. DK-200098 Denmark rainbow trout AY546605

38. DK-9895174 Denmark rainbow trout AY546603

39. DK-2835 Denmark rainbow trout AY546585

40. DK-5123 Denmark rainbow trout AY546588

41. DK-5e59 Denmark dab AY546583

42. DK-1p8 Denmark herring AY546573

43. CH-FI262BFH Switzerland rainbow trout AY546571

44. AU-8/95 Austria rainbow trout AY546570

45. DK-1p52 Denmark sprat AY546576

46. AY167587 Korea olive flounder AY167587

47. Cod Ulcus UK Atlantic cod Z93414

48. Hededam Denmark rainbow trout Z93412

49. 96-43 UK Atlantic herring AF143862

50. Fil3 France rainbow trout Y18263

51. 02-84 France France Salmo trutta VHU28800

52. Makah USA Coho salmon VHU28747

53. FA281107 Norway rainbow trout EU481506

NV protein

54. DK-1p55 Baltic Sea Sprat DQ162801

55. DK-1p53 Baltic Sea herring DQ159195

56. DK-1p52 Baltic Sea Sprat DQ159194

57. DK-1p49 Baltic Sea rockling DQ159193

58. F1 Denmark rainbow trout U47848

59. 07-71 France rainbow trout U28746

60. Makah USA Coho salmon U28745

Complete genome

61. JF00Ehi1 Japan Japanese flounder AB490792

62. FA281107 Norway rainbow trout EU481506

63. Fil3 France rainbow trout NC_000855

64. KRRV9822 Japan Japanese flounder AB179621

65. Cod Ulcus UK Atlantic cod Z93414

66. Hededam Denmark rainbow trout Z93412

67. 96-43 UK Atlantic herring AF143862

68. 14-58 France rainbow trout AF143863

69. 07-71 France rainbow trout AJ233396

Rhabdoviruses Complete Genome

70. Rhabdovirus GenBank no.

71. Bovine ephemeral fever virus (BEFV) NC_002526

72. European bat lyssavirus (Bat) NC_009527

73. Northern cereal mosaic virus (Cereal) NC_002251

74. Lettuce necrotic yellows virus (Lettuce) NC_007642

75. Maize Fine streak virus NC_005974

76. Maize mosaic virus (MMV) NC_005975

77. Mokola virus NC_006429

78. Orchid fleck virus (OFV) NC_009609

79. Rabies virus NC_001542

80. Siniperca chuatsi rhabdovirus NC_008514

81. Spring viremia of carp virus (SVC) NC_002803

82. Sonchus yellow net virus (SYN) NC_001615

83. Taro vein chlorosis virus (Taro) NC_006942
NC_006942
NC_006942

84. Tupaia rhabdovirus NC_007020

85. Vesicular stomatitis virus (VSV) NC_001560

86. Infectious hematopoietic necrosis virus (IHNV) X89213

87. Hirame rhabdovirus (HIRRV) NC_005093

88. Snakehead rhabdovirus (SHRV) NC_000903

*Virus was isolated from pool of Pholis gunellus, Gobiidae species, Zoarces viviparous and Acanthocottus scorpius.

Results

Complete nucleotide sequence of the VHSV strain MI03GL

The entire genome of VHSV-MI03GL strain was amplified as six overlapping cDNA fragments that were cloned, and the DNA sequenced (Fig. 1). The complete genome sequence of VHSV-MI03GL comprises 11,184 nucleotides (nts) and contains six genes that encode the nucleocapsid (N) protein, the phosphoprotein (P), the matrix protein (M), the glycoprotein (G), the non-virion (NV) protein, and the large (L) protein (Fig. 1). The gene order is similar to other novirhabdoviruses, 3'-N-P-M-G-NV-L-5'. The genomic features and predicted proteins of the VHSV strain MI03GL are shown in Table 3. All the open reading frames (ORFs) are separated by untranslated sequences, known as gene junctions, whereas the untranslated regions at the 3'- and 5'- ends are known as the 'leader' and 'trailer', respectively. For example, the N gene is composed of 1,388 nts, and is located between 54 and 1441 nts from the 3'-end of the genomic RNA. The ORF of N gene is flanked by 113 nts and 60 nts of 5'- and 3'-untranslated regions (UTRs), respectively, and encodes a protein of 404 amino acids, with a calculated molecular weight (MW) of 44.0 kDa. Similarly the length, ORF, and UTRs of the P, M, G, NV, and L genes, encoding respective proteins with their calculated MW, are depicted in Table 3.

Figure 1.

Figure 1

Genetic map of the VHSV genome and cDNA clones used for sequence analysis. The location and relative size of the VHSV ORFs are shown; the numbers indicate the starts and ends of the respective ORFs. Six cDNA fragments (F1 to F6) were synthesized from genomic RNA by RT-PCR. The primers used for RT-PCR fragments are shown at the end of each fragment. The RNA genome is 11,184 nucleotides long and contains a leader (L) and trailer (T) sequences at its 3'-end and 5'-end, respectively. The coding regions of N, P, M, G, NV and L genes are separated by intergenic sequences, which have gene-start and gene-end signals.

Table 3.

Genomic features and predicted proteins of the VHSV strain MI03GL

S. No Gene Start End 5'UTR ORF 3'UTR Total Lengtha Protein Size (aa) MWb
1. Leader 1 53 53

2. N 54 1441 113 1215 60 1388 404 44.0

3. P 1444 2203 57 669 34 760 222 24.4

4. M 2206 2946 81 606 54 741 201 22.3

5. G 2949 4556 33 1524 51 1608 507 56.9

6. NV 4559 4979 21 369 31 421 122 13.6

7. L 4982 11068 94 5955 38 6087 1984 224.1

8. Trailer 11069 11184 116

a Total length of a gene including 5'UTR, ORF and 3'UTR

b Predicted molecular weight of proteins in kilodaltons (kDa)

Genomic termini and untranslated sequences

Rhabdoviruses have conserved untranslated regions between open reading frames for optimal translation of viral proteins [15]. These sequences consist of a putative transcription stop/polyadenylation motif (UCUAUCU7), which signals reiterative copying of the U sequences to generate poly (A) tail to the mRNA. It is followed by an intergenic di-nucleotide GC or AC, which is not transcribed, and a putative transcription start signal, -CGUG- (Fig. 2A). All the genes contain these conserved gene end (GE), intergenic (IG) and gene start (GS) sequences, as shown in Fig. 2A.

Figure 2.

Figure 2

Analysis of the gene junctions and complementarities in the VHSV genome. A) Seven identified gene junctions of VHSV in the negative-sense of the genomic RNA are shown. 3'/N, junction of 3'-leader and nucleocapsid gene; N/P, junction of nucleocapsid and phosphoprotein gene; P/M, junction of phosphoprotein and matrix gene; M/G, junction of matrix and glycoprotein gene; G/NV, junction of glycoprotein and non-virion gene; NV/L, junction of non-virion and polymerase gene; L/5'-, junction of polymerase gene and 5' trailer. GE = Gene end; IG = Intergenic di-nucleotide; GS = Gene start. B)Complementarities of the 3'- and 5'-ends of the VHSV genome. The first 4 nucleotides of 3'-end are complementary to the 5'-end nucleotides of genomic RNA, except an additional uracil (U) residue at the 5'-terminal.

Like other rhabdoviruses, the genomic termini of VHSV 3'-terminal nucleotides exhibit complementarities to the nucleotides of the genomic 5'-terminus. Figure 2B shows that the first 4 nucleotides of 3'-end are complementary to the 5'-end nucleotides of genomic RNA, with the exception of an additional uracil (U) residue at the 5'-terminal. The complementary nature of genomic termini allows a formation of a panhandle structure, which is important for replication of rhabdoviruses.

Homology and phylogenetic analysis

The percent nucleotide and deduced amino acid sequence identities of VHSV-MI03GL with known VHSV strains and other rhabdoviruses were determined by Vector NTI program and the results are shown in Tables 4 and 5, respectively. The complete genome comparison of MI03GL with other VHSV strains reveals a close relationship with two Japanese strains, which were isolated from Japanese flounder [JF00Ehi1 (96%) and KRRV9822 (95%)]. Other VHSV strains are only 86-87% identical to the MI03GL strain (Table 4). Similarly, the complete genome comparison of MI03GL strain with different members of Rhabdoviridae family shows 30-35% identity, but among novirhabdoviruses, it exhibits 56% identity with infectious hematopoietic necrosis virus (IHNV) and 62% with snakehead rhabdovirus (SHRV), as shown in Table 5. Also in novirhabdoviruses, it is evident that non-virion protein (which is absent in other rhabdoviruses) is highly variable than any other region of the genome, showing only 16-17% identity.

Table 4.

Percent (%) nucleotide or deduced amino acid sequence identity of the Great Lakes VHSV-MI03GL with other VHSV strains a, b, c

VHSV Strains 3'UTR¥ N P M G NV L 5'UTR¥ Complete
Genome¥
07-71 95 92 90 97 93 73 78 79 86

Fi13 95 92 93 96 93 74 96 80 87

FA281107* 95 92 94 96 94 72 96 76 87

JF00Ehi1 96 96 100 98 96 89 99 90 96

KRRV9822 94 97 94 98 95 90 96 87 95

14-58 - 93 93 96 94 74 96 - 87┼

96-43 - 93 94 98 93 75 97 - 87┼

Cod Ulcus - 93 94 97 94 74 97 - 87┼

Hededam - 93 94 97 94 76 97 - 87┼

Makah - 94 98 98 96 92 - - -

DK-1p49 - - - - - 72 - - -

DK-1p53 - - - - - 72 - - -

DK-1p55 - - - - - 72 - - -

DQ159194 - - - - - 72 - - -

a bold letters in rows and columns indicates VHSV strains and VHSV proteins showing highest identity with MI03GL strain

b¥ only nucleotide sequences were used for analysis

c *termini sequences were incomplete; ┼ only coding sequences were available for comparison; (-) denotes that sequences are not available

Table 5.

Percent (%) nucleotide or deduced amino acid sequence identity of the VHSV strain MI03GL with other rhabdoviruses

Rhabdoviruses 3'UTR¥ N P M G NV L 5'UTR¥ Complete
genome¥
BEFV 39 8 12 8 13 NA 13 36 32

Cereal 27 11 9 8 10 NA 13 28 30

Bat 38 9 11 10 18 NA 15 32 35

Maize Fine streak 31 8 8 10 7 NA 13 32 30

Lettuce 27 11 11 8 8 NA 12 38 30

MMV 30 10 14 10 8 NA 13 25 32

Mokola 41 10 8 12 19 NA 14 38 34

OFV 27 8 7 2 7 NA 13 32 NA

Rabies 38 10 11 9 16 NA 15 34 35

Siniperca 34 8 7 8 13 NA 15 30 31

SVC 35 9 8 5 17 NA 14 35 34

SYNV 29 8 12 9 6 NA 13 22 30

Taro 26 10 12 9 10 NA 14 33 32

Tupaia 30 9 8 10 14 NA 15 44 31

VSV 38 9 8 5 13 NA 15 32 34

IHNV 35 40 35 36 38 16 60 35 56

HIRRV 32 39 34 38 38 17 59 34 56

SHRV 52 46 42 45 48 16 65 37 62

¥ Only nucleotide sequences were used for analysis

NA, not applicable

BEFV, Bovine ephemeral fever virus; Bat, European bat lyssavirus; MMV, Maize mosaic virus; Cereal, Northern cereal mosaic virus; Lettuce, Lettuce necrotic yellows virus; OFV, Orchid fleck virus; SYNV, Sonchus yellow net virus; SVC, Spring viremia of carp virus; Taro vein chlorosis virus (Taro); VSV, Vesicular stomatitis virus; IHNV, Infectious hematopoietic necrosis virus; HIRRV, Hirame rhabdovirus; SHRV, Snakehead rhabdovirus.

-Viruses belonging to Novirhabdovirus genus are in bold letters

Figure 3 shows the phylogenetic trees generated by comparing the deduced amino acid sequences of VHSV strains and other rhabdoviruses belonging to Rhabdoviridae family. Phylogenetic tree obtained by comparing the deduced amino acid sequences of VHSVs shows that MI03GL strain is closely related to the Japanese strains, JF00Ehil and KRRV9822 (Fig. 3A), whereas phylogenetic tree obtained by comparing the deduced amino acid sequences of known rhabdoviruses reveals that viruses belonging to the same genera of Vesiculovirus, Lyssavirus, Ephemerovirus, Novirhabdovirus, Cytorhabdovirus, and Nucleorhabdovirus would form separate clusters (Fig. 3B).

Figure 3.

Figure 3

Phylogenetic tree analysis of the deduced amino acid sequences of VHSV (A) and various other rhabdovirus genomes (B). Information about the VHSV strains and rhabdoviruses sequences used in this analysis is described in Table 2. Rhabdoviruses belonging to the same genus are circled in B. Novirhabdovirus (Blue); Lyssavirus (Red); Vesiculovirus (Orange); Cytorhabdovirus (Teal); Nucleorhabdovirus (Black); BEFV-Ephemerovirus; Siniperca-unclassified rhabdovirus. Phylogenetic tree analysis was conducted by neighbor-joining method using 1000 bootstrap replications. The scale at the bottom indicates the number of substitution events and bootstrap confidence values are shown at branch nodes.

Figure 4 shows the phylogenetic trees formed by comparing the deduced amino acid sequences of MI03GL strain N, P, M, NV and L proteins with other VHSV strains, in which it is apparent that MI03GL proteins clusters with JF00Ehi1, KRRV9822 and Makah VHSV strains, except the L protein. Figure 5 shows the phylogenetic tree obtained by comparing 48 glycoprotein gene sequences of different VHSV strains, in which MI03GL clusters with subtype IVa members but forms a distinct clade, IVb.

Figure 4.

Figure 4

Phylogenetic tree analysis of the deduced amino acid sequences of nucleocapsid (N), matrix (M), phosphoprotein (P), non-virion protein (NV) and polymerase protein (L) of various VHSV strains. Information about the VHSV strains used in this analysis is described in Table 2. Phylogenetic tree analysis was conducted by neighbor-joining method using 1000 bootstrap replications. The scale at the bottom indicates the number of substitution events and bootstrap confidence values are shown at branch nodes.

Figure 5.

Figure 5

Phylogenetic relationship of the full-length glycoprotein (G) sequences of 48 VHSV strains. Genotypes and sublineages are depicted by bold vertical lines, as described by Einer-Jensen et al. (2004) and Elsyad et al., 2006. The Great Lakes strain MI03GL (circled) forms different sublineage IVb, whereas rest of the North American VHSV isolates falls under sublineage IVa. Data of virus isolates used here are shown in Table 2. Phylogenetic tree analysis was conducted by neighbor-joining method using 1000 bootstrap replications. The scale at the bottom indicates the number of substitution events and bootstrap confidence values are shown at branch nodes.

Discussion

The Great Lakes strain of VHSV (MI03GL) was isolated from muskellunge, Esox masquinongy (Mitchill), in 2003 from Lake St. Clair, Michigan, USA. Previously, only G and N protein gene sequences for MI03GL strain were available and sequence analysis of the G gene revealed that it is closely related to the North American genotype IVa but distinct from the three European genotypes [11]. To fully understand the molecular characteristics of the Great Lakes VHSV, we determined the complete genome sequence of MI03GL strain. The genome is 11,184 nts long and the gene organization (N, P, M, G, NV and L) is similar to all members of the Novirhabdovirus genus. The termini of the viral genome have conserved sequences at the 3'-end (CAUAG/UU) and 5'-end (G/AAUAUG) as other members of the Novirhabdovirus genus. The first 4 nt of the leader sequence VHSV are complementary to the last 4 nt sequence of the trailer region (Fig 2B). The length of the 3' leader of MI03GL is 53 nts, which is similar to SHRV but slightly shorter than IHNV and hirame rhabdovirus (HIRRV; 60 nts). VHSV has the longest 5' trailer (116 nts) than other novirhabdoviruses, such as SHRV (42 nts), IHNV (102 nts), and HIRRV (73 nts). It is possible that the difference in length of trailer sequences may have some functional significance, which remains to be seen.

All the genes of VHSV start with a conserved gene start sequence (-CGUG-) like other novirhabdoviruses, followed by an ORF and conserved gene-end sequence (A/GUCUAU/ACU7). All the genes end with 7 uracil (U) residues, which are poly adenylation signal for polymerase when it transcribes a gene. Polymerase adds poly (A) by stuttering mechanism [16]. After this poly (A) signal, there are two conserved intergenic di-nucleotides (G/AC), which are untranscribed and act as spacers between the two genes. Polymerase skips these two nucleotides to next gene-start sequence and starts transcribing the next gene [16]. Transcription of rhabdovirus mRNAs is regulated by cis-acting signals located within the 3' leader region and untranslated region between each gene ORF [17-20]. The Kozak context for each gene is conserved and all the genes have adenosine (A) nucleotide at -3 position before the start codon (data not shown). Among all the genes, L gene has the optimal Kozak context (-ACCATGG-) as only few copies of the L mRNA are produced inside the cell, and every single mRNA has to be utilized efficiently to make polymerase protein that is essential for both replication and transcription.

Comparison of the available VHSV sequences indicates the presence of 5 highly variable regions (HVRs) in the N protein: I, 38-54; II, 76-87; III, 98-131; IV, 367-375 and V, 391-393. Phylogenetic tree of the N protein shows clustering of MI03GL, JF00Ehil, KRRV9822 and Makah strains. The major variation between MI03GL and rest of above said three strains is in HVR I and IV (data not shown). The N-terminal half of the P protein of VHSV is highly variable, whereas C-terminal half is conserved. Phylogenetic tree of the P protein shows clustering of MI03GL, JF00Ehil and Makah strains. The strain isolated from Japanese flounder, JF00Ehil is 100% identical to the MI03GL. The highly conserved nature of phosphoprotein demonstrates its importance in viral replication. The matrix (M) protein is an important structural component of virions, forming a layer between the glycoprotein containing outer membrane and the nucleocapsid core. Matrix protein of VHSV is highly conserved than any other protein. VHSV strains used in this study exhibit very close (96-98%) identity with MI03GL. In phylogenetic analysis, JF00Ehil, KRRV9822 and Makah strains form a cluster, which is 99-100% identical to each other, and 98% identical to MI03GL. Matrix protein of rhabdovirus is involved in viral assembly, condensation of nucleocapsid, formation of bullet-shaped virion [21,22] and induces apoptosis by shutdown of host cell machinery in infected cells [23,24]. Because it is highly essential for assembly and release of virions, the matrix protein maintains highest homology between VHSV strains than any other protein.

The non-virion protein (NV) of VHSV shows greatest genetic diversity than any other proteins of VHSV (Table 4). It was demonstrated that NV-knockout IHNV replicates very slowly in cell culture and is non-pathogenic in fish [25]. On the contrary, NV-knockout SHRV replicates very well as wild-type virus and it was shown that NV protein of SHRV is not essential for pathogenesis [26]. These studies suggested that each species of Novirhabdovirus genus has its own characteristics and one can not ignore the importance NV in pathogenesis. The wide host-range for VHSV suggests that the tropism and the pathogenicity not only reside in glycoprotein gene, but also in other genes, especially the NV gene. The L protein displays the highest level of sequence homology among members of various genera of Rhabdoviridae family (Table 5). All the available L sequences for VHSV strains show highest conservation (98%) as that of the matrix protein.

Genomic comparison of VHSV strains isolated from various marine species from different parts of the world sheds light on the correlation of genetic sequences with viral tropism and pathogenicity. The glycoprotein is believed to be involved in virulence and tropism because of it's involvement in viral attachment and cell entry [27]. Comparison of the glycoproteins of various VHSV strains has revealed only few blocks of conserved region (data not shown). The regions between residues 53-70; 140-156; 232-253 and 389-413, are highly conserved and the rest of the region shows genetic variations which are scattered all over the protein. The major neutralizing epitopes have been mapped to two antigenic sites for IHNV, at amino acids 230-231 and 272-276 [28,29]. In this analysis, we found no amino acid substitutions at positions 230-231 among 48 strains compared, except two. On the other hand, residues 270-281 are highly variable, which supports earlier findings and suggests the involvement of this site in antigenic variation and virulence [30].

In phylogenetic analysis of the G proteins, MI03GL forms a separate branch in genotype IVa (Fig. 5) and is sub-typed as IVb, as demonstrated earlier [11]. Although JF00Ehil, KRRV9822 and Makah strains maintain close identity with MI03GL, they are sub-typed as IVa. The genogroups of VHSV are determined based on the restriction fragment length polymorphism patterns of the G protein [31]. Makah maintains a close identity with Japanese JF00Ehil (99%) and KRRV9822 (98%), and North American isolates (99%). Phylogenetic tree of the G protein explicitly demonstrates the relationship of Makah strain with members of genotype IV. Makah strain isolated from Coho Salmon in 1988 from Washington, USA was grouped under genotype IVa [31]. Rests of the North American strains belonging to genotype IVa were isolated in different time periods (1991-2003) [11], and Japanese strains were isolated around year 2000. Isolates of genotype IV have been recovered mainly in North America, Japan and Korea [31,32] but not in Europe where genotypes I, II and III are prevalent. It was suggested that VHSV strains circulating in a defined geographical area have a remarkably conserved G gene, regardless of the elapsed time or the different host species [33]. These earlier reports and the current study suggests that the genotype IV strains of VHSV probably originated from North America and possible ancestor for isolates of genotype IV might be Makah. This suggests that MI03GL might have diverged from Makah and evolved independently thereafter. To date, among VHSV strains, MI03GL strain is the only member of the genotype IVb.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

VNV conceived the study. AA planned the experimental design and carried out cloning and sequencing. AA drafted the manuscript. All authors critically reviewed and approved the final manuscript.

Acknowledgments

Acknowledgements

We thank Dr. Gael Kurath for kindly providing the VHSV-MI03GL genomic RNA and William N Batts for technical assistance.

Contributor Information

Arun Ammayappan, Email: ammayapp@umbi.umd.edu.

Vikram N Vakharia, Email: vakharia@umbi.umd.edu.

References

  1. Schlotfeldt HJ, Ahne W. Epizootics in brown trout (Salmo trutta fario) caused by VHSV-F1. J App Ichthyol. 1988;4:147–148. doi: 10.1111/j.1439-0426.1988.tb00554.x. [DOI] [Google Scholar]
  2. Hopper K. The isolation of VHSV from salmon at Glenwood Springs, Orcas Island, Washington. Am Fish Soc Fish Health News. 1989;17:1. [Google Scholar]
  3. Schlotfeldt HJ, Ahne W, Vestergard-Jorgensen PE, Glende W. Occurrence of viral haemorrhagic septicaemia in turbot (Scophthalmus maximus)-a natural outbreak. EAFP Bull. 1991;11:105–7. [Google Scholar]
  4. Meyers TR, Sullivan J, Emmeneger E, Follet J, Short S, Batts WN. Identification of viral haemorrhagic septicemia virus isolated from pacific cod, Gadus macocephalus in prince William Sound, Alaska, USA. Dis Aquat Org. 1992;12:167–75. doi: 10.3354/dao012167. [DOI] [Google Scholar]
  5. Brudeseth BE, Evensen O. Occurrence of viral haemorrhagic septicemia virus (VHSV) in wild marine fish species in the coastal regions of Norway. Dis Aquat Org. 2002;52:21–28. doi: 10.3354/dao052021. [DOI] [PubMed] [Google Scholar]
  6. Tordo N, Benmansour A, Calisher C, Dietzgen RG, Fang RX, Jackson AO, Kurath G, Nadin-Davis S, Tesh RB, Walker P. The eighth report of the international committee for taxonomy of viruses. Academic Press, San Diego; 2004. Family Rhabdoviridae. [Google Scholar]
  7. Kurath G, Leong JA. Characterization of infectious hematopoietic virus mRNA species reveals a nonvirion rhabdovirus protein. J Virol. 1985;53:462–468. doi: 10.1128/jvi.53.2.462-468.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Schütze H, Enzmann PJ, Mundt E, Mettenleiter TC. Identification of the non-virion (NV) protein of fish rhabdoviruses viral haemorrhagic septicaemia virus and infectious haematopoietic necrosis virus. J Gen Virol. 1996;77:1259–1263. doi: 10.1099/0022-1317-77-6-1259. [DOI] [PubMed] [Google Scholar]
  9. Schütze H, Mundt E, Mettenleiter TC. Complete genomic sequence of viral haemorrhagic septicemia virus, a fish rhabdovirus. Virus Genes. 1999;19:59–65. doi: 10.1023/A:1008140707132. [DOI] [PubMed] [Google Scholar]
  10. Betts AM, Stone DM. Nucleotide sequence analysis of the entire coding regions of virulent and avirulent strains of viral haemorrhagic septicemia virus. Virus Genes. 2000;20:259–262. doi: 10.1023/A:1008148813746. [DOI] [PubMed] [Google Scholar]
  11. Elsayed E, Faisal M, Thomas M, Whelan G, Batts W, Winton J. Isolation of viral haemorrhagic septicemia virus from muskellunge, Esox masquinongy (Mitchill), in Lake St. Clair, Michigan, USA reveals a new sublineage of the North American genotype. J Fish Dis. 2006;29:611–619. doi: 10.1111/j.1365-2761.2006.00755.x. [DOI] [PubMed] [Google Scholar]
  12. Haas RC. The muskellunge of Lake St. Clair. Vol. 11. American Fisheries Society Special Publication; 1978. pp. 334–339. [Google Scholar]
  13. Nicholas KB, Nicholas HBJ, Deerfield DW. GeneDoc: analysis and visualization of genetic variation. EMBNEW NEWS. 1997;4:14. [Google Scholar]
  14. Tamura K, Dudley J, Nei M, Kumar S. Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
  15. Schnell MJ, Buonocore L, Whitt MA, Rose JK. The minimal conserved transcription stop-start signal promotes stable expression of a foreign gene in vesicular stomatitis virus. J Virol. 1996;70:2318–2323. doi: 10.1128/jvi.70.4.2318-2323.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Banjerjee AK. Transcription and replication of rhabdoviruses. Microbiol Rev. 1987;51:66–87. doi: 10.1128/mr.51.1.66-87.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Wertz GW, Whelan S, LeGrone A, Ball LA. Extent of terminal complementarity modulates the balance between transcription and replication of vesicular stomatitis virus RNA. Proc Natl Acad Sci. 1994;91:8587–8591. doi: 10.1073/pnas.91.18.8587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Barr JN, Whelan SP, Wertz GW. cis-Acting signals involved in termination of vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the U7 signal for polyadenylation. J Virol. 1997;71:8718–8725. doi: 10.1128/jvi.71.11.8718-8725.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Barr JN, Wertz GW. Polymerase slippage at vesicular stomatitis virus gene junctions to generate poly(A) is regulated by the upstream 3'-AUAC-5' tetranucleotide: implications for the mechanism of transcription termination. J Virol. 2001;75:6901–6913. doi: 10.1128/JVI.75.15.6901-6913.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Whelan SP, Wertz GW. Regulation of RNA synthesis by the genomic termini of vesicular stomatitis virus: identification of distinct sequences essential for transcription but not replication. J Virol. 1999;73:297–306. doi: 10.1128/jvi.73.1.297-306.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Newcomb WW, Brown JC. Role of the vesicular stomatitis virus matrix protein in maintaining the viral nucleocapsid in the condensed form found in native virions. J Virol. 1981;39:295–299. doi: 10.1128/jvi.39.1.295-299.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mebatsion T, Weiland F, Conzelmann KK. Matrix protein of rabies virus is responsible for the assembly and budding of bullet-shaped particles and interacts with the transmembrane spike glycoprotein G. J Virol. 1999;73:242–250. doi: 10.1128/jvi.73.1.242-250.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Finke S, Conzelmann KK. Replication strategies of rabies virus. Virus Res. 2005;111:120–131. doi: 10.1016/j.virusres.2005.04.004. [DOI] [PubMed] [Google Scholar]
  24. Kassis R, Larrous F, Estaquier J, Bourhy H. Lyssavirus matrix protein induces apoptosis by a TRAIL-dependent mechanism involving caspase-8 activation. J Virol. 2004;78:6543–6555. doi: 10.1128/JVI.78.12.6543-6555.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Thoulouze MI, Bouguyon E, Carpentier C, Bremont M. Essential role of the NV protein of Novirhabdovirus for pathogenicity in rainbow trout. J Virol. 2004;78:4098–4107. doi: 10.1128/JVI.78.8.4098-4107.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Alonso M, Kim CH, Johnson MC, Pressley M, Leong JA. The NV gene of snakehead rhabdovirus (SHRV) is not required for pathogenesis, and a heterologous glycoprotein can be incorporated into the SHRV envelope. J Virol. 2004;78:5875–5882. doi: 10.1128/JVI.78.11.5875-5882.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Bearzotti M, Monnier AF, Vende P, Grosclaude J, de Kinkelin P, Benmansour A. The glycoprotein of viral hemorrhagic septicemia virus (VHSV): antigenicity and role in virulence. Vet Res. 1995;26:413–422. [PubMed] [Google Scholar]
  28. Huang C. PhD thesis. University of Washington, Seattle, USA; 1993. Mapping of antigenic sites of infectious hematopoietic necrosis virus glycoprotein. [Google Scholar]
  29. Kim CH, Winton JR, Leong JC. Neutralization-resistant variants of infectious hematopoietic necrosis virus have altered virulence and tissue tropism. J Virol. 1994;68:8447–8453. doi: 10.1128/jvi.68.12.8447-8453.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Benmansour A, Basurco B, Monnier AF, Vende P, Winton JR, de Kinkelin P. Sequence variation of the glycoprotein gene identifies three distinct lineages within field isolates of viral haemorrhagic septicaemia virus, a fish rhabdovirus. J Gen Virol. 1997;78:2837–2846. doi: 10.1099/0022-1317-78-11-2837. [DOI] [PubMed] [Google Scholar]
  31. Einer-Jensen K, Winton J, Lorenzen N. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms. Vet Microbiol. 2005;106:167–178. doi: 10.1016/j.vetmic.2004.12.008. [DOI] [PubMed] [Google Scholar]
  32. Snow M, Cunningham CO, Melvin WT, Kurath G. Analysis of the nucleoprotein gene identifies distinct lineages of viral haemorrhagic septicaemia virus within the European marine environment. Virus Res. 1999;63:35–44. doi: 10.1016/S0168-1702(99)00056-8. [DOI] [PubMed] [Google Scholar]
  33. Stone DM, Way K, Dixon PF. Nucleotide sequence of the glycoprotein gene of viral haemorrhagic septicaemia (VHS) viruses from different geographical areas: a link between VHS in farmed fish species and viruses isolated from North Sea cod (Gadus morhua L.) J Gen Virol. 1997;78:1319–1326. doi: 10.1099/0022-1317-78-6-1319. [DOI] [PubMed] [Google Scholar]

Articles from Virology Journal are provided here courtesy of BMC

RESOURCES