Skip to main content
Reproductive Biology and Endocrinology : RB&E logoLink to Reproductive Biology and Endocrinology : RB&E
. 2009 Oct 23;7:116. doi: 10.1186/1477-7827-7-116

Prostaglandin treatment is associated with a withdrawal of progesterone and androgen at the receptor level in the uterine cervix

Ylva Vladic-Stjernholm 1,✉, Tomislav Vladic, Chellakkan S Blesson 2, Gunvor Ekman-Ordeberg 1, Lena Sahlin 2
PMCID: PMC2774313  PMID: 19852793

Abstract

Treatment with prostaglandin(PG)-E2 is clinically efficient for cervical priming. The aim of this study was to evaluate the impact of PG-E2 on the expression of the progesterone (PR), androgen (AR) and glucocorticoid (GR) receptors in human uterine cervix in prolonged pregnancy.

The study groups were postterm nulliparous women with unripe cervices undergoing cervical priming with PG-E2 before labor induction. Responders (n = 12) who delivered vaginally were compared with non-responders (n = 10), who underwent cesarean section due to failure to progress to the active phase of labor. Controls (n = 18) with vaginal partus at a normal gestational age served as a reference group. Cervical levels of PR-A and PR- B isoforms, AR and GR, serum levels of their ligands and sex hormone-binding globulin (SHBG) were quantified.

The responder group displayed lower total PR-AB and AR protein levels as compared to non-responders, and lower PR-B and AR protein levels as compared to controls. In addition, the PR mRNA level was lower in responders as compared to non-responders. The GR protein level did not differ between the groups.

We conclude that successful PG-E2 priming was followed by a progesterone and androgen withdrawal at the receptor level in the uterine cervix.

Background

In clinical practice, cases of maternal or fetal distress necessitate immediate induction of labor. Prostaglandins (PGs) from the E and F series are the main promoters of cervical ripening and myometrial contractility. The influence of PG-E2 in promotion of cervical maturation and uterine vasodilatation has been suggested as the primary functions of PGs in human parturition [1]. Local treatment with PG-E2 gel is efficient for cervical priming [1,2]. Prolonged pregnancy ≥ 42+0 gestational weeks occurs in 5-12% of pregnancies, predominantly in nulliparous women, exerting increased risks for perinatal mortality and morbidity [3-5]. Prolonged pregnancy is a key indication for cervical priming and induction of labor. The uterine cervix effaces towards the internal os and increases in diameter during the latency phase of labor, and it opens beyond 3-4 cm during the active phase. Late cervical ripening resembles an inflammatory reaction [1,6,7]. Progesterone, testosterone and cortisol are known to have anti-inflammatory properties [1,8,9].

Progesterone withdrawal associated with human parturition is characterized by decreased levels of the total progesterone receptor (PR) and an increased ratio of the inhibitory PR-A isoform to PR-B isoform form in the uterine cervix and myometrium [10-12].

The aim of this study was to evaluate the impact of PG-E2 priming on the expression of the PR, androgen (AR) and glucocorticoid (GR) receptors in human uterine cervix in prolonged pregnancy. Serum levels of the receptor ligands, sex hormone-binding globulin (SHBG), and cervical expression of the prostaglandin synthase enzymes constitutive cyclooxygenase (COX)-1 and inducible COX-2 were also determined.

Methods

Study patients

Ethics committee approval was obtained before the study (Karolinska University Hospital Ref No. 99-099). All women were healthy, non-smoking, had uncomplicated pregnancies, were without medication and gave informed consent to participate in the study. The study groups were nulliparous women with unripe cervices defined as a Bishop score ≤ 5 points. A Bishop score of ≥ 6 points was the criterion for a ripe cervix according to clinical guidelines [13]. The subjects were treated with PG-E2 in viscous gel (Minprostin® Pharmacia, Sweden) for cervical priming and labour induction in postterm pregnancy ≥ 42+0 gestational weeks (Table 1, 2 and 3).

Table 1.

Clinical data controls.

Age Gest age Oxytocin Anaesthesia Weight Gender
27 37+5 + EDA 3190 M
37 39+6 + EDA 3965 M
30 39+4 + EDA 3280 M
34 40+3 + EDA 3625 M
21 37+0 + EDA 2595 F
29 40+3 + EDA 3665 F
20 40+5 + EDA 3815 F
23 40+6 + EDA 3065 M
30 39+3 + EDA 3130 M
32 41+1 + EDA 3420 M
32 40+5 + N2O 4175 M
28 39+5 + EDA 3470 M
31 40+1 + EDA 3590 F
26 40+4 + EDA 3390 F
31 40+1 + N2O 3540 M
27 39+3 + EDA 2970 M
26 41+0 + EDA 2815 F
36 38+6 + EDA 4055 M
37 40+5 + EDA 4130 F
30 39+6 19/19 17/19 3470 F7/M12

Oxytocin = infusion of oxytocin10 U/glucose 2,5% 500 mL for augmentation of labor. EDA = epidural anaesthesia, N2O = inhalation of nitrous oxide 50%/oxygen 50%.

Table 2.

Clinical data responders.

Age Gest age BS PG-E Oxytocin Anaesthesia Weight Gender
21 42+5 2 4 + EDA 3410 F
31 42+4 2 7 + EDA 4360 M
39 42+2 3 0,5 + EDA 2870 F
28 42+3 4 4 + EDA 3960 F
31 42+2 4 2 + EDA 3815 F
37 42+5 0 4 + EDA 3535 F
35 42+5 2 2 + EDA 4010 M
21 42+4 4 2 + N2O, EDA 3430 M
29 42+3 4 4 + N2O, EDA 3625 M
28 42+1 2 2 + EDA 4245 M
23 42+4 3 2 + EDA 3540 M
30 42+1 4 4 + EDA 3985 M
30 42+4 3 3,1 12/12 12/12 3732 F5/M7

BS = Bishop score (points) before priming, PG-E2 = accumulated PG-E2 dose (mg), Oxytocin = infusion of oxytocin10 U/glucose 2,5% 500 mL for induction of labor. EDA = epidural anaesthesia, N2O = inhalation of nitrous oxide 50%/oxygen 50%.

Table 3.

Clinical data non-responders.

Age Gest age BS PG-E Oxytocin Anaesthesia Weight Gender
32 42+4 2 6 - EDA 3730 F
24 42+3 2 2 + EDA 2830 F
31 42+3 2 5 + SPA 3565 F
29 42+6 0 5,5 - SPA 5130 M
26 42+5 0 4 - SPA 3960 F
33 42+4 2 6 + SPA 2905 M
29 42+4 2 6 + EDA 3630 F
28 42+5 3 6 + EDA 4180 M
37 42+4 3 1 + SPA 5060 M
32 42+6 2 6,5 + SPA 4930 M
30 42+4 2 4,7 7/10 10/10 3992 F5/M5

BS = Bishop score (points) before priming, PG-E2 = accumulated PG-E2 dose (mg), Oxytocin = infusion of oxytocin10 U/glucose 2,5% 500 mL for induction of labor. EDA = epidural anaesthesia, SPA = spinal anaesthesia, N2O = inhalation of nitrous oxide 50%/oxygen 50%.

Nulliparous women (n = 18) with spontaneous onset of labor and vaginal partus at a normal gestational length served as a reference control (C) group. They had a median age of 30 years (range 20-37) a median gestational age of 39+6 weeks (range 37+0-41+1). Oxytocin infusion (Syntocinon® 10 U/glucose 2,5% 500 mL) for augmentation of labor was administered to all women according to the clinical guidelines [14].

The responders (R) were nulliparous women (n = 12) who delivered vaginally after successful cervical priming with PG-E2. They had a median age of 30 years (range 21-39), a median gestational length of 42+4 weeks (range 42+1- 42+5) at partus, and median Bishop score of 3 points (range 0-4) at admission. All 12 women received oxytocin infusion for augmentation of labor.

The non-responders (NR) were nulliparous women (n = 10) who failed to enter the active phase of labor after treatment with PG-E2 and therefore delivered by cesarean section [15]. They had a median age of 30 years (range 24-37), a median gestational length of 42+4 weeks (range 42+1- 42+6) at partus, and a median Bishop score of 2 points (range 0-4) before PG-E2 treatment. Oxytocin infusion was administered to 7 of 10 women for induction of labor.

It was not possible to obtain a peripheral venous sample from every subject, due to practical reasons or lack of consent. The limited size of the cervical biopsies did not allow for analysis of both mRNA and immunohistochemistry (IHC) in all samples. Thus, the actual number for the mRNA analyses is given in the Results section.

Sampling procedure

The cervical biopsies were obtained transvaginally from the anterior part of the uterine cervix at the 12 o'clock position, from 10-20 mm depth within 30 min after delivery. The biopsies were divided and one half was immersion-fixed in 4% formaldehyde overnight, stored at 4°C in 70% ethanol and thereafter embedded in paraffin. The other half was immediately frozen at -70°C. Cervical tissue obtained from women after partus at a normal gestational length served as reference material.

Serum analyses

Peripheral venous samples were drawn immediately after parturition or at cesarean section. They were centrifuged at 3000 × G for 10 min and stored at -20 °C until analyzed.

Serum levels of progesterone and SHBG were determined by direct chemiluminiscence enzyme immunoassay using commercially available kits from Diagnostic Products Corp., Los Angeles, CA (Immulite®). Serum testosterone was determined by direct radioimmunoassay using a kit obtained from Diagnostic Products Corp. ("Coat-a-Count®"). Serum 5α-DHT was determined after destruction of cross reacting testosterone by oxidative cleavage of the 4-ene double bond with potassium permanganate followed by extraction, using a kit from Diagnostic Systems Laboratories Inc., Webster, Texas, U.S.A. Values obtained by this method were compared with those obtained by a method including extraction with diethyl ether, column chromatography on celite and subsequent radioimmunoassay and an excellent correlation was found [16]. Circulating progesterone binds in < 1%, testosterone in 70%, and its active metabolite 5α-dehydrotestosterone (DHT) in 28%, by high affinity to sex hormone-binding globulin (SHBG) [17]. The free androgen index (FAI) (total T/SHBG × 100) was calculated since the non SHBG-bound fraction is the biologically active fraction of steroid hormones [18].

RNA preparation and reverse transcription

Total RNA from frozen cervical tissue samples was purified with the RNeasy® kit (Qiagen GmbH, Hilden, Germany) according to a procedure for RNA isolation from fibrous tissues, including a DNase step, as recommended by the manufacturer. Two μg of total RNA from each sample was reverse transcribed at 37°C for 60 min in a final volume of 30 μl with a reaction mixture (Qiagen) containing 1 × RT buffer, dNTP mix (0.5 mM each dNTP), 600 ng random primers (Invitrogen, Paisley, UK), 10 units RNase inhibitor (Superase-In, Ambion, Austin, TX), and 4 U of Omniscript™ reverse transcriptase (Qiagen).

Real time PCR analysis

The oligonucleotide primers for PR-AB, PR-B, AR and Cyclophilin A are presented in Table 4, as well as their predicted sizes. Real time PCR was performed in a DNA Engine Opticon™ 2 System (MJ Research, Waltham, MA). For PCR, the cDNAs corresponding to 40-100 ng (see Table 2) RNA were added to 10 μl of Quantitect™ SYBR® Green PCR mix (Qiagen) containing HotStarTaq DNA polymerase, PCR buffer, dNTP mixture and 0.3 μM of each oligonucleotide primer in a final volume of 20 μl. The reactions were performed in opaque white 0.2 ml low-profile strip tubes sealed with optical flat caps (TLS-0851, TCS-0803, MJ Research). After initial incubation for 15 min at 95°C, the samples were subjected to 40-44 cycles of 10 s at 94°C, 15-20 s at 56°C (see Table 4) and 20 s at 72°C with a final extension step at 72°C for 5 min. All PCR assays were performed twice. The purity of PCR products was confirmed by a melting curve analysis in all experiments (data not shown). All primers were designed to span an intron/exon boundary or to flank an intron. Thus, amplification of contaminating DNA was eliminated. Each PCR assay included a negative control containing a RNA sample without reverse transcription. The primers were based on the sequences of the human genes. The primer pairs (Table 4) were designed with Primer3 software [19].

Table 4.

Oligonucleotide primers used for real-time PCR.

Gene Accession No Primers
F = forward; R = reverse
Position cDNA Annealing step
PRAB NM_000926.4
[37]
F: tggaagaaatgactgcatcg
R: agcatccagtgctctcacaa
bp 2555-2574
bp 2702-2683
product: 148 bp
40 ng 56°C/15 s
PRB NM_000926.4
[37]
F: gactgagctgaaggcaaagg
R: cgaaacttcaggcaaggtgtc
bp 746-765
bp 890-870
product: 145 bp
40 ng 56°C/15 s
AR NM_000044.2 F: taccagctcaccaagctcct
R: gcttcactgggtgtggaaat
bp 3687-3706
bp 3882-3861
product: 195 bp
100 ng 56°C/20 s
Cyclophilin A NM_021130.3 F: gtggtgtttggcaaagtgaa
R: tcgagttgtccacagtcagc
bp 462-481
bp 577-558
product: 116 bp
40 ng 56°C/20 s

Quantification of mRNA

To standardize the quantification method, cyclophilin A was selected as the housekeeping gene. The PCR amplification rate and the cycle threshold (Ct) values were analyzed using Opticon Monitor 3.0 software (MJ Research). The values of relative expression of genes of interest were normalized against the cyclophilin A product.

Immunohistochemical analysis

Immunostaining for the determination of PR-AB, PR-A, PR-B, AR, GR, COX-1 and COX-2 utilizing the avidin-biotin peroxidase complex (ABC) procedure was performed [20]. The 5 μm paraffin sections prepared from cervical biopsies were first dewaxed in Bioclear (Bio-Optica, Milan, Italy), rehydrated and washed with phosphate-buffered saline (PBS; pH 7.4). Thereafter the sections were subjected to microwave antigen retrieval in 0.01 M sodium citrate buffer (pH 6.0) for 10 min and then allowed to cool for 20 min. Subsequently, endogenous peroxidase activity was quenched by immersion in 3% hydrogen peroxide (Merck) in methanol for 10 min at room temperature (RT); followed by blocking non-specific binding of the primary antibody by incubation as shown in Table 5, at RT. The sections were then incubated with the primary antibodies (see Table 5). For the negative controls the primary antibody was replaced by mouse IgG (or in the case of GR rabbit IgG, and for COX-1 and -2 goat IgG) at a corresponding concentration to the antibody it replaced.

Table 5.

Antibodies used in the study.

Protein Primary ab, company and order number Type and dilution Inc temp + time Blocking Biotinylated 2 nd Ab all diluted 1:200 Buffer Inc time in RT
PRAB Zymed Lab Inc, 18-0172 Mc mouse anti human 1:150 RT 60 min 1.5% NHS horse anti-mouse 1.5% NHS in PBS 45 min
PRA Novocastra Labs Ltd, NCL-PGR312 Mc mouse anti human 1:500 RT 60 min 1.5% NHS horse anti-mouse 1.5% NHS in PBS 45 min
PRB Affinity BioReagents Inc, MA1-411 Mc mouse Anti chick 1:100 RT 60 min 1.5% NHS horse anti-mouse 1.5% NHS in PBS 45 min
AR DakoCyto-mation Inc, M3562 Mc mouse anti human 1:100 +4°C o/n 2% NHS horse anti-mouse 2% NHS in PBS 30 min
GR Affinity Bio Reagents Inc, PA1-511A Pc rabbit anti human 1:1000 +4°C o/n 2% NGS goat anti rabbit 2% NGS in PBS 60 min
COX-1 Santa Cruz Biotechnology Inc, sc 1752 Pc goat anti human 1:100 +37°C 60 min 10% NRS rabbit anti goat 10% NRS in PBS 30 min
COX-2 Santa Cruz Biotechnology Inc, sc 1745 Pc goat anti human 1:100 +37°C 60 min 10% NRS rabbit anti goat 10% NRS in PBS 30 min

Mc = monoclonal, Pc = polyclonal

RT = room temperature

biotinylated horse anti-mouse (Vector, Cat# BA-2000)

biotinylated goat anti rabbit (Vector, Cat# BA-1000)

biotinylated rabbit anti goat (Vector, Cat# BA-5000)

The secondary biotinylated antibodies were incubated as shown in Table 5, followed by incubation with an avidin-biotin horseradish peroxidase complex (Vectastain Elite, Cat# PK-6100) for 30 min at RT. The site of the bound enzyme was visualized by the application of 3,3'-diaminobenzidine (DAB kit, Vector, CA), a chromogen which produces a brown, insoluble precipitate when incubated with enzyme. The sections were counterstained with haematoxylin and dehydrated before they were mounted with Pertex (Histolab, Gothenburg).

Image analysis

A Leica microscope and Sony video camera (Park Ridge, NJ, U.S.A.) connected to a computer with an image analysis system (Leica Imaging System Ltd, Cambridge, UK) was used to assess quantitative values from immunohistochemistry. The quantification of immunostaining was performed as described previously [20]. In short, by using colour discrimination software the total area of positively stained nuclei was measured, and expressed as a ratio of the total area of cell nuclei.

Manual scoring

Two observers blinded to the identity of the slides performed all the assessments. The staining was evaluated semi-quantitatively using a grading system. The staining intensity was graded on a scale of (0) no staining, (1) faint, (2) moderate or (3) strong staining.

Statistical analyses

Clinical data were calculated with ANOVA/ANCOVA and significances were evaluated with Scheffe's test. Statistical calculation for serum hormone levels, receptor and mRNA levels was performed by ANOVA on ranks (Kruskal-Wallis test) and significances were evaluated by Dunn's test. Values with different letter designations are significantly different at level p < 0.05.

Results

Clinical data

The median maternal age and fetal gender did not differ between the groups. The neonatal weights were, as was expected, significantly higher in the postterm NR and R groups as compared to term C group (p < 0.05).

Serum levels of steroid hormones and SHBG

No differences were observed for progesterone, total testosterone, 5α-DHT levels or FAI between C (n = 16), R (n = 8) and NR (n = 8) groups. Serum progesterone (medians and range) was 299 (175-563) nmol/L in C, 220 (115-394) in R, and 234 (159-423) in NR. Serum testosterone was 3.06 (1.07-7.84) nmol/L in C, 3.42 (1.72-4.47) in R, and 2.93 (2.13-7.81) in NR. Serum 5α-DHT was 1.02 (0.04-2.42) nmol/L in C, 0.96 (0.57-1.18) in R, and 0.77 (0.58-1.22) in NR. Serum SHBG was significantly lower 301 (248-424) nmol/L in NR (n = 7), as compared to C 512 (304-708) and R 504 (236-644), whereas the FAI (T/SHBG × 100) was comparable between the groups 0.556 (0.187-2.56) in C, 0.770 (0.352-1.75) in R, and 0.834 (0.634-2.60) in NR.

mRNA levels

The PR-AB mRNA level was lower in responders as compared to the non-responders. The ratio between PR-AB and PR-B represents the PR-A mRNA level which did not change between the groups (Figure 1, upper middle panel). The PRB mRNA showed similar results as the PR-AB mRNA, but differences between groups did not reach significance. The AR mRNA level showed a tendency to be increased in the NR group, but did not reach significance (Figure 1, bottom panel).

Figure 1.

Figure 1

Real-time PCR results for expression of PR-AB (upper), PR-AB/PR-B (upper middle), PR-B (lower middle) and AR (bottom) mRNAs in human cervix from the C (n = 11), R (n = 10) and NR (n = 4) groups respectively. The values of relative expression of target genes were normalized against cyclophilin A and displayed in arbitrary units. The ratio of PR-AB/PR-B represents the PR-A expression. The "box-and-whisker plot" represents the median value with 50% of all data falling within the box. The whiskers extend to the 5th and 95th percentiles. Boxes with different letter designations are significantly different, p < 0.05.

Immunohistochemistry

The immunohistochemistry (IHC) scores for nuclear PR-AB (top panel), PR-A (upper middle panel), PR-B (lower middle panel) and AR (bottom panel) protein are presented in Figure 2 and representative images of the IHC results are shown in Figure 3.

Figure 2.

Figure 2

Immunostaining results for PR-AB (top), PR-A (upper middle), PR-B (lower middle) and AR (bottom) in stroma, as assessed by image analysis in cervical samples from controls (C), responders (R) and non-responders (NR). The "box-and-whisker plot" represents the median value with 50% of all data falling within the box. The whiskers extend to the 5th and 95th percentiles. Boxes with different letter designations are significantly different, p < 0.05.

Figure 3.

Figure 3

Representative images of the immunostaining results for PR-AB (A-C), PR-A (D-F), PR-B (G-I), AR (J-L), COX-1 (M), COX-2 (N) and GR (O). A negative control is shown for monoclonal antibodies (P) where the primary antibody was replaced by an equal amount of mouse IgG. The magnification bars represent 30 μm in all images.

The IHC score for PR-AB was lower in responders as compared to non-responders (Figure 2 top panel; Figure 3A-C). The IHC score for PR-B was lower in responders as compared to controls (Figure 2 lower middle panel; Figure 3G-I). The IHC score for PR-A did not differ between study groups.

Immunohistochemical analysis revealed a significantly lower AR expression in the responders as compared to non-responders and controls (Figure 2 bottom panel; Figure 3J-L).

The IHC scores for stromal COX-1, COX-2 and GR did not differ between groups (data not shown). Representative images from immunostaining of COX-1 (M), COX-2 (N) and GR (O) are shown in Figure 3 as well as a negative control (P) where the primary antibody was replaced by an equal amount of mouse IgG.

Discussion

Prolonged pregnancy constitutes a key indication for cervical priming and induction of labor [3-5]. Local treatment with PG-E2 gel has been shown to promote degradation of the extracellular matrix by increasing matrix metalloproteinase (MMP)-1 collagenase activity and by altering the proteoglycan content [2,21,22]. Prostaglandin-E2 was reported to induce a functional progesterone withdrawal in vitro by increasing the inhibitory PR-A over PR-B expression through the protein kinase (PK)-C pathway in a human myometrial cell line (PHM1-31) [23].

We found that serum levels of the receptor ligands were unchanged between the groups. However, the responder group displayed a lower cervical level of total PR-AB protein as compared to non-responders, and a lower cervical PR-B isoform level as compared to controls. The PR mRNA level was lower in responders as compared to non-responders, whereas no difference was found for the inhibitory PR-A isoform, which acts as a repressor of the PR-B isoform and other steroid receptors such as AR and GR [24]. Thus, decreased PR-AB and PR-B protein levels in responders indicate that PG-E2 priming leading to vaginal partus was associated with a nuclear PR withdrawal. The decreased PR-AB level in responders as compared to non-responders could be the consequence of a vaginal delivery. Nevertheless, the decreased PR-B level in responders as compared to controls cannot be explained by a different mode of delivery. Furthermore, PG-E2 promotes chemotaxis in neutrophils and macrophages, which enhances leukocyte extravasation into tissues by a synergistic action with chemotactic interleukin (IL)-8 [1,25,26]. This is in accordance with the high leukocyte density and immunostaining for IL-8 observed in responders [27]. Pro-inflammatory cytokines activate the key pro-inflammatory transcription factor nuclear factor (NF)-κB, which was shown to exert a mutual negative interaction with PR [8,28]. The comparable levels of COX-2 between the groups could be explained by the oxytocin treatment, since oxytocin initiates COX-2 gene transcription [29]. In addition, mechanical stretch induces COX-2 activity [30].

Since the cervical AR protein level was lower in responders not only as compared to non-responders who delivered by cesarean sections, but also as compared to controls who delivered spontaneously, the result cannot be explained by a different mode of delivery. The low AR protein level in responders indicates that successful PG-E2 priming was followed by an androgen withdrawal at the receptor level. This finding is in accordance with results from in vitro studies, in which androgens were reported to attenuate the synthesis of pro-inflammatory cytokines, inhibit MMP-1 production and regulate cervical resistance by altering the proteoglycan content [31-34]. Possible responses to the androgen withdrawal reported here could therefore be events leading to degradation of the extracellular matrix and cervical maturation [21,22,32].

Comparing the results of mRNA and protein for PR-AB, PR-A, PR-B and AR, all showed a similar expression pattern, although only PR-AB displayed significant changes for both mRNA and protein. The lack of significance for mRNA levels of PR-B and AR could be due to the fact that mRNA levels were detected in cervix tissue homogenate whereas the protein levels were determined in stromal nuclei.

The total GR protein level in human uterine cervical stroma and squamous epithelium was decreased after term labor as compared to late pregnancy [35], but no differences were found between the groups in the present study.

In conclusion, successful local PG-E2 treatment for cervical priming after prolonged pregnancy was correlated to a progesterone and androgen withdrawal at the receptor level. A comparable progesterone and androgen withdrawal was neither observed in the non-responders, who failed to enter the active phase of labor and underwent cesarean sections, nor in the term control group with spontaneous deliveries. The progesterone withdrawal is in accordance with the previous study [36], whereas the possibility of an androgen withdrawal, to our knowledge, has not been reported previously. We conclude that successful PG-E2 priming was followed by a functional progesterone and androgen withdrawal at the receptor level in the uterine cervix. It is possible that treatment with an antiprogestin or an antiandrogen could serve as a supplement to PG-E2 priming in non-responders.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

YVS and GEO conceived and designed the study. YVS collected all samples. GEO run the serum samples. TV did the statistics for the clinical data and hormone levels. CSB and LS performed and analysed all mRNA and immunohistochemistry analyses/data, including statistical evaluation. YVS and TV drafted the manuscript. LS and CSB helped to draft the manuscript. All authors read and approved the final manuscript.

Acknowledgments

Acknowledgements

We are grateful for skilful technical assistance from Britt Masironi and Yvonne Pierre. This work was supported by The Swedish Research Council (projects 73X-20137 (LS) 73X-14612 (GE)), The Swedish Society of Medicine (LS) and Karolinska Institutet. C.S. Blesson post doc position is financed by a grant from the Swedish Institute. Financial support was also provided through the regional agreement on medical training and clinical research (ALF) between Stockholm County Council and Karolinska Institutet.

Contributor Information

Ylva Vladic-Stjernholm, Email: ylva.vladic-stjernholm@karolinska.se.

Tomislav Vladic, Email: tomislav.vladic@telia.com.

Chellakkan S Blesson, Email: blesson.selvanesan@ki.se.

Gunvor Ekman-Ordeberg, Email: gunvor.ekman-ordeberg@ki.se.

Lena Sahlin, Email: lena.sahlin@ki.se.

References

  1. Hertelendy F, Zakar T. Prostaglandins and the myometrium and cervix. Prostagl, Leukot Essen Fatty Acids. 2004;70:207–222. doi: 10.1016/j.plefa.2003.04.009. [DOI] [PubMed] [Google Scholar]
  2. Ekman G, Uldbjerg N, Malmstrom A, Ulmsten U. Increased postpartum collagenolytic activity in cervical connective tissue from women treated with prostaglandin E2. Gynecol Obstet Invest. 1983;16:292–298. doi: 10.1159/000299283. [DOI] [PubMed] [Google Scholar]
  3. Lindström K, Fernell E, Westgren M. Developmental data in preschool children born after prolonged pregnancy. Acta Paediatrica. 2005;94:1192–1197. doi: 10.1111/j.1651-2227.2005.tb02073.x. [DOI] [PubMed] [Google Scholar]
  4. Crowley P. Interventions for preventing or improving the outcome of delivery at or beyond term. Cochrane Database of Systematic Reviews. 2000. p. CD000170. [DOI] [PubMed]
  5. WHO WHO: recommended definitions, terminology and format for statistical tables related to the perinatal period and use of a new certificate for cause of perinatal deaths. Modifications recommended by FIGO as amended October 14, 1976. Acta Obstet Gynecol Scand. 1977;56:247–253. [PubMed] [Google Scholar]
  6. Sennstrom MB, Ekman G, Westergren-Thorsson G, Malmstrom A, Bystrom B, Endresen U, Mlambo N, Norman M, Stabi B, Brauner A. Human cervical ripening, an inflammatory process mediated by cytokines. Mol Hum Reprod. 2000;6:375–381. doi: 10.1093/molehr/6.4.375. [DOI] [PubMed] [Google Scholar]
  7. Stygar D, Wang H, Vladic YS, Ekman G, Eriksson H, Sahlin L. Increased level of matrix metalloproteinases 2 and 9 in the ripening process of the human cervix. Biol Reprod. 2002;67:889–894. doi: 10.1095/biolreprod.102.005116. [DOI] [PubMed] [Google Scholar]
  8. Almawi WY, Melemedjian OK. Molecular mechanisms of glucocorticoid antiproliferative effects: antagonism of transcription factor activity by glucocorticoid receptor. J Leuk Biol. 2002;71:9–15. [PubMed] [Google Scholar]
  9. Stites DP, Siiteri PK. Steroids as immunosuppressants in pregnancy. Immunol Rev. 1983;75:117–138. doi: 10.1111/j.1600-065X.1983.tb01093.x. [DOI] [PubMed] [Google Scholar]
  10. Stjernholm-Vladic Y, Wang H, Stygar D, Ekman G, Sahlin L. Differential regulation of the progesterone receptor A and B in the human uterine cervix at parturition. Gynecol Endocrin. 2004;18:41–46. doi: 10.1080/09513590310001651777. [DOI] [PubMed] [Google Scholar]
  11. Stjernholm Y, Sahlin L, Malmstrom A, Barchan K, Eriksson HA, Ekman G. Potential roles for gonadal steroids and insulin-like growth factor I during final cervical ripening. Obstet Gynecol. 1997;90:375–380. doi: 10.1016/S0029-7844(97)00245-7. [DOI] [PubMed] [Google Scholar]
  12. Smith R, Mesiano S, McGrath S. Hormone trajectories leading to human birth. Regul Pept. 2002;108:159–164. doi: 10.1016/S0167-0115(02)00105-2. [DOI] [PubMed] [Google Scholar]
  13. Bishop EH. Pelvic Scoring for Elective Induction. Obstet Gynecol. 1964;24:266–268. [PubMed] [Google Scholar]
  14. O'Driscoll K, Foley M, MacDonald D. Active management of labor as an alternative to cesarean section for dystocia. Obstet Gynecol. 1984;63:485–490. [PubMed] [Google Scholar]
  15. Watson WJ, Stevens D, Welter S, Day D. Factors predicting successful labor induction. Obstet Gynecol. 1996;88:990–992. doi: 10.1016/S0029-7844(96)00321-3. [DOI] [PubMed] [Google Scholar]
  16. Gustafsson O, Norming U, Gustafsson S, Eneroth P, Astrom G, Nyman CR. Dihydrotestosterone and testosterone levels in men screened for prostate cancer: a study of a randomized population. Br J Urol. 1996;77:433–440. doi: 10.1046/j.1464-410x.1996.89120.x. [DOI] [PubMed] [Google Scholar]
  17. Mendel CM. The free hormone hypothesis: a physiologically based mathematical model. Endocr Rev. 1989;10:232–274. doi: 10.1210/edrv-10-3-232. [DOI] [PubMed] [Google Scholar]
  18. Pardridge WM. Serum bioavailability of sex steroid hormones. Clin Endocrin Metab. 1986;15:259–278. doi: 10.1016/S0300-595X(86)80024-X. [DOI] [PubMed] [Google Scholar]
  19. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. 2000;132 doi: 10.1385/1-59259-192-2:365. [DOI] [PubMed] [Google Scholar]
  20. Wang H, Masironi B, Eriksson H, Sahlin L. A comparative study of estrogen receptors alpha and beta in the rat uterus. Biol Reprod. 1999;61:955–964. doi: 10.1095/biolreprod61.4.955. [DOI] [PubMed] [Google Scholar]
  21. Granström L, Ekman G, Malmstrom A. Insufficient remodelling of the uterine connective tissue in women with protracted labour. Br J Obst Gyn. 1991;98:1212–1216. doi: 10.1111/j.1471-0528.1991.tb15391.x. [DOI] [PubMed] [Google Scholar]
  22. Norman M, Ekman G, Malmstrom A. Prostaglandin E2-induced ripening of the human cervix involves changes in proteoglycan metabolism. Obstet Gynecol. 1993;82:1013–1020. [PubMed] [Google Scholar]
  23. Madsen G, Zakar T, Ku CY, Sanborn BM, Smith R, Mesiano S. Prostaglandins differentially modulate progesterone receptor-A and -B expression in human myometrial cells: evidence for prostaglandin-induced functional progesterone withdrawal. J Clin Endocrin Metab. 2004;89:1010–1013. doi: 10.1210/jc.2003-031037. [DOI] [PubMed] [Google Scholar]
  24. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O'Malley BW, McDonnell DP. Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrin. 1993;7:1244–1255. doi: 10.1210/me.7.10.1244. [DOI] [PubMed] [Google Scholar]
  25. Coleman RA, Smith WL, Narumiya S. International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol Rev. 1994;46:205–229. [PubMed] [Google Scholar]
  26. Denison FC, Calder AA, Kelly RW. The action of prostaglandin E2 on the human cervix: stimulation of interleukin 8 and inhibition of secretory leukocyte protease inhibitor. Am J Obstet Gynecol. 1999;180:614–620. doi: 10.1016/S0002-9378(99)70263-2. [DOI] [PubMed] [Google Scholar]
  27. Sahlin L, Stjernholm-Vladic Y, Roos N, Masironi B, Ekman-Ordeberg G. Impaired leukocyte influx in cervix of postterm women not responding to prostaglandin priming. Reprod Biol Endocrin. 2008;6:36. doi: 10.1186/1477-7827-6-36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kalkhoven E, Wissink S, Saag PT van der, Burg B van der. Negative interaction between the RelA(p65) subunit of NF-kappaB and the progesterone receptor. JBC. 1996;271:6217–6224. doi: 10.1074/jbc.271.11.6217. [DOI] [PubMed] [Google Scholar]
  29. Molnar M, Rigo J, Jr, Romero R, Hertelendy F. Oxytocin activates mitogen-activated protein kinase and up-regulates cyclooxygenase-2 and prostaglandin production in human myometrial cells. Am J Obstet Gynecol. 1999;181:42–49. doi: 10.1016/S0002-9378(99)70434-5. [DOI] [PubMed] [Google Scholar]
  30. Leguizamon G, Smith J, Younis H, Nelson DM, Sadovsky Y. Enhancement of amniotic cyclooxygenase type 2 activity in women with preterm delivery associated with twins or polyhydramnios. Am J Obstet Gynecol. 2001;184:117–122. doi: 10.1067/mob.2001.108076. [DOI] [PubMed] [Google Scholar]
  31. Gornstein RA, Lapp CA, Bustos-Valdes SM, Zamorano P. Androgens modulate interleukin-6 production by gingival fibroblasts in vitro. J Periodont. 1999;70:604–609. doi: 10.1902/jop.1999.70.6.604. [DOI] [PubMed] [Google Scholar]
  32. Ji H, Dailey TL, Long V, Chien EK. Androgen-regulated cervical ripening: a structural, biomechanical, and molecular analysis. Am J Obstet Gynecol. 2008;198:e541–549. doi: 10.1016/j.ajog.2007.11.012. [DOI] [PubMed] [Google Scholar]
  33. D'Agostino P, Milano S, Barbera C, Di Bella G, La Rosa M, Ferlazzo V, Farruggio R, Miceli DM, Miele M, Castagnetta L, Cillari E. Sex hormones modulate inflammatory mediators produced by macrophages. Ann NY Acad Sci. 1999;876:426–429. doi: 10.1111/j.1749-6632.1999.tb07667.x. [DOI] [PubMed] [Google Scholar]
  34. Ishikawa T, Harada T, Kubota T, Aso T. Testosterone inhibits matrix metalloproteinase-1 production in human endometrial stromal cells in vitro. Reproduction. 2007;133:1233–1239. doi: 10.1530/rep.1.01089. [DOI] [PubMed] [Google Scholar]
  35. Stjernholm-Vladic Y, Stygar D, Mansson C, Masironi B, Akerberg S, Wang H, Ekman-Ordeberg G, Sahlin L. Factors involved in the inflammatory events of cervical ripening in humans. Reprod Biol Endocrinol. 2004;2:74. doi: 10.1186/1477-7827-2-74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Stjernholm YM, Sahlin L, Eriksson HA, Bystrom BE, Stenlund PM, Ekman GE. Cervical ripening after treatment with prostaglandin E2 or antiprogestin (RU486). Possible mechanisms in relation to gonadal steroids. Eur J Obstet Gynecol RB. 1999;84:83–88. doi: 10.1016/S0301-2115(98)00329-7. [DOI] [PubMed] [Google Scholar]
  37. Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P. Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J. 1990;9:1603–1614. doi: 10.1002/j.1460-2075.1990.tb08280.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Reproductive Biology and Endocrinology : RB&E are provided here courtesy of BMC

RESOURCES