Abstract
Purpose
Krüppel-like factor KLF4 plays a crucial role in the development and maintenance of the mouse cornea. Here, we have compared the wild type (WT) and Klf4-conditional null (Klf4CN) corneal gene expression patterns to understand the molecular basis of the Klf4CN corneal phenotype.
Methods
Expression of more than 22,000 genes in 10 WT and Klf4CN corneas was compared by microarrays, analyzed using BRB ArrayTools and validated by Q-RT-PCR. Transient cotransfections were employed to test if KLF4 activates the aquaporin-3, Aldh3a1 and TKT promoters.
Results
Scatter plot analysis identified 740 and 529 genes up- and down-regulated by more than 2-fold, respectively, in the Klf4CN corneas. Cell cycle activators were upregulated while the inhibitors were downregulated, consistent with the increased Klf4CN corneal epithelial cell proliferation. Desmosomal components were downregulated, consistent with the Klf4CN corneal epithelial fragility. Downregulation of aquaporin-3, detected by microarray, was confirmed by immunoblot and immunohistochemistry. Aquaporin-3 promoter activity was stimulated 7–10 fold by cotransfection with pCI-KLF4. Corneal crystallins Aldh3A1 and TKT were downregulated in the Klf4CN cornea and their respective promoter activities were upregulated 16- and 9-fold by pCI-KLF4 in co-transfections. Expression of epidermal keratinocyte differentiation markers was affected in the Klf4CN cornea. While the cornea specific keratin-12 was downregulated, most other keratins were upregulated, suggesting hyperkeratosis.
Conclusions
We have identified functionally diverse candidate KLF4 target genes, revealing the molecular basis of the diverse aspects of the Klf4CN corneal phenotype. These results establish KLF4 as an important node in the genetic network of transcription factors regulating the corneal homeostasis.
Keywords: Cornea, Development, KLF4, Microarray
Introduction
Clear vision requires proper development and maintenance of the cornea, a multilayered tissue comprising an outer stratified squamous epithelium, an inner monolayered endothelium and a central stroma with regularly arranged collagen lamellae sparsely populated by keratocytes. The molecular and cellular mechanisms involved in the development and maintenance of the transparence, refractive and barrier functions of the cornea are exquisitely regulated 1–8. Defective development and/or maintenance of the cornea result in severe defects in vision 9, 10. Different transcription factors influencing corneal morphogenesis and their target genes are known 11–25. In spite of these advances, our knowledge of the genetic network of transcription factors regulating embryonic morphogenesis, postnatal maturation and maintenance of cornea remains incomplete.
KLF4, a member of the Krüppel-like transcription factors (KLF) subfamily of Cys2-His2 zinc finger proteins capable of binding the “GT box” or “CACCC” element, is one of the most highly expressed transcription factors in both 9 day- and 6 week-old mouse cornea 20, 26–29. During development, the expression of KLF4 begins in a stripe of mesenchymal cells extending from the forelimb bud to the developing eye around embryonic day (E) 10 30. In the adult mouse, KLF4 is widely expressed in post-mitotic epithelia of diverse tissues, including skin, gastrointestinal tract and cornea 27, 31, 32. Klf4 null mice die within 15 hours after birth due to late stage defects in skin barrier formation 33. Klf4 conditional null (Klf4CN) corneas derived by mating Klf4-LoxP mice 34 with Le-Cre mice 17, 35 develop multiple ocular defects including corneal epithelial fragility, stromal edema, smaller, vacuolated lens, and loss of conjunctival goblet cells 36. In order to investigate the changes in gene expression underlying the Klf4CN corneal phenotype, we have compared the gene expression patterns of the wild type and Klf4CN corneas by microarray hybridization in the present report. Our results show that KLF4 plays a significant role in maintenance of corneal homeostasis by regulating a wide array of genes encompassing a diverse spectrum of functional subgroups such as regulators of cell proliferation, cell adhesion molecules, corneal crystallins, components of epithelial barrier function and regulators of stromal hydration.
Materials and Methods
Conditional deletion of Klf4
Klf4CN mice were generated on a mixed background by mating Klf4loxP/loxP, Le-Cre/- mice with Klf4loxP/loxP mice as described before 34, 35 a mixed, 36. This mating scheme generated equal numbers of Klf4loxP/loxP, Le-Cre/- (Klf4CN) and Klf4loxP/loxP (control) offspring. Genomic DNA isolated from tail clippings was assayed for the presence of the Klf4-LoxP and Le-Cre transgenes by PCR using specific primers. Mice studied here were maintained in accordance with the guidelines set forth by the Animal Care and Use Committee of the National Eye Institute, NIH, and the ARVO statement for the use of animals in ophthalmic and vision research.
Isolation of total RNA, quality control, labeling and microarray analysis
In the present analysis, we used the whole cornea, comprising epithelial cells, stromal keratocytes and endothelial cells as well as a small number of infiltrating leukocytes. Similar microarray analyses of whole corneas have proven useful in identifying the corneal responses to Aspergillus fumigatus 37 or Pseudomonas aeruginosa 38 infections, diabetic conditions 39 and in characterizing the healing process following laser ablation 40 or keratectomy 41. Five age-matched 8 week-old wild type and Klf4CN mice each were used for comparison of corneal gene expression by microarray analysis. Two dissected corneas from each mouse were combined for isolation of total RNA using the RNeasy Mini kit (Qiagen, Valencia, CA). The RNA was sent to Expression Analysis (Durham, NC) who confirmed the integrity of the isolated total RNA using Agilent Bioanalyzer (Supplementary Figure 1) and subsequently performed the microarray hybridizations. Labeled samples were hybridized with Affymetrix Mouse 430 2.0 arrays containing 45,101 panels, each targeting a specific nucleic acid sequence. In these arrays, approximately 22,000 transcripts identified by Entrez Gene numbers are redundantly targeted by 41,400 panels: the remaining panels target relatively less characterized sequences. The raw data obtained from Expression Analysis was analyzed using BRB ArrayTools software available from NCI, NIH. Microarray data was normalized using median over entire array, and filtered using the following criteria. Genes were excluded from analysis if (1) the P value was greater than 0.005, (2) the % data missing or filtered out were greater than 50%, (3) greater than 20% of expression data values had more than 1.5-fold change in either direction from the median value, or (4) the detection call was “absent” in more than 50 % in both WT and Klf4CN. The microarray results provided in this report are all log transformed.
Validation of microarray results using RT-PCR and real time quantitative RT-PCR
Total RNA isolated from the wild type or Klf4CN corneas was quantified, the concentration adjusted with RNase-free water to 100 ng/μl and one step RT-PCR performed using 100 ng total RNA and Ready-To-Go RT-PCR beads (Amersham Pharmacia Biotech, Piscataway, NJ). In order to distinguish the products amplified from the contaminating genomic DNA if any, from those originating from the mRNA, the forward and reverse primers used in RT-PCR were picked from adjacent exons. The sequence of primers used for RT-PCR is provided in Supplementary Table 1. The RT-PCR products were separated on a 1.5% agarose gel using TBE buffer.
Applied Biosystems (Foster City, CA) was the source of the reagents, equipment and software for TaqMan gene expression quantitative real time RT-PCR assays (Q-RT-PCR). cDNA was generated using High Capacity cDNA Archive Kit and total RNA isolated from pooled corneas of 10 wild type or Klf4CN mice. Q-RT-PCR assays with pre-standardized gene-specific probes for different transcripts were performed in 7900HT thermocycler using 18S rRNA as endogenous control; the results were analyzed using SDS software version 2.1.
Immunoblots and immunohistochemistry
Total protein was extracted by homogenizing dissected corneas in 8.0 M urea, 0.08% Triton X-100, 0.2% sodium dodecylsulfate, 3% β-mercaptoethanol, and proteinase inhibitors and quantified by the bicinchoninic acid method (Pierce, Rockford, IL). Equal amounts of protein were electrophoresed in sodium dodecyl sulfate-polyacrylamide gels, transferred to polyvinylidene difluoride membranes and subjected to immunoblot analysis. Rabbit anti-aquaporin-3(Calbiochem, La Jolla, CA), and anti-actin antibody (Sigma Chemical Company, St. Louis, MO) were used as primary antibodies at a1:1,000 dilution in PBST. Horseradish peroxidase-coupled anti-rabbit immunoglobulin G (Amersham Biosciences, Piscataway, NJ) wasused as a secondary antibody at a 1:5,000 dilution. Immunoreactive bands were visualized by chemiluminescence using Super Signal West Pico solutions (Pierce, Rockford, IL).
For immunohistochemistry, 10 μm-thick cryosections from OCT-embedded eyeballs were fixed in freshly prepared buffered 4% paraformaldehyde for 30 min, blocked with 10% sheep serumin PBST for 1 h at room temperature in a humidified chamber, washed twice with PBST for 5 min each, incubated with a 1:100dilution of the primary antibody for 1 h at room temperature, washed thrice with PBST for 10 min each, incubated with secondary antibody (Alexafluor 555-coupled goat anti-rabbit IgG antibody; Molecular Probes, Carlsbad, CA) at a 1:300 dilution for 1 hat room temperature, washed thrice with PBST for 10 min each, mounted with Prolong Gold antifade reagent with DAPI (Molecular Probes, Carlsbad, CA), and observed with a Zeiss Axioplan 2fluorescence microscope.
Reporter vectors, cell culture, and promoter activities
Mouse genomic DNA was used to amplify different promoter fragments used in cotransfection assays reported here. Aquaporin3 (Aqp3) −502/+42 bp and −262/+42 bp promoter fragments were amplified by using the downstream Aqp3 +42/+22C HindIII (+42 ATGCAAGCTTGTCCGGCGGCGTACGAGTGC +22C)and upstream Aqp3 − 502/−482 XhoI (−502 ATGCCTCGAGCACGAAGCGCTGGTGAATTC −482)or Aqp3 −262/−245 XhoI (−262 ATGCCTCGAGGGAGACCGCTTGCTCTTC −245)primers. Transketolase (TKT) −518/+104 bp promoter fragment was amplified by using upstream TKT −518/−491 KpnI (−518 GGCCGGTACCGGCAAACCCAGTAATCTC −491) and downstream TKT +104/+87 HindIII (+104 GGCCAAGCTTCCTTCCATGGCGTGGTAGG +87) primers. Aldh3a1 −1050/+3486 bp promoter fragment was isolated as described previously (Davis et al. 2007, Invest. Ophthalmol. Vis. Sci., in press). These promoter fragments were cloned upstream of the luciferase reporter gene in pGL3Basic vector (Promega, Madison, WI) to generate the reporter vectors. Full length KLF4 was transiently expressed using the CMV promoter in pCI-Klf4. Monkey kidney Cos7 cells were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum, penicillin and streptomycin at 37°C in a humidified chamber containing 5% CO2 in air. Simian virus SV40-transformed human corneal epithelial (HCE)cells 42 were grown at 37°C in Ham’s F-12 supplemented with 10% fetal bovine serum,0.5% (vol/vol) dimethyl sulfoxide, cholera toxin (0.1 μg/ml), epidermal growth factor (10 ng/ml), insulin (5 μg/ml), gentamicin (40 μg/ml), and glutamine (20 mM) in a humidified chamber containing 5% CO2 in air. Mid-log phase cells in six-well plates were transfected with 0.5 μg of pAldh3A1-Luc or pTKT-Luc or pAqp3-Luc, along with 10 ng pRL-SV40 (Promega, Madison WI, for normalization of transfection efficiency) and0.5 μg of pCI or pCI-Klf4, using 3 μl of Fugene 6 reagent (Roche Molecular Biochemicals). After 2 days, cells were washed with cold PBS and lysed with 500 μl of passive lysis buffer (Promega, Madison, WI). The lysate was clarified by centrifugation and 50 μg protein in the lysate was analyzed using a dual-luciferase assay kit (Promega, Madison WI) and a Victor microplate luminometer (Perkin-Elmer). The measurement was integrated over 10 seconds with a delay of 2 seconds. Results from at least three independent experiments, normalized for transfection efficiency using theSV40 promoter-driven Renilla luciferase activity, were used to obtain mean promoter activities and standard deviation. Fold-activation was determined by dividing mean promoter activity by the promoter activity without added pCI/pCI-KLF4.
Results
Microarray analysis and validation of results
In order to obtain mechanistic insight into the diverse ocular surface phenotype observed in the Klf4CN mice 36, we compared the gene expression patterns between the wild type and Klf4CN corneas by microarray hybridization. Scatter plot analysis of the 6333 genes that passed the filtering criteria described in Materials and Methods showed that 529 genes were downregulated and 740 genes were upregulated by more than 2-fold in the Klf4CN compared to the wild type corneas (Fig. 1, Supplementary Tables 2A and 2B). Microarray results were validated by quantitative real time RT-PCR comparison of expression levels of 19 different genes (Table 1). There was a general conformity between the microarray and Q-RT-PCR results, indicating that the microarray results reflect the extent of changes in gene expression in the Klf4CN corneas (Table 1). The candidate KLF4 target genes, whose expression was significantly affected in the Klf4CN corneas, fall into different functional subgroups regulating diverse functions such as cell proliferation, apoptosis, development, immune response and barrier function. Below, we have analyzed the microarray results further, to correlate different aspects of the Klf4CN corneal phenotype with specific changes in gene expression, thus revealing the diverse contributions of KLF4 to corneal physiology.
Figure 1.
Scatter plot analysis of 6333 genes passing the filter described in Materials and Methods. Expression of 529 genes was downregulated and 740 genes upregulated by more than two folds in Klf4CN compared to the wild type corneas. The expression of about 80% of the genes (5064 genes) passing the filter remained relatively stable with less than 2-fold change.
Table 1.
Validation of microarray analysis results by real time quantitative RT-PCR of selected genes.
| Gene Symbol | Fold Difference as Measured by | |
|---|---|---|
| Microarray | Q-RT-PCR | |
| Alox12e | 19.64 | 61.34 |
| Alox15 | 86.21 | 137.26 |
| Aqp3 | 0.44 | 0.45 |
| Aqp5 | 0.09 | 0.24 |
| Krt1-12 | 0.91 | 0.33 |
| Krt1-17 | 57.79 | 80.59 |
| Krt2-4 | 5.98 | 10.7 |
| Lumican | 1.08 | 1.36 |
| CcnD2 | 5.86 | 5.71 |
| Lamb1-1 | 0.29 | 0.34 |
| Muc1 | 3.94 | 7.04 |
| Sprr2A | 77.43 | 20.01 |
| ALDH3A1 | 0.92 | 0.41 |
| ELF3 | 0.76 | 0.65 |
| IRF1 | 0.6 | 0.56 |
| Pax6 | 0.38 | 0.55 |
| SLURP1 | 0.02 | 0.1 |
| GSTO1 | 1.33 | 0.84 |
| SPARC | 1.41 | 1.7 |
Role of KLF4 in regulating the progression of corneal epithelial cell cycle
In view of the increased rate of Klf4CN corneal epithelial cell proliferation 36, we examined the expression pattern of a subset of genes known to participate in or regulate cell cycle. Several cell proliferation activators were upregulated (Table 2A) while cell cycle suppressors were downregulated (Table 2B) in the Klf4CN cornea, compared to the wild type. Important activators of cell cycle that were upregulated include cyclin D2, cyclin-dependent kinase 6, receptor type protein tyrosine phosphatase-b and -c, and FMS like tyrosine kinase-1 (Table 2A). Significantly downregulated inhibitors of cell cycle include retinoblastoma-1 (Rb) and cyclin-dependent kinase inhibitor 1a (p21) (Table 2B). Upregulation of activators of cell cycle and downregulation of inhibitors of cell cycle are consistent with the increased cell proliferation in the Klf4CN corneal epithelium 36.
Table 2.
| Table 2A. Expression levels of genes involved in cell cycle regulation, upregulated in the Klf4CN compared to the wild type corneas. The values shown for the wild type and Klf4CN cornea are log transformed. | ||||
|---|---|---|---|---|
| Description | Gene symbol | WT | Klf4 CN | Fold Difference |
| cyclin D2 (Validated by Real time Q-RT-PCR) | Ccnd2 | 6.86 | 9.41 | 5.86 |
| cyclin-dependent kinase 6 | Cdk6 | 9.34 | 10.71 | 2.58 |
| protein kinase, cGMP-dependent, type II | Prkg2 | 5.80 | 8.29 | 5.64 |
| protein kinase, cAMP dependent regulatory, type I, alpha | Prkar1a | 5.68 | 6.86 | 2.27 |
| FMS-like tyrosine kinase 1 | Flt1 | 5.64 | 6.95 | 2.48 |
| protein kinase C, mu | Prkcm | 5.71 | 7.20 | 2.80 |
| Protein tyrosine phosphatase, receptor type, B | Ptprb | 5.84 | 7.25 | 2.66 |
| protein tyrosine phosphatase, receptor type, C | Ptprc | 6.04 | 8.41 | 5.19 |
| early growth response 1 | Egr1 | 9.70 | 11.38 | 3.20 |
| Jun oncogene | Jun | 9.69 | 10.86 | 2.26 |
| expressed in non-metastatic cells 1, protein | Nme1 | 11.70 | 12.77 | 2.11 |
| platelet derived growth factor receptor, beta polypeptide | Pdgfrb | 8.08 | 9.25 | 2.26 |
| Eph receptor A4 | Epha4 | 9.38 | 10.72 | 2.52 |
| Table 2B. Expression levels of genes involved in cell cycle regulation, downregulated in the Klf4CN compared to the wild type corneas. The values shown for the wild type and Klf4CN cornea are log transformed. | ||||
|---|---|---|---|---|
| Description | Gene symbol | WT | Klf4 CN | Fold Difference |
| Eph receptor B6 | Ephb6 | 8.07 | 6.95 | 0.46 |
| ephrin A1 | Efna1 | 10.04 | 8.9 | 0.45 |
| ephrin B1 | Efnb1 | 9.12 | 7.96 | 0.45 |
| Cyclin-dependent kinase inhibitor 1a (p21) | cdkn1a | 11.76 | 10.92 | 0.56 |
| adenylate kinase 1 | Ak1 | 9.41 | 8.11 | 0.41 |
| NIMA (never in mitosis gene a)-related expressed kinase 3 | Nek3 | 9.11 | 7.4 | 0.31 |
| macrophage stimulating 1 receptor (c-met-related tyrosine kinase) | Mst1r | 8.9 | 7.89 | 0.5 |
| protein kinase C, beta 1 | Prkcb1 | 7.56 | 6.53 | 0.49 |
| protein kinase C, iota | Prkci | 10.67 | 9.28 | 0.38 |
| non-catalytic region of tyrosine kinase adaptor protein 1 | Nck1 | 11.46 | 10.44 | 0.49 |
| Rous sarcoma oncogene | Src | 9.01 | 7.99 | 0.49 |
| fibroblast growth factor receptor 2 | Fgfr2 | 10.28 | 9.08 | 0.43 |
| RAN binding protein 2 | Ranbp2 | 5.5 | 4.19 | 0.4 |
| retinoblastoma 1 | Rb1 | 6.48 | 4.24 | 0.21 |
| growth arrest and DNA-damage-inducible 45 alpha | Gadd45a | 10.95 | 9.82 | 0.46 |
| growth arrest specific 2 | Gas2 | 8.55 | 7.32 | 0.43 |
Role of KLF4 in regulation of epithelial cell-cell adhesion
In spite of the increased rate of cell proliferation, the Klf4CN cornea possessed fewer epithelial cell layers than the wild type, suggesting reduced cell-cell adhesion at the Klf4CN ocular surface 36. To explore this possibility further, we examined the expression of different components of desmosomes, the intercellular adhesion complexes prevalent in the stratified epithelia 43. Expression of most of the desmosomal components was significantly downregulated in the Klf4CN cornea, strongly supporting the notion that compromised cell-cell adhesion is responsible for the reduced numbers of Klf4CN corneal epithelial cell layers (Fig. 2A). Comparison of expression of these desmosomal components in the wild type and Klf4CN corneas by semi-quantitative RT-PCR validated the microarray results (Fig. 2B).
Figure 2.
A. Expression levels of different desmosomal components in the wild type and Klf4CN corneas. The values shown are log transformed.
B. Validation of downregulation of genes encoding desmosomal components in the Klf4CN compared to the wild type corneas, by semi-quantitative RT-PCR. M, Molecular weight markers; WT, wild type; CN, Klf4 conditional null.
Role of KLF4 in regulation of corneal hydration
Aquaporin-1, -3 and -5 are responsible for keeping the hydrophilic corneal stroma from abnormal swelling 44, 45. Previously, we have reported that the downregulation of Aqp5 may be responsible for the Klf4CN corneal stromal edema 36. In addition to confirming the downregulation of Aqp5, the present microarray analysis revealed that the expression of Aqp3 also is reduced in the Klf4CN cornea to about half of that in the wild type, while the expression of Aqp1 remained relatively unaffected. Downregulation of Aqp3 transcripts and the 38 kDa Aqp3 protein was validated by Q-RT-PCR (Table 1, Fig. 3A) and immunoblot analysis (Fig. 3B), respectively. Equal loading of proteins for immunoblot analysis was confirmed by stripping the membrane of antibodies and reprobing with an anti-actin antibody, which did not show any difference between wild type and Klf4CN corneas (Fig. 3B). Immunohistochemistry confirmed the reduction in the amount of Aqp3 in the Klf4CN corneal epithelium (Fig. 3C) consistent with the reduced amount of Aqp3 in the Klf4CN corneal extracts compared with the wild type extracts (Fig. 3B). In view of the reduced stratification of the Klf4CN corneal epithelium (Fig. 3C), it was uncertain to what extent the reduced Aqp3 protein band in the immunoblot (Fig. 3B) was due to reduced expression of Aqp3 in the epithelium or to the relatively large stromal cell representation in the Klf4CN corneal extracts inasmuch as stromal cells do not express Aqp3 46, 47; present data, yet contain actin which was used for normalization. In order to more directly test if KLF4 stimulates Aqp3 promoter activity, we utilized co-transfection assays in cultured cells. Both −502/+42 bp and −262/+42 bp Aqp3 promoter activities were upregulated 8 to 9-fold by co-transfection with pCI-KLF4, indicating that the KLF4 binding sites reside within the −262/+42 bp region of the Aqp3 proximal promoter (Fig. 3D). Taken together, these results show that Aqp3 promoter is regulated by KLF4 and suggest that the cumulative effect of reduced expression of Aqp3 and Aqp5 is responsible for the observed Klf4CN stromal edema 36.
Figure 3.
Aquaporin-3 expression is reduced in the Klf4CN relative to the wild type cornea.
A. Q-RT-PCR comparison of expression levels of Aqp3 in the wild type and Klf4CN corneas.
B. Immunoblot analysis of Aqp3 levels in total proteins extracted from wild type and Klf4CN corneas. The blot probed with anti-Aqp3 antibody (on the left) was stripped of the antibody and re-probed with anti-actin antibody (on the right) to ensure equal loading of proteins.
C. Immunohistochemistry with anti-Aqp3 antibody. Images in the top row show nuclei stained with DAPI, while those in the bottom row show fluorescence coming from the secondary antibody bound to the primary anti-Aqp3 antibody. The expression of Aqp3 localized to the epithelial and endothelial cell membranes in the wild type (bottom, left), is reduced in the Klf4CN cornea (bottom, center). The sections processed in a similar manner without the primary antibody served as controls (bottom, right).
D. Aquaporin-3 promoter is stimulated by KLF4 in cultured human corneal epithelial cells cotransfected with Aqp3-Luc and pCI-KLF4.
Role of KLF4 in regulation of expression of corneal crystallins
Corneas, like lenses, accumulate unusually high proportions of a few water-soluble proteins termed corneal crystallins, in a taxon-specific manner 48. In the mouse corneal epithelium, aldehyde dehydrogenase-3a1 (Aldh3a1) and transketolase (TKT) comprise 20–50% and 10–15% respectively, of the water-soluble protein49, 50. Microarray comparison indicated that the expression of Aldh3a1 and TKT genes was downregulated in the Klf4CN cornea to 90% and 30% of the wild type, respectively (Fig. 4A). This downregulation was estimated more quantitatively by Q-RT-PCR, which showed that the expression of Aldh3a1 and TKT genes in the Klf4CN cornea was downregulated to 41 % and 56 % of the wild type, respectively (Fig. 4B). In order to directly test the influence of KLF4 on Aldh3A1 and TKT promoter activities, we utilized cotransfection assays in cultured Cos7 cells, in which the −1050/+3486 bp Aldh3A1 promoter and −518/+104 bp TKT promoter activities were upregulated by 16- and 9- fold, respectively, in cells co-transfected with pCI-Klf4, compared to those co-transfected with pCI (Fig. 4C). Taken together, these results suggest that KLF4 contributes to the corneal transparence and refractive properties, by activating the expression of corneal crystallins Aldh3A1 and TKT.
Figure 4.
Expression of corneal crystallins Aldh3a1 and TKT is regulated by KLF4
A. Comparison of expression of Aldh3a1 and TKT in the wild type (WT) and Klf4 conditional null (Klf4CN) cornea, as detected by microarray.
B. Q-RT-PCR comparison of expression of Aldh3a1 and TKT in WT and Klf4CN corneas.
C. Aldh3a1 and TKT promoter activities are stimulated by KLF4 in Cos-7 cells upon cotransfection with pCI-KLF4.
Role of KLF4 in regulating the barrier function of corneal epithelium
Several genes encoding proteins related directly or indirectly to epithelial barrier function were downregulated in the Klf4CN cornea. Uroplakin 3B, an integral membrane protein that contributes to the apical membrane permeability barrier function 51, as well as gastrokine-1 (also known as antrum mucosal protein-18), a mitogenic protein abundantly expressed in the superficial gastric epithelium and down-regulated in gastric carcinoma 52, were significantly downregulated in the Klf4CN cornea (Supplementary Table 2B). The expression of a large number of immune response related genes was affected in the Klf4CN cornea (Supplementary Tables 2A and 2B). The upregulated immune response related genes belonged to diverse groups such as complement components, chemokines and chemokine receptors. Infiltration of the immune cells into the Klf4CN cornea in response to the inflammatory signals generated by the fragile corneal epithelium and edematous stroma may account for the observed upregulation of the immune response related genes in the Klf4CN cornea.
Keratins, the fibrous intermediate-filament protein polymers, play critical roles in maintenance of the epithelial cell structure, protecting them from mechanical trauma. Previously, we have shown that Krt12 promoter is bound and upregulated by KLF4, and that the downregulation of Krt12 may be responsible for the Klf4CN corneal epithelial fragility 36. Microarray analysis showed that while Krt12 was indeed downregulated, most of the other keratins were upregulated, indicating hyperkeratosis in the Klf4CN cornea (Fig. 5A). Semi-quantitative RT-PCR assays validated these microarray results (Fig. 5B).
Figure 5.
A. Expression levels of different keratins in the wild type and Klf4CN corneas. The values shown are log transformed.
B. Validation of upregulation of genes encoding different keratin genes in the Klf4CN compared to the wild type corneas, by semi-quantitative RT-PCR. M, Molecular weight markers; WT, wild type; CN, Klf4 conditional null.
Role of KLF4 in regulation of genes involved in mouse epidermal keratinocyte differentiation
In view of the fact that KLF4 plays a crucial role in the mouse epidermal development 33, we examined the expression pattern of different genes involved in the mouse epidermal keratinocyte differentiation. Oncogenes Ets1 and Jun, as well as tumor necrosis factor receptor Tnfrsf1b, were upregulated, while the expression of epidermal growth factor (egf), protein kinase-Cβ1 and mitogen activated protein kinase kinase-6 (Mapkk6) were downregulated by more than 2-fold in the Klf4CN cornea, compared to the wild type (Supplementary Table 2A; Table 3). Expression of epidermal keratinocyte differentiation markers, such as involucrin and transglutaminase was affected in the Klf4CN cornea. Expression of several members of the Sprr family of proteins, constituents of the cornified envelope in the skin, was upregulated in the Klf4CN cornea (Supplementary Table 2A; Table 3).
Table 3.
Expression levels of mouse epidermal keratinocyte differentiation markers in the wild type and Klf4CN corneas. The values shown for the wild type and Klf4CN cornea are log transformed.
| Description | Gene symbol | WT | Klf4 CN | Fold Difference |
|---|---|---|---|---|
| Tumor necrosis factor receptor superfamily, member 1b | Tnfrsf1b | 5.91 | 7.30 | 2.62 |
| E26 avian leukemia oncogene 1, 5′ domain | Ets1 | 6.84 | 8.32 | 2.77 |
| Jun oncogene | Jun | 9.69 | 10.86 | 2.26 |
| Small proline-rich protein 2a | Sprr2a | 5.96 | 12.24 | 77.43 |
| Small proline-rich protein 2f | Sprr2f | 5.64 | 10.41 | 27.25 |
| Small proline-rich protein 2d | Sprr2d | 2.26 | 5.49 | 25.06 |
| Cystatin B | Cstb | 9.91 | 10.30 | 1.47 |
| Transglutaminase 1 | Tgm1 | 5.56 | 6.02 | 1.58 |
| Transglutaminase 2 | Tgm2 | 9.08 | 9.57 | 1.63 |
| epidermal growth factor | Egf | 8.31 | 7.02 | 0.41 |
| protein kinase C, beta 1 | Prkcb1 | 2.02 | 1.88 | 0.49 |
| Mitogen activated protein kinase kinase | Map2k6 | 8.39 | 7.37 | 0.49 |
| Involucrin | Ivl | 5.78 | 5.18 | 0.55 |
| Transglutaminase 4 | Tgm4 | 5.43 | 5.15 | 0.75 |
| Cystatin A | Csta | 9.59 | 9.10 | 0.61 |
| Cystatin E/M | Cst6 | 9.98 | 8.03 | 0.26 |
Role of KLF4 in the regulation of gene regulatory networks in the cornea
In order to understand the impact of conditional deletion of Klf4 on gene regulatory networks in the cornea, we examined the expression levels of different transcription factors in the Klf4CN cornea. Downregulation of the paired box-homeobox transcription factor Pax6, central to eye development 53, by more than 2-fold as detected by microarray analysis (Table 4), was validated by Q-RT-PCR (Table 1). In addition, special AT-rich sequence binding protein-1 (SATB1), which organizes nuclear architecture and recruits chromatin remodeling factors to specific promoters 54–56, was downregulated by approximately 3-fold (Table 4). Another significantly downregulated transcription factor, inhibitor of DNA binding-2 (Id2), is known to contribute to epithelial cell differentiation and suppress tumor formation 57. In contrast, several stress response related transcription factors such as Ahr 58, E2F5 and EGR1 59, NFκB2 60 and ATF3 61 were significantly upregulated in the Klf4CN cornea, compared to the wild type cornea (Table 4).
Table 4.
Comparison of expression levels of selected transcription factors in the wild type and Klf4CN corneas. The values shown for the wild type and Klf4CN cornea are log transformed.
| Description | Gene symbol | WT | Klf4 CN | Fold Difference |
|---|---|---|---|---|
| Upregulated Genes | ||||
| SRY-box containing gene 4 | Sox4 | 4.49 | 7.52 | 8.19 |
| Nuclear Factor Kapa b2 | Nfkb2 | 5.31 | 7.49 | 4.52 |
| Activating transcription factor 3 | Atf3 | 5.96 | 7.73 | 3.41 |
| E2F transcription factor 5 | E2f5 | 6.08 | 7.92 | 3.57 |
| Aryl-hydrocarbon receptor | Ahr | 9.87 | 11.36 | 2.82 |
| Ribosomal protein S9 | Rps9 | 10.01 | 12.97 | 7.81 |
| Early growth response 1 | Egr1 | 9.70 | 11.38 | 3.20 |
| CCAAT/enhancer binding protein (C/EBP), delta | Cebpd | 8.86 | 11.41 | 5.86 |
| Eukaryotic translation initiation factor 4E member 3 | Eif4e3 | 6.13 | 8.48 | 5.10 |
| GATA binding protein 2 | Gata2 | 6.11 | 7.41 | 2.47 |
| Downregulated Genes | ||||
| Paired box gene 6 | Pax6 | 11.02 | 9.62 | 0.38 |
| Special AT-rich sequence binding protein 1 | Satb1 | 9.17 | 7.14 | 0.24 |
| Inhibitor of DNA binding 2 | Id2 | 12.35 | 10.56 | 0.29 |
| Hepatic leukemia factor | Hlf | 13.11 | 11.88 | 0.43 |
| ELK4, member of ETS oncogene family | Elk4 | 5.2 | 3.5 | 0.31 |
| kinase 4 | Eif2ak4 | 9.30 | 8.12 | 0.44 |
Discussion
Previously, we demonstrated that the structural integrity of the mouse corneal epithelium, stroma and endothelium was affected when the Klf4 gene was deleted, indicating that KLF4 plays a crucial role in the development and maintenance of the mouse cornea 36. We also demonstrated that the expression levels of Krt12 and Aqp5 are reduced in the Klf4CN cornea, consistent with the Klf4CN corneal epithelial fragility and stromal edema, respectively. Here, we have employed microarray analysis to obtain a comprehensive view of the changes in corneal gene expression upon deletion of Klf4. Our findings reveal the molecular basis of the wide ranging influence of KLF4 on corneal homeostasis and identify candidate target genes of KLF4 in the adult mouse cornea.
Previous attempts at KLF4 target gene profiling used a human cell line containing inducible KLF4 62, 63, or transgenic mice over-expressing KLF4 in the epidermis under the control of keratin-5 promoter (Krt5-KLF4) and the Klf4−/− mice 64. In addition to being largely consistent with the earlier reports, our results identify novel KLF4 target genes with specialized functions in the mouse cornea, such as aquaporins-3 and -5, corneal crystallins Aldh3a1 and transketolase, and desmosomal components.
Consistent with the established mechanism of suppression of cell proliferation by KLF4 65, 66, cyclin-D2 was upregulated and cdkn1a (p21) was downregulated in the Klf4CN cornea. Furthermore, our results are consistent with the previous report that several other inhibitors of cell division are upregulated, and activators of cell cycle are downregulated by KLF4 63, suggesting additional mechanisms by which KLF4 can suppress the progression of cell cycle (Tables 2A and 2B).
Many members of the large family of keratins, the major components of the intermediate filaments protecting the epithelial cells from mechanical and non-mechanical stresses 67, are upregulated in the Klf4CN corneas. In contrast to our results, most keratins were upregulated by KLF4 in a KLF4 inducible cell culture system 62. This difference could be due to the different experimental systems used and/or to an indirect hyperkeratinizing response in the Klf4CN cornea as a consequence of the loss of corneal barrier function.
A striking feature of our results is the large number of genes whose expression is affected by the absence of KLF4 in the mouse cornea. While some of these genes are likely to be direct targets of KLF4, the remaining genes may be indirect targets through other transcription factors regulated by KLF4. The expression of Pax6 is reduced to about half in the Klf4CN cornea compared to the wild type cornea. Thus, Pax6 target genes are likely to be included in the list of genes affected by the absence of KLF4. In this regard, it is noteworthy that the Pax6(+/−) corneal epithelium appears remarkably similar to the Klf4CN corneal epithelium with fewer cell layers, roughened ocular surface, and epithelial vacuolation 15, 68. Other transcription factors whose expression in the Klf4CN cornea is reduced (Id2, SATB1, and Elk4) or increased (NFκB, Sox4, Atf3, C/EBPδ. GATA2, Ahr and Egr1) may indirectly contribute to the list of genes with changed expression in the Klf4CN cornea.
In addition to the changes discussed above, the expression of many genes with no established functions in the cornea and/or no apparent relevance to the Klf4CN corneal phenotype was significantly affected in the Klf4CN cornea. Three members of the Ly6/Plaur domain containing proteins- Slurp1, one of the most abundant transcripts in the mouse cornea 27, a ligand for nicotinic acetylcholine receptors and a late marker of epidermal differentiation associated with the inflammatory palmoplantar keratoderma disease Mal de Meleda 69–71, Lynx1 (also a ligand for nicotinic acetylcholine receptors 72), and Lypd2 were significantly downregulated in the Klf4CN cornea (Supplementary Table 2B). Similarly, the expression of 15 and 9 different members of the solute carrier family of proteins was up- and down- regulated respectively, in the Klf4CN compared to the wild type cornea (Supplementary Tables 2A and 2B). Whether these changes contribute to any aspect of the Klf4CN corneal phenotype remains to be established.
The results presented in this report show that KLF4 coordinately regulates functionally related subsets of genes such as those contributing to the control of corneal epithelial cell cycle progression, intercellular adhesion, corneal crystallins, Ly6/Plaur domain containing proteins Slurp1, Lypd2 and Lynx1 69–72 and the small proline-rich proteins (SPRR), the primary constituents of the cornified cell envelope and integral components of the surface barrier 73, 74. We have also shown that KLF4 stimulates the promoter activities of aquaporin-3 and -5 36, and corneal crystallins Aldh3A1 and TKT in cultured cells. It remains to be established if KLF4 plays a direct role in the coordinate regulation of the remaining groups of genes whose expression is affected in the Klf4CN cornea. A fraction of the observed changes in gene expression could be indirect, such as a response to the inflammatory conditions caused by the fragile Klf4CN corneal epithelium. The loss of epithelial barrier function may be responsible for the overexpression of several stress related genes in the Klf4CN cornea, such as the antioxidant enzyme ceruloplasmin that is upregulated in different neurodegenerative disorders including glaucoma 75, 76, arachidonate lipoxygenase-12 and -15, which promote epithelial wound healing and host defense 77, and carbonic anhydrase-2, -12, and -13, regulators of corneal ion transport, that are overexpressed in human glaucoma 78, 79 (Supplementary Tables 2A and 2B).
In summary, the changes in gene expression patterns detected by the present microarray analysis are consistent with the phenotypic changes in the Klf4CN cornea. Our results show that KLF4 contributes to corneal homeostasis by coordinately regulating the expression of subsets of genes involved in specific functions such as progression of cell cycle, cell-cell adhesion, epithelial barrier formation, corneal crystallins and maintenance of corneal hydration. Taken together with our earlier report 36, the present studies establish KLF4 as an important node in the genetic network of transcription factors required for proper development and maintenance of the ocular surface.
Supplementary Material
Acknowledgments
We are grateful to Dr. Stephen Harvey, University of Pittsburgh, for his insightful comments on the manuscript. This work was supported by the intramural research program of the National Eye Institute, NEI Career Development Award1 K22 EY016875-01 (SKS), startup funds from the department of ophthalmology, core grant for vision research (5P30 EY08098-19), Research to Prevent Blindness and the Eye and Ear Foundation, Pittsburgh.
References
- 1.Hay ED. Development of the vertebrate cornea. Int Rev Cytol. 1979;63:263–322. doi: 10.1016/s0074-7696(08)61760-x. [DOI] [PubMed] [Google Scholar]
- 2.Zieske JD. Corneal development associated with eyelid opening. Int J Dev Biol. 2004;48:903–911. doi: 10.1387/ijdb.041860jz. [DOI] [PubMed] [Google Scholar]
- 3.Collinson JM, Morris L, Reid AI, et al. Clonal analysis of patterns of growth, stem cell activity, and cell movement during the development and maintenance of the murine corneal epithelium. Dev Dyn. 2002;224:432–440. doi: 10.1002/dvdy.10124. [DOI] [PubMed] [Google Scholar]
- 4.Beebe DC, Masters BR. Cell lineage and the differentiation of corneal epithelial cells. Investigative ophthalmology & visual science. 1996;37:1815–1825. [PubMed] [Google Scholar]
- 5.Lavker RM, Dong G, Cheng SZ, Kudoh K, Cotsarelis G, Sun TT. Relative proliferative rates of limbal and corneal epithelia. Implications of corneal epithelial migration, circadian rhythm, and suprabasally located DNA-synthesizing keratinocytes. Investigative ophthalmology & visual science. 1991;32:1864–1875. [PubMed] [Google Scholar]
- 6.Thoft RA, Friend J. The X, Y, Z hypothesis of corneal epithelial maintenance. Investigative ophthalmology & visual science. 1983;24:1442–1443. [PubMed] [Google Scholar]
- 7.Cotsarelis G, Cheng SZ, Dong G, Sun TT, Lavker RM. Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: implications on epithelial stem cells. Cell. 1989;57:201–209. doi: 10.1016/0092-8674(89)90958-6. [DOI] [PubMed] [Google Scholar]
- 8.Nagasaki T, Zhao J. Centripetal movement of corneal epithelial cells in the normal adult mouse. Investigative ophthalmology & visual science. 2003;44:558–566. doi: 10.1167/iovs.02-0705. [DOI] [PubMed] [Google Scholar]
- 9.Klintworth GK. The molecular genetics of the corneal dystrophies--current status. Front Biosci. 2003;8:d687–713. doi: 10.2741/1018. [DOI] [PubMed] [Google Scholar]
- 10.Vincent AL, Patel DV, McGhee CN. Inherited corneal disease: the evolving molecular, genetic and imaging revolution. Clin Experiment Ophthalmol. 2005;33:303–316. doi: 10.1111/j.1442-9071.2005.01011.x. [DOI] [PubMed] [Google Scholar]
- 11.Adhikary G, Crish JF, Bone F, Gopalakrishnan R, Lass J, Eckert RL. An involucrin promoter AP1 transcription factor binding site is required for expression of involucrin in the corneal epithelium in vivo. Investigative ophthalmology & visual science. 2005;46:1219–1227. doi: 10.1167/iovs.04-1285. [DOI] [PubMed] [Google Scholar]
- 12.Adhikary G, Crish JF, Gopalakrishnan R, Bone F, Eckert RL. Involucrin expression in the corneal epithelium: an essential role for Sp1 transcription factors. Investigative ophthalmology & visual science. 2005;46:3109–3120. doi: 10.1167/iovs.05-0053. [DOI] [PubMed] [Google Scholar]
- 13.Chiambaretta F, Blanchon L, Rabier B, et al. Regulation of corneal keratin-12 gene expression by the human Kruppel-like transcription factor 6. Investigative ophthalmology & visual science. 2002;43:3422–3429. [PubMed] [Google Scholar]
- 14.Chiambaretta F, Nakamura H, De Graeve F, et al. Kruppel-like factor 6 (KLF6) affects the promoter activity of the alpha1-proteinase inhibitor gene. Investigative ophthalmology & visual science. 2006;47:582–590. doi: 10.1167/iovs.05-0551. [DOI] [PubMed] [Google Scholar]
- 15.Davis J, Duncan MK, Robison WG, Jr, Piatigorsky J. Requirement for Pax6 in corneal morphogenesis: a role in adhesion. J Cell Sci. 2003;116:2157–2167. doi: 10.1242/jcs.00441. [DOI] [PubMed] [Google Scholar]
- 16.Hough RB, Piatigorsky J. Preferential transcription of rabbit Aldh1a1 in the cornea: implication of hypoxia-related pathways. Molecular and cellular biology. 2004;24:1324–1340. doi: 10.1128/MCB.24.3.1324-1340.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Dwivedi DJ, Pontoriero GF, Ashery-Padan R, Sullivan S, Williams T, West-Mays JA. Targeted deletion of AP-2alpha leads to disruption in corneal epithelial cell integrity and defects in the corneal stroma. Investigative ophthalmology & visual science. 2005;46:3623–3630. doi: 10.1167/iovs.05-0028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Francesconi CM, Hutcheon AE, Chung EH, Dalbone AC, Joyce NC, Zieske JD. Expression patterns of retinoblastoma and E2F family proteins during corneal development. Investigative ophthalmology & visual science. 2000;41:1054–1062. [PubMed] [Google Scholar]
- 19.Lambiase A, Merlo D, Mollinari C, et al. Molecular basis for keratoconus: lack of TrkA expression and its transcriptional repression by Sp3. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:16795–16800. doi: 10.1073/pnas.0508516102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nakamura H, Chiambaretta F, Sugar J, Sapin V, Yue BY. Developmentally regulated expression of KLF6 in the mouse cornea and lens. Investigative ophthalmology & visual science. 2004;45:4327–4332. doi: 10.1167/iovs.04-0353. [DOI] [PubMed] [Google Scholar]
- 21.Nakamura H, Ueda J, Sugar J, Yue BY. Developmentally regulated expression of Sp1 in the mouse cornea. Investigative ophthalmology & visual science. 2005;46:4092–4096. doi: 10.1167/iovs.05-0324. [DOI] [PubMed] [Google Scholar]
- 22.Saika S, Muragaki Y, Okada Y, et al. Sonic hedgehog expression and role in healing corneal epithelium. Investigative ophthalmology & visual science. 2004;45:2577–2585. doi: 10.1167/iovs.04-0001. [DOI] [PubMed] [Google Scholar]
- 23.Sivak JM, Mohan R, Rinehart WB, Xu PX, Maas RL, Fini ME. Pax-6 expression and activity are induced in the reepithelializing cornea and control activity of the transcriptional promoter for matrix metalloproteinase gelatinase B. Dev Biol. 2000;222:41–54. doi: 10.1006/dbio.2000.9694. [DOI] [PubMed] [Google Scholar]
- 24.Sivak JM, West-Mays JA, Yee A, Williams T, Fini ME. Transcription Factors Pax6 and AP-2alpha Interact To Coordinate Corneal Epithelial Repair by Controlling Expression of Matrix Metalloproteinase Gelatinase B. Molecular and cellular biology. 2004;24:245–257. doi: 10.1128/MCB.24.1.245-257.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ueta M, Hamuro J, Yamamoto M, Kaseda K, Akira S, Kinoshita S. Spontaneous ocular surface inflammation and goblet cell disappearance in I kappa B zeta gene-disrupted mice. Investigative ophthalmology & visual science. 2005;46:579–588. doi: 10.1167/iovs.04-1055. [DOI] [PubMed] [Google Scholar]
- 26.Chiambaretta F, De Graeve F, Turet G, et al. Cell and tissue specific expression of human Kruppel-like transcription factors in human ocular surface. Mol Vis. 2004;10:901–909. [PubMed] [Google Scholar]
- 27.Norman B, Davis J, Piatigorsky J. Postnatal gene expression in the normal mouse cornea by SAGE. Investigative ophthalmology & visual science. 2004;45:429–440. doi: 10.1167/iovs.03-0449. [DOI] [PubMed] [Google Scholar]
- 28.Bieker JJ. Kruppel-like factors: three fingers in many pies. The Journal of biological chemistry. 2001;276:34355–34358. doi: 10.1074/jbc.R100043200. [DOI] [PubMed] [Google Scholar]
- 29.Dang DT, Pevsner J, Yang VW. The biology of the mammalian Kruppel-like family of transcription factors. Int J Biochem Cell Biol. 2000;32:1103–1121. doi: 10.1016/s1357-2725(00)00059-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ehlermann J, Pfisterer P, Schorle H. Dynamic expression of Kruppel-like factor 4 (Klf4), a target of transcription factor AP-2alpha during murine mid-embryogenesis. Anat Rec A Discov Mol Cell Evol Biol. 2003;273:677–680. doi: 10.1002/ar.a.10089. [DOI] [PubMed] [Google Scholar]
- 31.Garrett-Sinha LA, Eberspaecher H, Seldin MF, de Crombrugghe B. A gene for a novel zinc-finger protein expressed in differentiated epithelial cells and transiently in certain mesenchymal cells. The Journal of biological chemistry. 1996;271:31384–31390. doi: 10.1074/jbc.271.49.31384. [DOI] [PubMed] [Google Scholar]
- 32.Shields JM, Christy RJ, Yang VW. Identification and characterization of a gene encoding a gut-enriched Kruppel-like factor expressed during growth arrest. The Journal of biological chemistry. 1996;271:20009–20017. doi: 10.1074/jbc.271.33.20009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Segre JA, Bauer C, Fuchs E. Klf4 is a transcription factor required for establishing the barrier function of the skin. Nature genetics. 1999;22:356–360. doi: 10.1038/11926. [DOI] [PubMed] [Google Scholar]
- 34.Katz JP, Perreault N, Goldstein BG, et al. The zinc-finger transcription factor Klf4 is required for terminal differentiation of goblet cells in the colon. Development. 2002;129:2619–2628. doi: 10.1242/dev.129.11.2619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ashery-Padan R, Marquardt T, Zhou X, Gruss P. Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye. Genes Dev. 2000;14:2701–2711. doi: 10.1101/gad.184000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Swamynathan SK, Katz JP, Kaestner KH, Ashery-Padan R, Crawford MA, Piatigorsky J. Conditional deletion of the mouse Klf4 gene results in corneal epithelial fragility, stromal edema, and loss of conjunctival goblet cells. Molecular and cellular biology. 2007;27:182–194. doi: 10.1128/MCB.00846-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wang Y, Liu T, Gong H, Zhou Q, Sun S, Xie L. Gene profiling in murine corneas challenged with Aspergillus fumigatus. Mol Vis. 2007;13:1226–1233. [PubMed] [Google Scholar]
- 38.Huang X, Hazlett LD. Analysis of Pseudomonas aeruginosa corneal infection using an oligonucleotide microarray. Investigative ophthalmology & visual science. 2003;44:3409–3416. doi: 10.1167/iovs.03-0162. [DOI] [PubMed] [Google Scholar]
- 39.Saghizadeh M, Kramerov AA, Tajbakhsh J, et al. Proteinase and growth factor alterations revealed by gene microarray analysis of human diabetic corneas. Investigative ophthalmology & visual science. 2005;46:3604–3615. doi: 10.1167/iovs.04-1507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Cao Z, Wu HK, Bruce A, Wollenberg K, Panjwani N. Detection of differentially expressed genes in healing mouse corneas, using cDNA microarrays. Investigative ophthalmology & visual science. 2002;43:2897–2904. [PubMed] [Google Scholar]
- 41.Varela JC, Goldstein MH, Baker HV, Schultz GS. Microarray analysis of gene expression patterns during healing of rat corneas after excimer laser photorefractive keratectomy. Investigative ophthalmology & visual science. 2002;43:1772–1782. [PubMed] [Google Scholar]
- 42.Araki-Sasaki K, Ohashi Y, Sasabe T, et al. An SV40-immortalized human corneal epithelial cell line and its characterization. Investigative ophthalmology & visual science. 1995;36:614–621. [PubMed] [Google Scholar]
- 43.Kottke MD, Delva E, Kowalczyk AP. The desmosome: cell science lessons from human diseases. J Cell Sci. 2006;119:797–806. doi: 10.1242/jcs.02888. [DOI] [PubMed] [Google Scholar]
- 44.Fischbarg J. On the mechanism of fluid transport across corneal endothelium and epithelia in general. Journal of experimental zoology. 2003;300:30–40. doi: 10.1002/jez.a.10306. [DOI] [PubMed] [Google Scholar]
- 45.Verkman AS. Role of aquaporin water channels in eye function. Exp Eye Res. 2003;76:137–143. doi: 10.1016/s0014-4835(02)00303-2. [DOI] [PubMed] [Google Scholar]
- 46.Kenney MC, Atilano SR, Zorapapel N, Holguin B, Gaster RN, Ljubimov AV. Altered expression of aquaporins in bullous keratopathy and Fuchs’ dystrophy corneas. J Histochem Cytochem. 2004;52:1341–1350. doi: 10.1177/002215540405201010. [DOI] [PubMed] [Google Scholar]
- 47.Levin MH, Verkman AS. Aquaporin-dependent water permeation at the mouse ocular surface: in vivo microfluorimetric measurements in cornea and conjunctiva. Investigative ophthalmology & visual science. 2004;45:4423–4432. doi: 10.1167/iovs.04-0816. [DOI] [PubMed] [Google Scholar]
- 48.Piatigorsky J. Gene sharing in lens and cornea: facts and implications. Prog Retin Eye Res. 1998;17:145–174. doi: 10.1016/s1350-9462(97)00004-9. [DOI] [PubMed] [Google Scholar]
- 49.Nees DW, Wawrousek EF, Robison WG, Jr, Piatigorsky J. Structurally normal corneas in aldehyde dehydrogenase 3a1-deficient mice. Molecular and cellular biology. 2002;22:849–855. doi: 10.1128/MCB.22.3.849-855.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Xu ZP, Wawrousek EF, Piatigorsky J. Transketolase haploinsufficiency reduces adipose tissue and female fertility in mice. Molecular and cellular biology. 2002;22:6142–6147. doi: 10.1128/MCB.22.17.6142-6147.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Hu P, Meyers S, Liang FX, et al. Role of membrane proteins in permeability barrier function: uroplakin ablation elevates urothelial permeability. Am J Physiol Renal Physiol. 2002;283:F1200–1207. doi: 10.1152/ajprenal.00043.2002. [DOI] [PubMed] [Google Scholar]
- 52.Oien KA, McGregor F, Butler S, et al. Gastrokine 1 is abundantly and specifically expressed in superficial gastric epithelium, down-regulated in gastric carcinoma, and shows high evolutionary conservation. J Pathol. 2004;203:789–797. doi: 10.1002/path.1583. [DOI] [PubMed] [Google Scholar]
- 53.Kozmik Z. Pax genes in eye development and evolution. Current opinion in genetics & development. 2005;15:430–438. doi: 10.1016/j.gde.2005.05.001. [DOI] [PubMed] [Google Scholar]
- 54.Cai S, Lee CC, Kohwi-Shigematsu T. SATB1 packages densely looped, transcriptionally active chromatin for coordinated expression of cytokine genes. Nature genetics. 2006;38:1278–1288. doi: 10.1038/ng1913. [DOI] [PubMed] [Google Scholar]
- 55.Kumar PP, Bischof O, Purbey PK, et al. Functional interaction between PML and SATB1 regulates chromatin-loop architecture and transcription of the MHC class I locus. Nature cell biology. 2007;9:45–56. doi: 10.1038/ncb1516. [DOI] [PubMed] [Google Scholar]
- 56.Pavan Kumar P, Purbey PK, Sinha CK, et al. Phosphorylation of SATB1, a global gene regulator, acts as a molecular switch regulating its transcriptional activity in vivo. Molecular cell. 2006;22:231–243. doi: 10.1016/j.molcel.2006.03.010. [DOI] [PubMed] [Google Scholar]
- 57.Russell RG, Lasorella A, Dettin LE, Iavarone A. Id2 drives differentiation and suppresses tumor formation in the intestinal epithelium. Cancer research. 2004;64:7220–7225. doi: 10.1158/0008-5472.CAN-04-2095. [DOI] [PubMed] [Google Scholar]
- 58.Nebert DW, Roe AL, Dieter MZ, Solis WA, Yang Y, Dalton TP. Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochemical pharmacology. 2000;59:65–85. doi: 10.1016/s0006-2952(99)00310-x. [DOI] [PubMed] [Google Scholar]
- 59.Stefanovic L, Stefanovic B. Mechanism of direct hepatotoxic effect of KC chemokine: sequential activation of gene expression and progression from inflammation to necrosis. J Interferon Cytokine Res. 2006;26:760–770. doi: 10.1089/jir.2006.26.760. [DOI] [PubMed] [Google Scholar]
- 60.Piva R, Belardo G, Santoro MG. NF-kappaB: a stress-regulated switch for cell survival. Antioxidants & redox signaling. 2006;8:478–486. doi: 10.1089/ars.2006.8.478. [DOI] [PubMed] [Google Scholar]
- 61.Hai T, Wolfgang CD, Marsee DK, Allen AE, Sivaprasad U. ATF3 and stress responses. Gene expression. 1999;7:321–335. [PMC free article] [PubMed] [Google Scholar]
- 62.Chen X, Whitney EM, Gao SY, Yang VW. Transcriptional profiling of Kruppel-like factor 4 reveals a function in cell cycle regulation and epithelial differentiation. Journal of molecular biology. 2003;326:665–677. doi: 10.1016/S0022-2836(02)01449-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Whitney EM, Ghaleb AM, Chen X, Yang VW. Transcriptional profiling of the cell cycle checkpoint gene kruppel-like factor 4 reveals a global inhibitory function in macromolecular biosynthesis. Gene expression. 2006;13:85–96. doi: 10.3727/000000006783991908. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Patel S, Xi ZF, Seo EY, McGaughey D, Segre JA. Klf4 and corticosteroids activate an overlapping set of transcriptional targets to accelerate in utero epidermal barrier acquisition. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:18668–18673. doi: 10.1073/pnas.0608658103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Rowland BD, Bernards R, Peeper DS. The KLF4 tumour suppressor is a transcriptional repressor of p53 that acts as a context-dependent oncogene. Nature cell biology. 2005;7:1074–1082. doi: 10.1038/ncb1314. [DOI] [PubMed] [Google Scholar]
- 66.Rowland BD, Peeper DS. KLF4, p21 and context-dependent opposing forces in cancer. Nature reviews. 2006;6:11–23. doi: 10.1038/nrc1780. [DOI] [PubMed] [Google Scholar]
- 67.Gu LH, Coulombe PA. Keratin function in skin epithelia: a broadening palette with surprising shades. Current opinion in cell biology. 2007;19:13–23. doi: 10.1016/j.ceb.2006.12.007. [DOI] [PubMed] [Google Scholar]
- 68.Ramaesh T, Ramaesh K, Martin Collinson J, Chanas SA, Dhillon B, West JD. Developmental and cellular factors underlying corneal epithelial dysgenesis in the Pax6+/− mouse model of aniridia. Exp Eye Res. 2005;81:224–235. doi: 10.1016/j.exer.2005.02.002. [DOI] [PubMed] [Google Scholar]
- 69.Favre B, Plantard L, Aeschbach L, et al. SLURP1 is a late marker of epidermal differentiation and is absent in Mal de Meleda. J Invest Dermatol. 2007;127:301–308. doi: 10.1038/sj.jid.5700551. [DOI] [PubMed] [Google Scholar]
- 70.Mastrangeli R, Donini S, Kelton CA, et al. ARS Component B: structural characterization, tissue expression and regulation of the gene and protein (SLURP-1) associated with Mal de Meleda. Eur J Dermatol. 2003;13:560–570. [PubMed] [Google Scholar]
- 71.Moriwaki Y, Yoshikawa K, Fukuda H, Fujii YX, Misawa H, Kawashima K. Immune system expression of SLURP-1 and SLURP-2, two endogenous nicotinic acetylcholine receptor ligands. Life Sci. 2007;80:2365–2368. doi: 10.1016/j.lfs.2006.12.028. [DOI] [PubMed] [Google Scholar]
- 72.Miwa JM, Stevens TR, King SL, et al. The prototoxin lynx1 acts on nicotinic acetylcholine receptors to balance neuronal activity and survival in vivo. Neuron. 2006;51:587–600. doi: 10.1016/j.neuron.2006.07.025. [DOI] [PubMed] [Google Scholar]
- 73.Patel S, Kartasova T, Segre JA. Mouse Sprr locus: a tandem array of coordinately regulated genes. Mamm Genome. 2003;14:140–148. doi: 10.1007/s00335-002-2205-4. [DOI] [PubMed] [Google Scholar]
- 74.Tong L, Corrales RM, Chen Z, et al. Expression and regulation of cornified envelope proteins in human corneal epithelium. Investigative ophthalmology & visual science. 2006;47:1938–1946. doi: 10.1167/iovs.05-1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Farkas RH, Chowers I, Hackam AS, et al. Increased expression of iron-regulating genes in monkey and human glaucoma. Investigative ophthalmology & visual science. 2004;45:1410–1417. doi: 10.1167/iovs.03-0872. [DOI] [PubMed] [Google Scholar]
- 76.Stasi K, Nagel D, Yang X, Ren L, Mittag T, Danias J. Ceruloplasmin upregulation in retina of murine and human glaucomatous eyes. Investigative ophthalmology & visual science. 2007;48:727–732. doi: 10.1167/iovs.06-0497. [DOI] [PubMed] [Google Scholar]
- 77.Gronert K, Maheshwari N, Khan N, Hassan IR, Dunn M, Laniado Schwartzman M. A role for the mouse 12/15-lipoxygenase pathway in promoting epithelial wound healing and host defense. The Journal of biological chemistry. 2005;280:15267–15278. doi: 10.1074/jbc.M410638200. [DOI] [PubMed] [Google Scholar]
- 78.Bonanno JA. Identity and regulation of ion transport mechanisms in the corneal endothelium. Prog Retin Eye Res. 2003;22:69–94. doi: 10.1016/s1350-9462(02)00059-9. [DOI] [PubMed] [Google Scholar]
- 79.Liao SY, Ivanov S, Ivanova A, et al. Expression of cell surface transmembrane carbonic anhydrase genes CA9 and CA12 in the human eye: overexpression of CA12 (CAXII) in glaucoma. Journal of medical genetics. 2003;40:257–261. doi: 10.1136/jmg.40.4.257. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.





