Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Nov 3.
Published in final edited form as: Ann Clin Lab Sci. 2009 Summer;39(3):251–262.

Truncation of Histone H2A’s C-terminal Tail, as is Typical for Ni(II)-assisted Specific Peptide Bond Hydrolysis, has Gene Expression Altering Effects

Aldona A Karaczyn 1,2,*, Robert Y S Cheng 3,*, Gregory S Buzard 4, James Hartley 5, Dominic Esposito 5, Kazimierz S Kasprzak 1
PMCID: PMC2772094  NIHMSID: NIHMS150653  PMID: 19667409

Abstract

Nickel(II), capable of transforming cells and causing tumors in humans and animals, has been previously shown by us to mediate hydrolytic truncation of histone H2A’s C-terminal tail by 8 amino acids in both cell-free and cell culture systems. Since H2A’s C-tail is involved in maintaining chromatin structure, such truncation might alter this structure and affect gene expression. To test the latter possibility, we transfected cultured T-REx 293 human embryonic kidney cells with plasmids expressing either wild type (wt) or truncated (q) histone H2A proteins, which were either untagged or N-terminally tagged with fluorescent proteins. Each histone variant was found to be incorporated into chromatin at 24 and 48 hrs post-transfection. Cells transfected with the untagged plasmids were tested for gene expression by microarray and real-time PCR. Evaluation of the results for over 21 000 genes using the multidimensional scaling and hierarchical clustering methods revealed significant differences in expression of numerous genes between the q-H2A and wt-H2A transfectants. Many of the differentially expressed genes, including BAZ2A, CLDN18, CYP51A1, GFR, GIPC2, HMGB1, IRF7, JAK3, PSIP1, and VEGF are cancer-related genes. The results thus demonstrate the potential of q-H2A to contribute to the process of carcinogenesis through epigenetic mechanisms.

Keywords: Histone H2A, Nickel, Gene Expression

Introduction

Our previous studies have revealed that nickel(II) is capable of inducing a specific hydrolytic truncation of histone’s H2A C-terminal tail in both cell-free and cultured cell systems [1-3]. In general, histone tails play a major role in assembling chromatin via inter-nucleosomal and inter-protein interactions [4, 5]. Known covalent modifications of histone tails, including acetylation, methylation, phosphorylation, ubiquitination, sumoylation, deimination, and others affect the interlocking interactions of histones with each other and with DNA (mainly the extranucleosomal linker DNA [6], which in turn affect the chromatin structure. This eventually leads to the opening or closing of access of transcription factors to the DNA that is critical to regulating gene expression [7-13]. The “core” histones all have N-terminal tails, but histone H2A is unique in having a protruding tail at both the N- and C-termini. The roles of the N-terminal tails and their modifications in the regulation of chromatin assembly and gene expression have been studied quite extensively [9-11, 14]. However, the physiological role of the C-terminal tail of the major variant of histone H2A has received much less attention. Footprinting and cross-linking experiments have shown that the C-terminal tail participates in building the higher-order structures of chromatin; in particular, the end of this tail interacts with histone H2B [15] and linker DNA [16]. Thus, the removal of the 8 terminal amino acids of this tail, 5 of them being positively charged lysine and histidine residues, observed in Ni(II)-exposed cells has the potential to affect chromatin compaction and thus gene expression. To test for the latter outcome, in the present study, we have transfected cells with plasmids carrying either the Ni(II)-truncated version of histone H2A or a full-length H2A, and using the high-throughput profiling technique, we have compared the whole genome expression profile of these cells. Our results indicate that the truncation of H2A did indeed significantly alter the pattern of gene expression in the transfected cells.

Materials and Methods

Histone clones

Histone clones were generated by site-specific recombination using the Gateway System [17]. The following four plasmids, derived from a human histone H2A plasmid were cloned: 1.) q-H2A; 2.) q-H2A tagged with red fluorescent protein at its N-terminus (mRFP-q-H2A); 3.) wild-type H2A (wt-H2A); and 4.) wt-H2A tagged with green fluorescent protein at its N-terminus (eGFP-wt-H2A).

Oligonucleotides and plasmids

pDonr223 is a Gateway Donor vector modified from pDonr201 (Invitrogen, Carlsbad, CA). pDonr223 replaces the kanamycin resistance gene with a gene encoding spectinomycin resistance, and contains several sequencing primer sites to aid in the sequence verification of Entry Clones. pDest-732 is a Gateway Destination vector modified from the Tet-inducible pDest-30 vector (Invitrogen) by addition of an aminoterminal eGFP fusion upstream of the attB1 recombination site. pDest-733 is a Gateway Destination vector modified from the Tet-inducible pDest-30 vector (Invitrogen) by addition of an amino-terminal mRFP1 fusion [18] upstream of the attB1 recombination site. The following oligonucleotides (synthesized by Operon, Inc. Huntsville, AL) were used in this study: L456: 5′-GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGGTCGCGGCAAACAAGGCG- 3′ L457: 5′-GGGGACAACTTTGTACAAGAAAGTTGGCTACTACTTTCCCTTGGCCTTATGATGGCTCTC-3′ L458: 5′-GGGGACAACTTTGTACAAGAAAGTTGGCTACTACTCAGTTTTCTTAGGCAGCAGCACC-3′

Cloning of histone H2A entry clones

The human H2A gene was re-cloned by PCR from the plasmid AAH-pET17xb (a generous gift of Dr. W. Bonner, NCI Laboratory of Molecular Pharmacology, Bethesda MD) [19]. Wt-H2A was cloned with primers L456 and L457. Truncated q-H2A, (lacking the last eight C-terminal amino acids SHHKAKGK of wt-H2A) was cloned with primers L456 and L458. All PCR amplifications used Platinum Taq HiFidelity DNA polymerase (Invitrogen) and were performed for 20 cycles under standard conditions with a 0.5 minute extension time. The final PCR products contained the H2A genes with a 5′-Kozak sequence for translation initiation (ACC), and were flanked by two Gateway recombination signal sequences, attB1 at the 5′ end and attB2 at the 3′ end. The PCR products were purified using a QiaQuick PCR purification kit (Qiagen, Valencia, CA), and recombined into pDonr223 using the Gateway BP recombination reaction (Invitrogen) according to the manufacturer’s protocols. BP reactions were transferred into E. coli DH5α cells (Invitrogen), and colonies were isolated on Luria-Bertani agar plates containing 50 μg/ml spectinomycin. Plasmid DNA was isolated and then sequenced using internal and external sequencing primers to confirm that the desired sequences had been cloned.

Subcloning of histone H2A genes into mammalian expression vectors

The sequence-verified Entry Clones were next subcloned by Gateway LR recombination into three expression vectors, pDest-30, pDest-732, and pDest-733, using the manufacturer’s instructions (Invitrogen). Vectors contained the CMV promoter for mammalian expression under the control of the tetracycline operator, which allows induction of expression only in the presence of tetracycline. To express the native (untagged) H2A histones, Entry Clones for wt-H2A and q-H2A were introduced into pDest-30 to obtain the 065-X1-30 and 065-X2-30 plasmids for the wt-H2A and q-H2A, respectively. To express the tagged H2A histones, the wt-H2A Entry Clone was transferred to pDest-732 to create an amino-terminal eGFP-wt-H2A fusion protein plasmid (065-X1-732), and the q-H2A Entry Clone was transferred to pDest-733 to create an amino-terminal mRFP1-q-H2A fusion protein plasmid (065-X2-733). Final expression clones were verified by size and restriction enzyme digestion pattern. Cell-culture transfection-quality DNA was prepared for all expression clones using the EndoFree Midi Plasmid Kit (Qiagen).

Cell culture

T-REx 293 human embryonic kidney cells (ATCC # CRL-1573), stably expressing the Tet repressor, were cultured at 37 °C, under 5% CO2-containing air in DMEM medium (Biofluids, Rockville, MD) with 10% fetal bovine serum (HyClone, Logan, UT), 2 mM L-glutamine (Biofluids) and 5 μg/ml blasticidin S (Invitrogen).

Transfections

Cells growing in 52 cm2 flasks were transfected at 70% confluence with wt-H2A and q-H2A plasmids, tagged or untagged, using SuperFect (Qiagen) transfection reagents according to manufacturer’s protocol. Transfections were performed in quadruplicate for each plasmid. Just prior to transfection, aliquots containing 10 μg of DNA of a plasmid were diluted with OPTI-MEM (Invitrogen) growth medium containing no serum, proteins, or antibiotics, to a total volume of 0.3 ml each. SuperFect transfection reagent was then added to the plasmid solution and vortexed for 10 sec. Mixtures were incubated for 10 min at room temperature. While complex formation took place, cells were washed once with PBS and 4.6 ml of fresh DMEM medium was added. One ml of the same medium was then added to the reaction tube containing the transfection complex and such diluted complex was immediately transferred to the cells. The cells were finally incubated with the transfection complex overnight under their normal growth conditions. After 18 hr the transfection medium was replaced with fresh DMEM medium and cells were induced with 2 μg/ml of tetracycline (Invitrogen) to express their plasmids as proteins. Cells were harvested at 24 and 48 hours after tetracycline induction and analyzed as described below.

Testing the nuclear incorporation of wt-H2A and q-H2A

To verify the incorporation of q-H2A into chromatin and to assess the efficiency of transfection, samples of cells were subjected to Western blotting and were also analyzed by confocal microscopy. Nuclear histones were extracted with 0.5 M HCl [20] from cells transfected with either the q-H2A or wt-H2A plasmids. Extracted histones were separated by gel electrophoresis in 10% NuPage SDS Bis-Tris gels (Invitrogen) under reducing conditions provided by 10% v/v β-mercaptoethanol. Aliquots of nuclear extracts containing 10 μg of total protein (as determined by the Bradford method) were loaded on the gel and separated in 2-(-N-morpholino)ethano-sulfonic acid (MES) running buffer at 70-100 V for 2.5-3 hours. Proteins resolved by gel electrophoresis were transferred onto a nitrocellulose membrane (Amersham Biosciences, Piscataway NJ) in 25 mM AMPSO ([3-[(1,1-dimethyl-hydroxyethyl)amino]-2-hydroxypropane-sulfonic acid] buffer, pH 9.5, at 30 V for 1.5 hr at 4°C. Primary rabbit anti-H2A antibodies (Upstate, Charlottesville VA), followed by secondary anti-rabbit antibodies labeled with horseradish peroxidase (Cell Signaling Technology, Danvers MA) were applied for histone H2A detection on the membrane. Super Signal (Pierce, Rockford IL) reagents were then used for visualization of the luminescent signal. Confocal microscopy was employed to verify incorporation of the expressed eGFP-wt-H2A and mRFP-q-H2A histone proteins into chromatin.

Microarray analysis

Total RNA to be used for the microarray analysis was extracted from cultures transfected with untagged wt-H2A and q-H2A plasmids using an RNAEasy Mini-kit and a QiaShredder kit (Qiagen). The human oligo microarray chips were from the NCI Microarray Core Facility (Advanced Technology Center, NCI, Gaithersburg, MD). Quality- and quantity-checked RNAs were amplified and labeled with Cy dye by using the FairPlay Microarray Labeling Kit (Stratagene, La Jolla CA). Microarray chips were stringently washed after 18 hours hybridization. Array images were captured through a GenePix 4000B microarray scanner and quantified by the GenePix software version 5 (Molecular Devices, Sunnyvale, CA).

Microarray data were exported to BRB-Array Tools (CIT, NIH, Bethesda MD) with all default settings on. All samples were measured against the Universal Human Reference RNA (UHRR) standard (Stratagene). Each chip was globally normalized by the median values of two Cy dye channels to minimize chip-to-chip variations.

Evaluation of the microarray data

An analytical non-supervised learning approach was adopted for this study, it included Multidimensional Scaling (MDS) in which hyperdimensional relationships were visualized in a compressed 3-dimensional view, and Hierarchical Clustering in which various linkage methods and distance measuring algorithms were used to explore the data set in a two-dimensional view. Data were also evaluated statistically using a computerized selection of genes whose median expression (all repeats) differed by a factor of at least 4 between the cells transfected with q-H2A versus cells transfected with wt-H2A.

Real-time PCR analysis

The expression of genes showing significant differences by microarray analysis was quantified by real-time PCR for confirmation. Primers for each gene were designed using a Primer3 online primer designing tool (MIT, Boston MA). In brief, 2 μg of total RNA from each sample were converted to cDNA in a Sprint PowerScript Hexamer PrePrimed real time PCR tube (20 ul final volume; Clontech, Mountain View, CA) at 42°C for 90 min. Then 10 μl of 2X Quantitect SYBR Green Master Mix (Qiagen) and 2 μl of cDNA products were mixed with 10 pmole of a target-gene primer pair (Table 1). The real-time PCR conditions followed the manufacturer’s (Qiagen) instructions. 18S RNA (Forward: GATGATCCGGAAGATGAAGC, Reverse: CGCAGTGCACATACCTTCAG, Amplicon size: 117 bp) served as an internal and amplification control. A template-free reaction was run as a negative control. Control cDNAs generated from the Universal Human Reference RNA (UHRR) (Invitrogen) were serially diluted and amplified with each primer pair to ensure they had similar amplification efficiency.

Table 1.

Primers used for confirmation of selected gene expression changes by real-time PCR

BAZ2A-1F TGCTTTGTGATGGGTGTGAC
BAZ2A-1R CTGCTGAGCCAAACAGACAG
CLDN18-1F GTCTGTGTTTGCCAACATGC
CLDN18-1R GGTCTGAACAGTCTGCACCA
CYP51A1-1F GAGCTCATCGGGAAATCAAG
CYP51A1-1R CGCCCATCCTTGTATGTAGC
GFR-1F TCACAGCAAAGGTCGATGAG
GFR-1R CAGCTCTTGCTCGTGAATTG
GIPC2-1F CTTCGCCTGAGATCAAAAGG
GIPC2-1R TCAAACATTGTGGTGGCTAAA
HMGB1-1F TAAGAAGCCGAGAGGCAAAA
HMGB1-1R GCAGACATGGTCTTCCACCT
IRF7-1F TACCATCTACCTGGGCTTCG
IRF7-1R AGGGTTCCAGCTTCACCAG
JAK3-1F TCTCAAGGAGCAGGGTGAGT
JAK3-1R GTAGGCAGGCCTTGTAGCTG
PSIP1-1F ACTCCAAAAGCTGCCAGAAG
PSIP1-1R TAGCTGCAGGTCGTCCTCTT
VEGF-1F TCTTCAAGCCATCCTGTGTG
VEGF-1R ATCTGCATGGTGATGTTGGA

Amplicons were visually examined on 2.2% agarose gel to ensure no non-specific amplifications. All real-time PCRs were amplified in a Bio-Rad IQ Real-time PCR Detection System and the data were exported to Microsoft Excel for delta-delta Ct (Relative Expression Level) computation.

Results

The H2A histone variants, both tagged and untagged, were expressed and incorporated into the chromatin of cells transfected with the corresponding plasmids (Figs. 1 and 2). As can be seen in Fig. 1, the proportion of cellular q-H2A incorporated into the histone H2A nuclear pool was reproducible. The fluorescent tags did not reveal any conspicuous qualitative differences in the spatial distribution within cell nuclei between the wild-type and truncated variants of H2A (not shown). The same was true for chromatin visualized by confocal microscopy in dividing cells (Fig. 2). These results thus confirm the previous findings of Ivanova and Bonner [19] and Reeves R et al. [21] indicating that truncated histone H2A can be expressed and incorporated into functional chromatin of cultured cells.

Fig. 1.

Fig. 1

Western blot analysis of the wild type (wt-H2A) and truncated (q-H2A) histones H2A isolated from cell nuclei 24 hr post-induction; in quadruplicates.

Fig. 2.

Fig. 2

Confocal microscopic images of the tagged wild type (wt-H2A, green) and truncated (q-H2A, red) histones H2A incorporated into cell nuclei 48 hr post-induction.

The Multidimensional Scaling analysis of the genes (> 21,000) on a chip enabled us to depict their expression in a compressed hyperdimensional view. This approach disclosed that the four experimental groups (2 plasmids at 2 time points) formed their own clusters, without any overlap, in a three-dimensional view (Fig. 3). Thus, at each time point there were significant differences in gene expression between wt-H2A- and q-H2A-transfected cells.

Fig. 3.

Fig. 3

A three-dimensional screen capture of the Multi-Dimensional Scaling analysis of the microarray results showing the formation of individual clusters with no overlap in global gene expression by cells expressing the wild type (wt-H2A) and truncated (q-H2A) histones at 24 and 48 hr post-induction.

The hierarchical clustering analysis, with complete linkage and centered correlation distance measuring algorithm, revealed that a set of 618 out of the > 21 000 genes showed at least a 2-fold difference in expression levels vs. the UHRR standard for both the q-H2A and wt-H2A transfectants. These could be separated into four clusters (Fig 4). Among them, cluster 2 represented lower expression of 224 genes in cells transfected with q-H2A relative to cells transfected with wt-H2A at both 24 and 48 hours post-transfection. At the same time, cluster 3 represented higher expression of another set of genes (113 genes) in q-H2A-vs. wt-H2A-bearing cells. The expression levels of genes forming clusters 1 (67 genes) and 4 (214 genes) differed between the two time points but not between q-H2A and wt-H2A transfectants at a given time, and were not evaluated any further. In cluster 2, 43% of the genes were encoding cell signaling molecules, followed by protein metabolism (19%), transcription factors (15%), proteins of unknown function (13%), and structural proteins (10%). In cluster 3 this distribution was different: the cell signaling genes constituted 15%, protein metabolism genes 21%, transcription factors 28%, and proteins of unknown function (26%); structural proteins constituted 10% of all genes. In cluster 2, the most prominent were genes coding for protein kinases COP9, PRKCG, and PRKCM; the UBE4B ubiquitination enzyme; and proteins involved in cell growth regulation, such as IL3, EDN1, and S100A3. The transcription factors expressed at the relatively highest levels in cluster 3 included the FGF5 fibroblast growth factor and the PSIP1 lens epithelium-derived growth factor. Two other important members of this cluster were AVEN, a caspase activation inhibitor, and LBR, a lamin B receptor.

Fig. 4.

Fig. 4

Gene expression levels (medoids calculated from replicates) in cells bearing the wild type (wt-H2A) and truncated (q-H2A) histones H2A for the four-cluster solution provided by the PAM method at 24 and 48 hr post-induction. The cluster numbers are given in the panels (see Results).

To further reduce the number of genes for subsequent analysis, the entire gene set was filtered for genes whose expression differed between the q-H2A and wt-H2A transfected cells by a factor of at least 4 in at least one time point. This resulted in selection of 76 and 39 genes for evaluation of the results at the 24 and 48 hr post-transfection points, respectively. Of these, at 24 hr post-transfection, expression of 53 genes was found to be higher in q-H2A cells while expression of 23 other genes was greater than four times lower in q-H2A than in wt-H2A cells (Table 2). At 48 hr post-transfection, expression of 33 genes was higher in q-H2A cells and expression of 6 genes was lower in q-H2A than in wt-H2A-transfected cells (Table 3). Among these genes were several known cancer-related genes whose differential expression was also examined by real-time PCR (Table 4). They were all tested at 24 and 48 hr post-transfection even if the microarray results indicated different expression at the desired 4-fold level only at one time point. As can be seen in Table 4, in most cases the PCR results confirmed the results of the microarray analysis.

Table 2.

Genes whose expression level in q-H2A-transfected cells was at least 4-fold higher or lower than in wt-H2A-transfected cells at 24 hr post-inductiona

A. q-H2A > wt-H2Ab
 1. ABCC5, ATP-binding cassette, sub-family C, member 5; involved in cellular export of cyclic nucleotides
 2. APOBEC3A, cytidine deaminase; an apolipoprotein B mRNA editing enzyme. Overexpression of enzymes
   of this family can cause cancer [54].
 3. CGI-60, dynein 2 light intermediate chain isoform 3; an ABC transporter nucleotide-binding domain.
 4. CTAG2, cancer and testis antigen 2; LAGe-1 isoform. A new gene with tumor specificity [55]
 5. CYP51A1, cytochrome P450 family member; lanosterol 14α-demethylase
 6. DAMS, antisense transcript to SMAD5 expressed in embryonal and tumor tissues
 7. DEFB127, defensin beta 127 important in the immunologic response to invading microorganisms
 8. ENTPD5, ectonucleoside triphosphate diphosphohydrolase 5; a proto-oncogene. Its expression enhances the
   invasiveness of prostate cancer cells [56] and is deregulated in human breast, testicular and laryngeal
   cancers [57, 58]
 9. FBXO29, F-box protein; member of the ubiquitin protein ligase SCFs complex
 10. FOXE1, forkhead box E1; a thyroid transcription factor 2. It is expressed in human epidermis and basal cell
   carcinoma [59].
 11. HMGB1, high mobility group box 1 involved in tissue inflammation, repair and regeneration [27]
 12. IL2RB, interleukin 2 receptor, beta involved in endocytosis and transduction of mitogenic signals from
   interleukin 2
 13. IRF7, interferon regulatory factor 7 implicated in the regulation of Epstein-Barr virus latency. It is
   hypermethylated in human lung cancer [47] and has oncogenic properties [45].
 14. JAK3, Janus kinase 3 involved in cytokine receptor-mediated intracellular signal transduction; promotes
   VEGF production in T-cell lymphomas [37].
 15. MGC33864, ADP-ribosylation-like factor 6 interacting protein 6
 16. MGC45400, transcription elongation factor A (SII)-like 8
 17. NDUFS7, NADH dehydrogenase (ubiquinone) Fe-S protein 7 associated with a variety of clinical
   phenotypes such as Leigh syndrome, encephalomyopathy and cardiomyopathy
 18. PDCD6, TNF superfamily member 6 (programmed cell death 6); participates in T cell receptor-, Fas-, and
   glucocorticoid-induced programmed cell death. It is upregulated in hepatomas and lung cancer [60] and in
   other cancers [61].
 19. PRIM1, DNA primase polypeptide 1; a component of chromosomal replication apparatus amplified in many
   pediatric osteosarcomas [62]
 20. PSIP1, a PC4 and SFRS1 interacting nuclear protein 1 involved in gene transcription and cell cycle. It is an
   oncogenic protein that controls a caspase-independent lysosomal cell death pathway [34].
 21. RBT1, RPA-binding trans-activator highly expressed in transformed cells [63]
 22. RPLP0, acidic ribosomal protein; a housekeeping gene
 23. S100A10, Ca-binding protein involved in the regulation of cell cycle progression and differentiation;
   overexpressed in renal cell carcinoma [64]
 24. SENP2, SUMO1/sentrin/SMT3 specific peptidase 2; a de-SUMOylase involved in regulation of the tumor
   suppressor HIC1 gene activity [65]
 25. SNX15, sorting nexin 15 involved in protein trafficking. Its overexpression disrupts normal trafficking of
   proteins from the plasma membrane to recycling endosomes or the trans-Golgi network [66]
 26. TCR, T-cell receptor
 27. TSSC3, an apoptosis-related candidate tumor suppressor gene imprinted in human brain and Wilms tumors
   [67, 68]
B. q-H2A < wt-H2Ab
 1. C11orf13, HRAS-related; Ras association (RalGDS/AF-6) domain family member; a proto-oncogene
 2. CACNA1F, L-type calcium channel expressed in various tissues [69]
 3. HIST1H2AJ, histoneH2aj
 4. IGFBP5, insulin-like growth factor binding protein 5. It plays a role in the invasiveness, progression and
   metastasis of several human cancers, including breast cancer [70]
 5. TBX21, T-box transcription factor
a

Gene symbols and functional data are cited after PubMed Protein. Selected additional, more specific references are given in brackets.

b

In addition to the above genes, 44 genes of unknown function were expressed differentially (26 for q-H2A > wt-H2A plus 18 for q-H2A < wt-H2A)

Table 3.

Genes whose expression level in q-H2A-transfected cells was at least 4-fold higher or lower than in wt-H2A-transfected cells at 48 hr post-inductiona

A. q-H2A > wt-H2Ab
 1. AP1S1, adaptor protein complex AP-1sigma 1[71]
 2. BAZ2A, bromodomain adjacent to zinc finger; a putative chromatin remodeling factor; HAT-associated; in
   pre-B acute lymphoblastic leukemia [42]
 3. CLDN18, claudin 18. It regulates cell transformation/metastases and may serve as a marker for colon cancer
   [31, 72, 73].
 4. DPYSL4, dihydropyrimidinase-like 4. It is aberrantly expressed in Down syndrome [74].
 5. EPHA2, member of the ephrin receptor subfamily of the protein-tyrosine kinase family associated with
   ovarian and urinary tract cancers [75-77]
 6. FGF2, member of the fibroblast growth factor family implicated in diverse biological processes including
   tumor cells growth [78, 79]
 7. GABARAPL1, GABA(A) receptor-associated protein; member of the microtubule-associated protein (MAP)
   family [80]
 8. GFR, nuclear protein: guanine nucleotide exchange factor. It may assist in neoplastic transformation and
   growth of cells through RAS activation [43, 44]
 9. GIPC2, a PDZ domain protein. It plays a role in carcinogenesis through growth factor signaling [38]
 10. GYPA, glycophorin A; an erythroid-lineage-specific membrane sialoglycoprotein
 11. KRTAP1-1, keratin associated protein (KAP) 1-1; forms keratin intermediate filaments
 12. LACRT, lacritin; a secretion-enhancing factor. It is expressed in human breast tumors, breast cancer cell lines,
   and in normal breast [81]
 13. OSBPL11, an oxysterol-binding protein involved in regulation of cholesterol balance
 14. REPS1, RALBP1-associated Eps domain. It plays an important role in the Ras-RalGDS signal transduction
   pathways [82] and is associated with cancer [83].
 15. RNF7, a ring finger protein; member of ubiquitin ligase complex important for cell cycle progression and
   signal transduction; involved in HIF activity regulation [84]
 16. USH1C, harmonin; expressed in inner ear sensory cells
 17. VEGF, vascular endothelial growth factor. It is essential for neovascularization of tumors [26].
B. q-H2A < wt-H2Ab
 1. HIST1H2AJ, histoneH2aj
 2. METAP2, methionyl aminopeptidase 2 overexpressed in colorectal and colon cancers [85]
 3. RGS8, regulator of G-protein signaling selectively expressed in NK cells [86] and also in hereditary prostate
   cancer [87]
a

Symbols and functional data according to PubMed Protein. Selected additional, more specific references are given in brackets

b

In addition to the above genes, 19 genes of unknown function were expressed differentially (16 for q-H2A > wt-H2A plus 3 for q-H2A < wt-H2A)

Table 4.

Confirmation of differential expression of selected cancer-related genes by real-time PCRa

at 24 hr at 48 hr
BAZ2A Y (+) N (+)
CLDN18 Y (+) Y (+)
CYP51A1 Y (+) Y (o)
GFR N (−) Y (+)
GIPC2 Y (−) N (+)
HMGB1 Y (+) Y (+)
IRF7 N (+) Y (−)
JAK3 Y (+) Y (+)
PSIP1 Y (+) Y (+)
VEGF Y (o) Y (+)
a

Y or N indicates that the microarray result was consistent or not, respectively, with the real-time PCR result. The “+”, “−“, or “o” sign in parentheses indicates higher, lower, or not different expression level of q-H2A vs. wt-H2A as found by the microarray analysis.

Discussion

We have reported previously that Ni(II) mediates hydrolytic truncation of histone H2A’s C-terminal tail between the E121 and S122 amino acid residues in both cell-free systems and in cultured cells [1-3]. The outgoing octapeptide SHHKAKGK takes away four positively charged residues that should attenuate interaction of the tail with linker DNA [16]. The truncation may also lower the affinity of the H2A/H2B dimers for the H3/H4 tetramer subunits in the core histone octamer, similarly to what was observed by Eickbush et al. [15, 22] and Minami et al. [23] for another truncated H2A variant. Thus, the truncation has the potential of modifying chromatin assembly and structure, which in turn, may affect gene expression. In fact, transcriptional regulation of genes has already been proposed, but not yet directly proven, to be associated with the activity of specific histone-truncating hydrolases [22, 24, 25]. However, those hydrolases cause more extensive deletions, e.g., a chromatin-bound H2A-specific protease [15, 22] deletes 15 terminal amino acid residues from H2A’s C-tail, while Ni(II) induces the loss of only 8 residues. Would this be enough to affect gene expression? The results of the present experiment provide a positive answer to this question.

Comparisons of gene expression in cells bearing wt-H2A plasmid with those bearing q-H2A plasmid revealed significant differences in terms of both the overall expression patterns and the levels of expression of selected genes. The Multidimensional Scaling approach disclosed that the four experimental groups tested formed four unique clusters without any overlap. The hierarchical clustering analysis allowed us to identify two clusters of genes whose expression level differed significantly between the transfectants at both time points (clusters 2 and 3 in Fig. 4). Of these two, cluster 2 contained genes whose expression in the q-H2A cells was lower than in wt-H2A cells, while genes in cluster 3 were expressed in q-H2A cells at relatively higher levels. The majority of genes in cluster 2 were genes involved in cell signaling, followed by those for protein metabolism, transcription factors, proteins of unknown function, and finally structural proteins. In cluster 3 this ranking was different: genes for transcription factors were followed by unknown genes, then protein metabolism, cell signaling, and finally structural proteins. These two rankings indicate that q-H2A as compared with wt-H2A induced a shift in gene expression that affected predominantly genes coding for signaling proteins and transcription factors. Worthy of notice here is also the fact that q-H2A was capable of lowering the expression of certain genes (cluster 2) while enhancing the expression of others (cluster 3).

Microarray analysis is best suited for identifying patterns of changes in the global (whole genome) gene expression in differently treated cells. Unfortunately, due to intrinsic technical limitations, the current microarray technology is not precise enough to be fully reliable concerning the differential expression of single selected genes of special interest in such cells, especially when the differences are minimal. Therefore, we limit further detailed discussion to ten genes that might be relevant to carcinogenesis and toxicity that differed in expression between q-H2A and wt-H2A cells substantially, by a factor of at least 4 in at least one time point, and whose expression was also confirmed by the real-time PCR. The basic functional information on these and the other genes is summarized in Tables 3 and 4.

In concordance with the technology limitations and individual experimental errors of the microarray and PCR techniques, in the present study the real-time PCR confirmed most (80%), but not all, of the microarray results tested (Table 4). Among the results confirmed were those for the VEGF, CLDN18, CYP51A1, HMGB1, PSIP1, and JAK3 genes at both 24 and 48 hr post-transfection, and the GIPC2, BAZ2A, GFR, and IRF7 genes at one time point or the other. The vascular endothelial growth factor VEGF is a key molecule in the development, progression, and metastasis of tumors via induction of neovascularization [26]. The relatively higher level of VEGF found after 48 hr in q-H2A-transfected cells may signify a potential of the truncated histone to assist in tumor growth. The HMGB1 gene product belongs to the high mobility group of nuclear proteins, which play complex functions in inflammation and cancer, but are also involved in tissue repair and regeneration [27]. The CYP51A1 gene is a cytochrome P450 family member that codes for a lanosterol 14α-demethylase, an enzyme essential for cholesterol synthesis. Its increased activity might potentially be associated with the widespread arteriosclerosis induced in rats by nickel [28]. CYP51A1 is overexpressed in ovarian [29] and colon cancers [30] at higher levels than in the corresponding normal tissues. The CLDN18 gene product belongs to the claudin family of proteins, which are essential for the maintenance of epithelial and endothelial tight junctions and also play a role in maintaining cytoskeleton integrity and in cell signaling. Their expression is often dysregulated in various human cancers [31]. More specifically, claudin-18 is frequently overexpressed in infiltrating pancreatic ductal adenocarcinomas [32], but down-regulated in gastric cancer [33]. PSIP1 codes for a nuclear protein involved in gene transcription and cell cycle regulation. It is also known as LEDGF (lens epithelium-derived growth factor) and is considered to be an oncogenic protein controlling a caspase-independent lysosomal cell death, up-regulated in human breast and bladder carcinomas [34]. JAK3, a member of the Janus kinase family of tyrosine kinases, is involved in intracellular signal transduction. Its overexpression promotes in vitro cell transformation [35]. Expression of JAK3 is also dysregulated in various human cancers and other diseases [36]. JAK3 also promotes VEGF production in cutaneous T-cell lymphomas [37]. GIPC2, along with other members of the GIPC family, plays a key role in carcinogenesis through growth factor signaling and cell adhesion regulation [38]. It is up-regulated in certain types of human gastric cancers [39], but down-regulated in human primary kidney and colorectal tumors [40]. BAZ2A codes for a bromodomain protein, an integral component of chromatin remodeling complexes, e.g. SNF2h, with histone acetyl transferase (HAT) activity [41]. It may play a role in the pathogenesis of acute lymphoblastic leukemia [42]. The protein product of the GFR gene is a guanine nucleotide exchange factor. This nuclear protein serves as a RAS activator and may thus assist in RAS-mediated cell transformation and cancer [43, 44]. The IRF7 gene codes for interferon regulatory factor and has oncogenic properties [45]. The family of IRF transcription factors is important in the regulation of interferons in response to viral infections and in the regulation of interferon-inducible genes. It plays a major role in Epstein-Barr virus latency and is important in a variety of biologic responses to viral infections and tumors [46]. IRF7 has been found to be hypermethylated, and thus suppressed, in human lung cancer [47], but its expression has been detected in many primary lymphomas of the human central nervous system. In cultured NIH 3T3 cells, IRF-7 may promote the anchorage-independent growth and assist in malignant transformation [45].

Interestingly, among the histone proteins, only one variant of histone H2A, H2aj was expressed differentially. The difference in its expression found by the microarray was over 15-fold at both time points in all replicates. Expression of no other major histone or histone variant differed between the two transfectants. Although the hierarchical clustering analysis did not place H2aj in any of the four clusters, the expression of this histone variant remained much lower in the q-H2A-than in the wt-H2A-transfected cells over the entire experimental time, indicating a possible functional similarity of these two. The H2aj variant has one different amino acid residue and is shorter by two amino acid residues than the major variant of mammalian H2A.1 (wt-H2A) at the C-terminus: i.e., -SHHKTK is present in H2aj versus -SHHKAKGK in H2A.1. Unfortunately, the significance of H2aj in cell physiology is currently unknown and difficult to ascertain, especially in view of the wide variety of the diverse functional variants and covalent modifications of histone H2A’s C-tail [48]. This makes it impossible to predict whether or not q-H2A could substitute for H2aj in providing any particular function.

Chemical interactions of nickel ions with cellular components result in the induction of multiple signaling pathways leading to activation of various protective and/or destructive mechanisms, depending on the cell type and level and duration of the exposure [49]. Since in the present study cells were not exposed to nickel but only to one product of its known interactions, i.e., q-H2A, one might possibly expect to see only the part of the spectrum of nickel-caused alterations in gene expression for which q-H2A would be solely responsible. However, because the published information on nickel effects on gene expression considers very different exposure conditions and various cell lines, such expectation must be cautiously limited to only a few identical or functionally interdependent genes found previously. One such gene, VEGF, found up-regulated after 48 hr in q-H2A-transfected cells, is a hypoxia-inducible gene known to be enhanced in various cell lines through HIF-1α stabilization; most likely due to nickel-catalyzed destruction of HIF’s co-factor ascorbic acid [50]. The action of histone q-H2A would thus contribute to the increase of VEGF expression through yet another mechanism. The bromodomain BAZ2A gene product is an integral component of chromatin remodeling factors [41]. Hence, down-regulation of BAZ2A gene in cells expressing q-H2A for 48 hrs, observed by real-time PCR at 48 hrs post-transfection, would coincide in time with down-regulation of the remodeling factor hSNF2H found by us before in nickel-treated cells [51]. The various interferon regulatory transcription factors, IRFs, which mediate interferon signaling in immune responses and cell growth, may potentiate their individual activity toward gene expression by working in pairs, e.g., IRF1/IRF3 and IRF1/IRF7. This provides a flexible mechanism for integration of diverse signaling pathways [52]. The simultaneous opposite effects of nickel on IRF1 expression [53] and of q-H2A on IRF7 expression level (this study) would constitute an example of molecular events underlying such flexible mechanisms.

In summary, this study revealed altered expression of a wide variety of genes in cells transfected with plasmid expressing histone q-H2A, i.e., the major variant of histone H2A having its C-tail truncated by 8 terminal amino acid residues, which is typical for Ni(II) assisted hydrolysis of this histone [1, 3], as compared with cells transfected with the full-length wt-H2A. Many of these genes are involved in neoplastic transformation and growth of cancer cells. This may signify the potential of q-H2A, and thus nickel, to assist in the process of carcinogenesis through epigenetic mechanisms.

Acknowledgements

The authors are grateful to Dr. William M. Bonner for the generous gift of human H2A plasmid, and to Drs. Steven Lockett, Yih-Horng Shiao, and Lucy M. Anderson for technical help and critical discussion of this study. Skillful technical assistance of Ms. S. Lynn North and Mr. Robert M. Bare is also gratefully acknowledged. This project has been funded in whole with federal funds from the National Cancer Institute, Center for Cancer Research, National Institutes of Health, under the Intramural Research Program and Contract N01-CO-12400. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organization imply endorsement by the United States Government.

Abbreviations

MES

2-(-N-morpholino)ethano-sulfonic acid

Ni(II)

divalent nickel

q-H2A

truncated human histone H2A.1 lacking the SHHKAKGK C-terminus sequence

wt-H2A

wild-type human histone H2A.1

UHRR

Universal Human Reference RNA

References

  • [1].Bal W, Lukszo J, Bialkowski K, Kasprzak KS. Interactions of Nickel(II) with histones: interactions of Nickel(II) with CH3CO-Thr-Glu-Ser-His-His-Lys-NH2, a peptide modeling the potential metal binding site in the “C-Tail” region of histone H2A. Chem Res Toxicol. 1998;11:1014–1023. doi: 10.1021/tx980051y. [DOI] [PubMed] [Google Scholar]
  • [2].Karaczyn AA, Bal W, North SL, Bare RM, Hoang VM, Fisher RJ, Kasprzak KS. The octapeptidic end of the C-terminal tail of histone H2A is cleaved off in cells exposed to carcinogenic nickel(II) Chem Res Toxicol. 2003;16:1555–1559. doi: 10.1021/tx0300277. [DOI] [PubMed] [Google Scholar]
  • [3].Bal W, Liang R, Lukszo J, Lee SH, Dizdaroglu M, Kasprzak KS. Ni(II) specifically cleaves the C-terminal tail of the major variant of histone H2A and forms an oxidative damage-mediating complex with the cleaved-off octapeptide. Chem Res Toxicol. 2000;13:616–624. doi: 10.1021/tx000044l. [DOI] [PubMed] [Google Scholar]
  • [4].Kamakaka RT, Biggins S. Histone variants: deviants? Genes Dev. 2005;19:295–310. doi: 10.1101/gad.1272805. [DOI] [PubMed] [Google Scholar]
  • [5].Arya G, Schlick T. Role of histone tails in chromatin folding revealed by a mesoscopic oligonucleosome model. Proc Natl Acad Sci U S A. 2006;103:16236–16241. doi: 10.1073/pnas.0604817103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Angelov D, Vitolo JM, Mutskov V, Dimitrov S, Hayes JJ. Preferential interaction of the core histone tail domains with linker DNA. Proc Natl Acad Sci U S A. 2001;98:6599–6604. doi: 10.1073/pnas.121171498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Kornberg RD, Lorch Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 1999;98:285–294. doi: 10.1016/s0092-8674(00)81958-3. [DOI] [PubMed] [Google Scholar]
  • [8].Ausio J, Abbott DW, Wang X, Moore SC. Histone variants and histone modifications: a structural perspective. Biochem Cell Biol. 2001;79:693–708. [PubMed] [Google Scholar]
  • [9].Zhang Y. Transcriptional regulation by histone ubiquitination and deubiquitination. Genes Dev. 2003;17:2733–2740. doi: 10.1101/gad.1156403. [DOI] [PubMed] [Google Scholar]
  • [10].Nathan D, Sterner DE, Berger SL. Histone modifications: Now summoning sumoylation. Proc Natl Acad Sci U S A. 2003;100:13118–13120. doi: 10.1073/pnas.2436173100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Shiio Y, Eisenman RN. Histone sumoylation is associated with transcriptional repression. Proc Natl Acad Sci U S A. 2003;100:13225–13230. doi: 10.1073/pnas.1735528100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Khan AU, Krishnamurthy S. Histone modifications as key regulators of transcription. Front Biosci. 2005;10:866–872. doi: 10.2741/1580. [DOI] [PubMed] [Google Scholar]
  • [13].Bartova E, Krejci J, Harnicarova A, Galiova G, Kozubek S. Histone modifications and nuclear architecture: a review. J Histochem Cytochem. 2008;56:711–721. doi: 10.1369/jhc.2008.951251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Placek BJ, Gloss LM. The N-terminal tails of the H2A-H2B histones affect dimer structure and stability. Biochemistry. 2002;41:14960–14968. doi: 10.1021/bi026283k. [DOI] [PubMed] [Google Scholar]
  • [15].Eickbush TH, Godfrey JE, Elia MC, Moudrianakis EN. H2a-specific proteolysis as a unique probe in the analysis of the histone octamer. J Biol Chem. 1988;263:18972–18978. [PubMed] [Google Scholar]
  • [16].Usachenko SI, Bavykin SG, Gavin IM, Bradbury EM. Rearrangement of the histone H2A C-terminal domain in the nucleosome. Proc Natl Acad Sci U S A. 1994;91:6845–6849. doi: 10.1073/pnas.91.15.6845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Hartley JL, Temple GF, Brasch MA. DNA cloning using in vitro site-specific recombination. Genome Res. 2000;10:1788–1795. doi: 10.1101/gr.143000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, Zacharias DA, Tsien RY. A monomeric red fluorescent protein. Proc Natl Acad Sci U S A. 2002;99:7877–7882. doi: 10.1073/pnas.082243699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Ivanova VS, Bonner WM. Expression of a marked H2A histone protein in mammalian cells. Exp Cell Res. 1994;215:63–67. doi: 10.1006/excr.1994.1315. [DOI] [PubMed] [Google Scholar]
  • [20].Bonner WM, West MH, Stedman JD. Two-dimensional gel analysis of histones in acid extracts of nuclei, cells, and tissues. Eur J Biochem. 1980;109:17–23. doi: 10.1111/j.1432-1033.1980.tb04762.x. [DOI] [PubMed] [Google Scholar]
  • [21].Reeves R, Gorman CM, Howard B. In vivo incorporation of Drosophila H2a histone into mammalian chromatin. Nucleic Acids Res. 1983;11:2681–2700. doi: 10.1093/nar/11.9.2681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Eickbush TH, Watson DK, Moudrianakis EN. A chromatin-bound proteolytic activity with unique specificity for histone H2A. Cell. 1976;9:785–792. doi: 10.1016/0092-8674(76)90141-0. [DOI] [PubMed] [Google Scholar]
  • [23].Minami J, Takada K, Aoki K, Shimada Y, Okawa Y, Usui N, Ohkawa K. Purification and characterization of C-terminal truncated forms of histone H2A in monocytic THP-1 cells. Int J Biochem Cell Biol. 2007;39:171–180. doi: 10.1016/j.biocel.2006.07.010. [DOI] [PubMed] [Google Scholar]
  • [24].Furlan M, Jericijo M, Suhar A. Purification and properties of a neutral protease from alf thymus nuclei. Biochim Biophys Acta. 1968;167:154–160. doi: 10.1016/0005-2744(68)90285-4. [DOI] [PubMed] [Google Scholar]
  • [25].Chong MT, Garrard WT, Bonner J. Purification and properties of a neutral protease from rat liver chromatin. Biochemistry. 1974;13:5128–5134. doi: 10.1021/bi00722a012. [DOI] [PubMed] [Google Scholar]
  • [26].Furuya M, Yonemitsu Y. Cancer neovascularization and proinflammatory microenvironments. Curr Cancer Drug Targets. 2008;8:253–265. doi: 10.2174/156800908784533481. [DOI] [PubMed] [Google Scholar]
  • [27].Klune JR, Dhupar R, Cardinal J, Billiar TR, Tsung A. HMGB1: endogenous danger signaling. Mol Med. 2008;14:476–484. doi: 10.2119/2008-00034.Klune. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Hopfer SM, Sunderman FW, Jr., McCully KS, Reid MC, Liber C, Spears JR, Serur J. Studies of the pathogenesis of arteriosclerosis induced in rats by intrarenal injection of a carcinogen, nickel subsulfide. Ann Clin Lab Sci. 1984;14:355–365. [PubMed] [Google Scholar]
  • [29].Downie D, McFadyen MC, Rooney PH, Cruickshank ME, Parkin DE, Miller ID, Telfer C, Melvin WT, Murray GI. Profiling cytochrome P450 expression in ovarian cancer: identification of prognostic markers. Clin Cancer Res. 2005;11:7369–7375. doi: 10.1158/1078-0432.CCR-05-0466. [DOI] [PubMed] [Google Scholar]
  • [30].Kumarakulasingham M, Rooney PH, Dundas SR, Telfer C, Melvin WT, Curran S, Murray GI. Cytochrome p450 profile of colorectal cancer: identification of markers of prognosis. Clin Cancer Res. 2005;11:3758–3765. doi: 10.1158/1078-0432.CCR-04-1848. [DOI] [PubMed] [Google Scholar]
  • [31].Hewitt KJ, Agarwal R, Morin PJ. The claudin gene family: expression in normal and neoplastic tissues. BMC Cancer. 2006;6:186. doi: 10.1186/1471-2407-6-186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Karanjawala ZE, Illei PB, Ashfaq R, Infante JR, Murphy K, Pandey A, Schulick R, Winter J, Sharma R, Maitra A, Goggins M, Hruban RH. New markers of pancreatic cancer identified through differential gene expression analyses: claudin 18 and annexin A8. Am J Surg Pathol. 2008;32:188–196. doi: 10.1097/PAS.0b013e31815701f3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Sanada Y, Oue N, Mitani Y, Yoshida K, Nakayama H, Yasui W. Down-regulation of the claudin-18 gene, identified through serial analysis of gene expression data analysis, in gastric cancer with an intestinal phenotype. J Pathol. 2006;208:633–642. doi: 10.1002/path.1922. [DOI] [PubMed] [Google Scholar]
  • [34].Daugaard M, Kirkegaard-Sorensen T, Ostenfeld MS, Aaboe M, Hoyer-Hansen M, Orntoft TF, Rohde M, Jaattela M. Lens epithelium-derived growth factor is an Hsp70-2 regulated guardian of lysosomal stability in human cancer. Cancer Res. 2007;67:2559–2567. doi: 10.1158/0008-5472.CAN-06-4121. [DOI] [PubMed] [Google Scholar]
  • [35].Knoops L, Hornakova T, Royer Y, Constantinescu SN, Renauld JC. JAK kinases overexpression promotes in vitro cell transformation. Oncogene. 2008;27:1511–1519. doi: 10.1038/sj.onc.1210800. [DOI] [PubMed] [Google Scholar]
  • [36].Verma A, Kambhampati S, Parmar S, Platanias LC. Jak family of kinases in cancer. Cancer Metastasis Rev. 2003;22:423–434. doi: 10.1023/a:1023805715476. [DOI] [PubMed] [Google Scholar]
  • [37].Krejsgaard T, Vetter-Kauczok CS, Woetmann A, Lovato P, Labuda T, Eriksen KW, Zhang Q, Becker JC, Odum N. Jak3- and JNK-dependent vascular endothelial growth factor expression in cutaneous T-cell lymphoma. Leukemia. 2006;20:1759–1766. doi: 10.1038/sj.leu.2404350. [DOI] [PubMed] [Google Scholar]
  • [38].Katoh M. GIPC gene family (Review) Int J Mol Med. 2002;9:585–589. [PubMed] [Google Scholar]
  • [39].Kirikoshi H, Katoh M. Up-regulation of GIPC2 in human gastric cancer. Int J Oncol. 2002;20:1183–1187. [PubMed] [Google Scholar]
  • [40].Kirikoshi H, Katoh M. Molecular cloning and characterization of human GIPC2, a novel gene homologous to human GIPC1 and Xenopus Kermit. Int J Oncol. 2002;20:571–576. [PubMed] [Google Scholar]
  • [41].Jones MH, Hamana N, Nezu J, Shimane M. A novel family of bromodomain genes. Genomics. 2000;63:40–45. doi: 10.1006/geno.1999.6071. [DOI] [PubMed] [Google Scholar]
  • [42].Panagopoulos I, Strombeck B, Isaksson M, Heldrup J, Olofsson T, Johansson B. Fusion of ETV6 with an intronic sequence of the BAZ2A gene in a paediatric pre-B acute lymphoblastic leukaemia with a cryptic chromosome 12 rearrangement. Br J Haematol. 2006;133:270–275. doi: 10.1111/j.1365-2141.2006.06020.x. [DOI] [PubMed] [Google Scholar]
  • [43].Rebhun JF, Castro AF, Quilliam LA. Identification of guanine nucleotide exchange factors (GEFs) for the Rap1 GTPase. Regulation of MR-GEF by M-Ras-GTP interaction. J Biol Chem. 2000;275:34901–34908. doi: 10.1074/jbc.M005327200. [DOI] [PubMed] [Google Scholar]
  • [44].Buday L, Downward J. Many faces of Ras activation. Biochim Biophys Acta. 2008;1786:178–187. doi: 10.1016/j.bbcan.2008.05.001. [DOI] [PubMed] [Google Scholar]
  • [45].Zhang L, Zhang J, Lambert Q, Der CJ, Del Valle L, Miklossy J, Khalili K, Zhou Y, Pagano JS. Interferon regulatory factor 7 is associated with Epstein-Barr virus-transformed central nervous system lymphoma and has oncogenic properties. J Virol. 2004;78:12987–12995. doi: 10.1128/JVI.78.23.12987-12995.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Zhang L, Pagano JS. Structure and function of IRF-7. J Interferon Cytokine Res. 2002;22:95–101. doi: 10.1089/107999002753452700. [DOI] [PubMed] [Google Scholar]
  • [47].Fukasawa M, Kimura M, Morita S, Matsubara K, Yamanaka S, Endo C, Sakurada A, Sato M, Kondo T, Horii A, Sasaki H, Hatada I. Microarray analysis of promoter methylation in lung cancers. J Hum Genet. 2006;51:368–374. doi: 10.1007/s10038-005-0355-4. [DOI] [PubMed] [Google Scholar]
  • [48].Ausio J, Abbott DW. The many tales of a tail: carboxyl-terminal tail heterogeneity specializes histone H2A variants for defined chromatin function. Biochemistry. 2002;41:5945–5949. doi: 10.1021/bi020059d. [DOI] [PubMed] [Google Scholar]
  • [49].Kasprzak KS, Sunderman FW, Jr., Salnikow K. Nickel carcinogenesis. Mutat Res. 2003;533:67–97. doi: 10.1016/j.mrfmmm.2003.08.021. [DOI] [PubMed] [Google Scholar]
  • [50].Salnikow K, Kasprzak KS. Ascorbate depletion: a critical step in nickel carcinogenesis? Environ Health Perspect. 2005;113:577–584. doi: 10.1289/ehp.7605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Lee SH, Shiao YH, Plisov SY, Kasprzak KS. Nickel(II) acetate-treated Chinese hamster ovary cells differentially express Vimentin, hSNF2H homologue, and H ferritin. Biochem Biophys Res Commun. 1999;258:592–595. doi: 10.1006/bbrc.1999.0692. [DOI] [PubMed] [Google Scholar]
  • [52].Xie R, van Wijnen AJ, van Der Meijden C, Luong MX, Stein JL, Stein GS. The cell cycle control element of histone H4 gene transcription is maximally responsive to interferon regulatory factor pairs IRF-1/IRF-3 and IRF-1/IRF-7. J Biol Chem. 2001;276:18624–18632. doi: 10.1074/jbc.M010391200. [DOI] [PubMed] [Google Scholar]
  • [53].Cheng RY, Zhao A, Alvord WG, Powell DA, Bare RM, Masuda A, Takahashi T, Anderson LM, Kasprzak KS. Gene expression dose-response changes in microarrays after exposure of human peripheral lung epithelial cells to nickel(II) Toxicol Appl Pharmacol. 2003;191:22–39. doi: 10.1016/s0041-008x(03)00228-x. [DOI] [PubMed] [Google Scholar]
  • [54].Navaratnam N, Sarwar R. An overview of cytidine deaminases. Int J Hematol. 2006;83:195–200. doi: 10.1532/IJH97.06032. [DOI] [PubMed] [Google Scholar]
  • [55].Lethe B, Lucas S, Michaux L, De Smet C, Godelaine D, Serrano A, De Plaen E, Boon T. LAGE-1, a new gene with tumor specificity. Int J Cancer. 1998;76:903–908. doi: 10.1002/(sici)1097-0215(19980610)76:6<903::aid-ijc22>3.0.co;2-1. [DOI] [PubMed] [Google Scholar]
  • [56].Rouzaut A, Recio JA, Notario V. Expression of the protein product of the PCPH proto-oncogene in human tumor cell lines. Radiat Res. 2001;155:181–187. doi: 10.1667/0033-7587(2001)155[0181:eotppo]2.0.co;2. [DOI] [PubMed] [Google Scholar]
  • [57].Blanquez MJ, Arenas MI, Conde I, Tirado OM, Paniagua R, Notario V. Deregulated expression of the PCPH proto-oncogene in human breast cancers. Int J Oncol. 2004;25:821–830. [PubMed] [Google Scholar]
  • [58].Blanquez MJ, Regadera J, Marino J, Newman RE, Notario V. Gradual deregulation and loss of PCPH expression in the progression of human laryngeal neoplasia. Mol Carcinog. 2002;35:186–195. doi: 10.1002/mc.10091. [DOI] [PubMed] [Google Scholar]
  • [59].Eichberger T, Regl G, Ikram MS, Neill GW, Philpott MP, Aberger F, Frischauf AM. FOXE1, a new transcriptional target of GLI2 is expressed in human epidermis and basal cell carcinoma. J Invest Dermatol. 2004;122:1180–1187. doi: 10.1111/j.0022-202X.2004.22505.x. [DOI] [PubMed] [Google Scholar]
  • [60].la Cour JM, Mollerup J, Winding P, Tarabykina S, Sehested M, Berchtold MW. Up-regulation of ALG-2 in hepatomas and lung cancer tissue. Am J Pathol. 2003;163:81–89. doi: 10.1016/S0002-9440(10)63632-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [61].Krebs J, Saremaslani P, Caduff R. ALG-2: a Ca2+ -binding modulator protein involved in cell proliferation and in cell death. Biochim Biophys Acta. 2002;1600:68–73. doi: 10.1016/s1570-9639(02)00446-6. [DOI] [PubMed] [Google Scholar]
  • [62].Yotov WV, Hamel H, Rivard GE, Champagne MA, Russo PA, Leclerc JM, Bernstein ML, Levy E. Amplifications of DNA primase 1 (PRIM1) in human osteosarcoma. Genes Chromosomes Cancer. 1999;26:62–69. doi: 10.1002/(sici)1098-2264(199909)26:1<62::aid-gcc9>3.0.co;2-f. [DOI] [PubMed] [Google Scholar]
  • [63].Cho JM, Song DJ, Bergeron J, Benlimame N, Wold MS, Alaoui-Jamali MA. RBT1, a novel transcriptional co-activator, binds the second subunit of replication protein A. Nucleic Acids Res. 2000;28:3478–3485. doi: 10.1093/nar/28.18.3478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [64].Domoto T, Miyama Y, Suzuki H, Teratani T, Arai K, Sugiyama T, Takayama T, Mugiya S, Ozono S, Nozawa R. Evaluation of S100A10, annexin II and B-FABP expression as markers for renal cell carcinoma. Cancer Sci. 2007;98:77–82. doi: 10.1111/j.1349-7006.2006.00355.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [65].Stankovic-Valentin N, Deltour S, Seeler J, Pinte S, Vergoten G, Guerardel C, Dejean A, Leprince D. An acetylation/deacetylation-SUMOylation switch through a phylogenetically conserved psiKXEP motif in the tumor suppressor HIC1 regulates transcriptional repression activity. Mol Cell Biol. 2007;27:2661–2675. doi: 10.1128/MCB.01098-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [66].Phillips SA, Barr VA, Haft DH, Taylor SI, Haft CR. Identification and characterization of SNX15, a novel sorting nexin involved in protein trafficking. J Biol Chem. 2001;276:5074–5084. doi: 10.1074/jbc.M004671200. [DOI] [PubMed] [Google Scholar]
  • [67].Muller S, van den Boom D, Zirkel D, Koster H, Berthold F, Schwab M, Westphal M, Zumkeller W. Retention of imprinting of the human apoptosis-related gene TSSC3 in human brain tumors. Hum Mol Genet. 2000;9:757–763. doi: 10.1093/hmg/9.5.757. [DOI] [PubMed] [Google Scholar]
  • [68].Schwienbacher C, Angioni A, Scelfo R, Veronese A, Calin GA, Massazza G, Hatada I, Barbanti-Brodano G, Negrini M. Abnormal RNA expression of 11p15 imprinted genes and kidney developmental genes in Wilms’ tumor. Cancer Res. 2000;60:1521–1525. [PubMed] [Google Scholar]
  • [69].McRory JE, Hamid J, Doering CJ, Garcia E, Parker R, Hamming K, Chen L, Hildebrand M, Beedle AM, Feldcamp L, Zamponi GW, Snutch TP. The CACNA1F gene encodes an L-type calcium channel with unique biophysical properties and tissue distribution. J Neurosci. 2004;24:1707–1718. doi: 10.1523/JNEUROSCI.4846-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [70].Wang H, Arun BK, Wang H, Fuller GN, Zhang W, Middleton LP, Sahin AA. IGFBP2 and IGFBP5 overexpression correlates with the lymph node metastasis in T1 breast carcinomas. Breast J. 2008;14:261–267. doi: 10.1111/j.1524-4741.2008.00572.x. [DOI] [PubMed] [Google Scholar]
  • [71].Takatsu H, Futatsumori M, Yoshino K, Yoshida Y, Shin HW, Nakayama K. Similar subunit interactions contribute to assembly of clathrin adaptor complexes and COPI complex: analysis using yeast three-hybrid system. Biochem Biophys Res Commun. 2001;284:1083–1089. doi: 10.1006/bbrc.2001.5081. [DOI] [PubMed] [Google Scholar]
  • [72].Kominsky SL. Claudins: emerging targets for cancer therapy. Expert Rev Mol Med. 2006;8:1–11. doi: 10.1017/S1462399406000056. [DOI] [PubMed] [Google Scholar]
  • [73].Dhawan P, Singh AB, Deane NG, No Y, Shiou SR, Schmidt C, Neff J, Washington MK, Beauchamp RD. Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer. J Clin Invest. 2005;115:1765–1776. doi: 10.1172/JCI24543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [74].Weitzdoerfer R, Fountoulakis M, Lubec G. Aberrant expression of dihydropyrimidinase related proteins-2,-3 and -4 in fetal Down syndrome brain. J Neural Transm Suppl. 2001:95–107. doi: 10.1007/978-3-7091-6262-0_8. [DOI] [PubMed] [Google Scholar]
  • [75].Herrem CJ, Tatsumi T, Olson KS, Shirai K, Finke JH, Bukowski RM, Zhou M, Richmond AL, Derweesh I, Kinch MS, Storkus WJ. Expression of EphA2 is prognostic of disease-free interval and overall survival in surgically treated patients with renal cell carcinoma. Clin Cancer Res. 2005;11:226–231. [PubMed] [Google Scholar]
  • [76].Abraham S, Knapp DW, Cheng L, Snyder PW, Mittal SK, Bangari DS, Kinch M, Wu L, Dhariwal J, Mohammed SI. Expression of EphA2 and Ephrin A-1 in carcinoma of the urinary bladder. Clin Cancer Res. 2006;12:353–360. doi: 10.1158/1078-0432.CCR-05-1505. [DOI] [PubMed] [Google Scholar]
  • [77].Lu C, Shahzad MM, Wang H, Landen CN, Kim SW, Allen J, Nick AM, Jennings N, Kinch MS, Bar-Eli M, Sood AK. EphA2 overexpression promotes ovarian cancer growth. Cancer Biol Ther. 2008;7:1098–1103. doi: 10.4161/cbt.7.7.6168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [78].Xiao D, Wang K, Zhou J, Cao H, Deng Z, Hu Y, Qu X, Wen J. Inhibition of fibroblast growth factor 2-induced apoptosis involves survivin expression, protein kinase C alpha activation and subcellular translocation of Smac in human small cell lung cancer cells. Acta Biochim Biophys Sin (Shanghai) 2008;40:297–303. doi: 10.1111/j.1745-7270.2008.00401.x. [DOI] [PubMed] [Google Scholar]
  • [79].Da MX, Wu Z, Tian HW. Tumor lymphangiogenesis and lymphangiogenic growth factors. Arch Med Res. 2008;39:365–372. doi: 10.1016/j.arcmed.2007.12.005. [DOI] [PubMed] [Google Scholar]
  • [80].Nemos C, Mansuy V, Vernier-Magnin S, Fraichard A, Jouvenot M, Delage-Mourroux R. Expression of gec1/GABARAPL1 versus GABARAP mRNAs in human: predominance of gec1/GABARAPL1 in the central nervous system. Brain Res Mol Brain Res. 2003;119:216–219. doi: 10.1016/j.molbrainres.2003.09.011. [DOI] [PubMed] [Google Scholar]
  • [81].Weigelt B, Bosma AJ, van’t Veer LJ. Expression of a novel lacrimal gland gene lacritin in human breast tissues. J Cancer Res Clin Oncol. 2003;129:735–736. doi: 10.1007/s00432-003-0514-y. [DOI] [PubMed] [Google Scholar]
  • [82].Xu J, Zhou Z, Zeng L, Huang Y, Zhao W, Cheng C, Xu M, Xie Y, Mao Y. Cloning, expression and characterization of a novel human REPS1 gene. Biochim Biophys Acta. 2001;1522:118–121. doi: 10.1016/s0167-4781(01)00310-4. [DOI] [PubMed] [Google Scholar]
  • [83].Katoh M, Katoh M. Identification and characterization of human GUKH2 gene in silico. Int J Oncol. 2004;24:1033–1038. [PubMed] [Google Scholar]
  • [84].Tan M, Gu Q, He H, Pamarthy D, Semenza GL, Sun Y. SAG/ROC2/RBX2 is a HIF-1 target gene that promotes HIF-1 alpha ubiquitination and degradation. Oncogene. 2008;27:1404–1411. doi: 10.1038/sj.onc.1210780. [DOI] [PubMed] [Google Scholar]
  • [85].Selvakumar P, Lakshmikuttyamma A, Dimmock JR, Sharma RK. Methionine aminopeptidase 2 and cancer. Biochim Biophys Acta. 2006;1765:148–154. doi: 10.1016/j.bbcan.2005.11.001. [DOI] [PubMed] [Google Scholar]
  • [86].Kveberg L, Ryan JC, Rolstad B, Inngjerdingen M. Expression of regulator of G protein signalling proteins in natural killer cells, and their modulation by Ly49A and Ly49D. Immunology. 2005;115:358–365. doi: 10.1111/j.1365-2567.2005.02174.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [87].Sood R, Bonner TI, Makalowska I, Stephan DA, Robbins CM, Connors TD, Morgenbesser SD, Su K, Faruque MU, Pinkett H, Graham C, Baxevanis AD, Klinger KW, Landes GM, Trent JM, Carpten JD. Cloning and characterization of 13 novel transcripts and the human RGS8 gene from the 1q25 region encompassing the hereditary prostate cancer (HPC1) locus. Genomics. 2001;73:211–222. doi: 10.1006/geno.2001.6500. [DOI] [PubMed] [Google Scholar]

RESOURCES