Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2009 Oct 9;150(11):4883–4891. doi: 10.1210/en.2009-0158

Impaired Skeletal Muscle β-Adrenergic Activation and Lipolysis Are Associated with Whole-Body Insulin Resistance in Rats Bred for Low Intrinsic Exercise Capacity

Sarah J Lessard 1, Donato A Rivas 1, Zhi-Ping Chen 1, Bryce J van Denderen 1, Matthew J Watt 1, Lauren G Koch 1, Steven L Britton 1, Bruce E Kemp 1, John A Hawley 1
PMCID: PMC2775978  PMID: 19819977

Abstract

Rats selectively bred for high endurance running capacity (HCR) have higher insulin sensitivity and improved metabolic health compared with those bred for low endurance capacity (LCR). We investigated several skeletal muscle characteristics, in vitro and in vivo, that could contribute to the metabolic phenotypes observed in sedentary LCR and HCR rats. After 16 generations of selective breeding, HCR had approximately 400% higher running capacity (P < 0.001), improved insulin sensitivity (P < 0.001), and lower fasting plasma glucose and triglycerides (P < 0.05) compared with LCR. Skeletal muscle ceramide and diacylglycerol content, basal AMP-activated protein kinase (AMPK) activity, and basal lipolysis were similar between LCR and HCR. However, the stimulation of lipolysis in response to 10 μm isoproterenol was 70% higher in HCR (P = 0.004). Impaired isoproterenol sensitivity in LCR was associated with lower basal triacylglycerol lipase activity, Ser660 phosphorylation of HSL, and β2-adrenergic receptor protein content in skeletal muscle. Expression of the orphan nuclear receptor Nur77, which is induced by β-adrenergic signaling and is associated with insulin sensitivity, was lower in LCR (P < 0.05). Muscle protein content of Nur77 target genes, including uncoupling protein 3, fatty acid translocase/CD36, and the AMPK γ3 subunit were also lower in LCR (P < 0.05). Our investigation associates whole-body insulin resistance with impaired β-adrenergic response and reduced expression of genes that are critical regulators of glucose and lipid metabolism in skeletal muscle. We identify impaired β-adrenergic signal transduction as a potential mechanism for impaired metabolic health after artificial selection for low intrinsic exercise capacity.

Reduced β-adrenergic signaling in muscle is associated with impaired metabolic health.

Exercise training is a clinically effective intervention to treat and prevent insulin resistance and type 2 diabetes (1,2). Metabolic changes in skeletal muscle are thought to make an important contribution to improved insulin sensitivity after exercise training (3). However, the precise mechanisms in skeletal muscle by which exercise training enhances whole-body metabolic health are still not well understood.

The simultaneous occurrence of several molecular adaptations in skeletal muscle after exercise training makes it difficult to determine which of these is essential for its insulin-sensitizing effects. To this end, novel animal models that exhibit phenotypes emulating the physiological profiles of sedentary and exercise-trained states have been developed. Through two-way artificial selection for intrinsic aerobic capacity, rodent models of low (LCR) and high (HCR) running capacity have been generated. After 11 generations of two-way selective breeding, aerobic exercise capacity in HCR was 374% higher compared with LCR in the absence of any exercise training (4). Increased running capacity in HCR was associated with improved whole-body insulin sensitivity as evidenced by lower fasting blood glucose and insulin concentrations and higher glucose tolerance (4). Furthermore, recent evidence indicates HCR animals from generation 13 are protected against high-fat diet-induced insulin resistance (5). Thus, divergent LCR/HCR phenotypes afford an appropriate model for identifying the intrinsic metabolic traits that are essential to impart both exercise capacity and insulin sensitivity. Importantly, the metabolic profile of these animals can be studied in the absence of potentially confounding additional adaptations that occur with exercise training.

Multiple changes in skeletal muscle have been linked to exercise-induced insulin sensitivity. Increased fatty acid turnover after endurance training may lead to reduced accumulation of fatty acid species, such as ceramide and diacylglycerol, that inhibit insulin signal transduction (6). The activation of AMP-activated protein kinase (AMPK) has also been linked to enhanced glucose transport and insulin sensitivity in skeletal muscle after endurance training (7,8,9,10). In addition, the stimulation of β-adrenergic signaling in muscle via catecholamine release during exercise is responsible for many training-induced adaptations (11,12) and has an important role in the regulation of muscle metabolism. Specifically, β-adrenergic stimulation regulates lipid turnover in muscle via its activation of hormone-sensitive lipase (HSL), an enzyme that has been linked to skeletal muscle insulin sensitivity (13). Independent activation of the AMPK and β-adrenergic signaling pathways are also responsible for promoting the transcription of several genes that are important in the regulation of skeletal muscle glucose and lipid metabolism, including glucose transporter (GLUT)4, uncoupling protein (UCP)3, and fatty acid translocase (FAT/CD36) (14,15).

We have investigated the metabolic adaptations and cellular signaling pathways that have been implicated as potential mechanisms for exercise-induced insulin sensitization in LCR and HCR. Substrate storage, AMPK activation, and β-adrenergic signal transduction as well as the expression of genes that are associated with insulin sensitivity were examined in the skeletal muscle of LCR and HCR rats. It was hypothesized that molecular traits that are essential to impart both endurance capacity and insulin sensitivity will be divergent in LCR and HCR animals, whereas those that are unnecessary will be similar in these contrary phenotypes.

Materials and Methods

Animals

Rat models with high and low aerobic capacity were bred from genetically heterogeneous N:NIH stock rats by artificial selection for low and high treadmill running capacity as previously reported (4,16). Animals were phenotyped for intrinsic running capacity at 11 wk of age using an incremental treadmill running test, and their running capacity in meters was recorded. Female rats (∼30 wk old) from generations 16, 20, and 22 were used for analysis in the present study. All animal experimentation procedures were carried out with the approval of animal ethics committees from the University of Melbourne, RMIT University, and University of Michigan.

Animals (n = 10 per group; generation 16) were fasted overnight and anesthetized with 60–80 mg/kg body mass of pentobarbital sodium. Blood samples were removed via cardiac puncture, transferred to plastic microcentrifuge tubes, and centrifuged at 4 C for the recovery of serum. Red quadriceps (RQ) and red gastrocnemius (RG) muscles were immediately removed, snap-frozen with clamps cooled in liquid nitrogen, and stored at −80 C for later analysis.

Insulin tolerance test

A separate cohort of animals (n = 8 per group; generation 20) was subjected to an ip insulin tolerance test for the assessment of insulin sensitivity. Animals were fasted for 5 h before receiving an ip injection of insulin (0.85 U/kg body mass). Blood glucose concentrations were measured at 0, 5, 10, 15, 30, 45, and 60 min after the insulin dose, and the area under the blood glucose curve (millimoles per liter × minutes) was calculated for each animal using GraphPad Prism software. The rate constant for glucose disappearance KITT was calculated using the Lundbaek formula KITT = 0.693/t1/2.

Blood metabolite measurements

Serum glucose, triglycerides, and total cholesterol analyses were performed using a modular analytic SWA P module (Roche Diagnostics, Mannheim, Germany) at Melbourne Pathology, Collingwood, Victoria, Australia. Serum free fatty acids were determined using an enzymatic colorimetric method (NEFA C; Wako Chemicals, USA, Inc., Richmond, VA).

Intramuscular substrate storage

Portions of RQ muscle were freeze dried, powdered, and analyzed for the content of glycogen, glycerol, ceramide, and diacylglycerol as previously described (17). Briefly, the freeze-dried, powdered muscle was cleaned of all visible connective tissue and blood under magnification. Skeletal muscle triacylglycerol (total glycerol) content was determined fluorometrically, after Folch lipid extraction and saponification of a portion of dry, powdered tissue. Diacylglycerol and ceramide content was quantified using the diacylglycerol kinase method on a separate aliquot of tissue.

Western blotting

RQ muscle lysates (60 μg) were solubilized in Laemmli buffer, separated by SDS-PAGE, and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat dry milk in Tris-buffered saline with Tween 20 and incubated overnight at 4 C with antibodies specific for phospho-HSL Ser660 (Cell Signaling Technology, Beverly, MA; 4126), total HSL (Abcam, Cambridge, MA; ab17652), β2-adrenergic receptor (Santa Cruz Biotechnology, Santa Cruz, CA; H-73), Nur77 (Cell Signaling; 3562), UCP3 [Affinity BioReagents (Pierce Biotechnology), Rockford, IL; PA1-055], FAT/CD36 (Abcam; FA6-152), or GLUT4 (Abcam; ab654). Membranes were probed with α-tubulin (Sigma Chemical Co., St. Louis, MO; T6074) or actin (Sigma A3853) antibody to monitor protein loading. The immunoreactive proteins were detected with enhanced chemiluminescence and quantified by densitometry.

AMPK activity

AMPK activity, pThr172 phosphorylation, and total protein content were analyzed in RQ muscle as previously described (18). Activities were expressed as picomoles of phosphate transferred to the SAMS peptide per minute per milligram of extract protein subjected to immunoprecipitation. Acetyl-coenzyme A carboxylase (ACC) was affinity purified and quantified using post-AMPK immunoprecipitation supernatants as previously described (18). Total protein content of AMPK subunits were quantified via Western blotting using antibodies specific for α1 (rat 231-251), α2 (rat 351-366), β1 (Epitomics, Burlingame, CA; catalog item1604-1), β2 (rat 24-44; previously described in Ref. 19), γ1 (rat 319-331), and γ3 (Santa Cruz; catalog item C-20).

Skeletal muscle lipolysis in vitro

Methods for the in vitro release of glycerol from skeletal muscle in basal and isoproterenol-stimulated conditions were adapted from Enoksson et al. (20). Briefly, soleus muscles were removed from anesthetized animals (generation 22) and immediately placed in Krebs-Henseleit buffer (KHB) supplemented with 40 mm mannitol. All visible fat and connective tissue was removed, and the muscles were cut into strips weighing 16.8 ± 0.5 mg. Muscle strips were preequilibrated for 30 min in oxygenated KHB supplemented with 5 mm HEPES, 0.1% BSA, 2 mm pyruvate, and 38 mm mannitol. Vessels containing muscle strips were continuously gassed with 95% O2/5% CO2 and kept at 30 C in a gently shaking water bath. After the recovery period, muscle strips were transferred to vials (five strips per vial) containing oxygenated, modified KHB [5 mm HEPES, 2% BSA (fatty acid-free; Sigma), 5 mm glucose, 0.1% ascorbic acid] and incubated at 30 C in the absence (basal) or presence of 10 μm isoproterenol (Sigma). After a 5-h incubation period, the incubation vessels were placed on ice, and muscle strips were blotted and weighed. Samples of the medium were deproteinized with perchloric acid, neutralized with KOH, and analyzed for glycerol content using fluorometric methods as described previously. A separate portion of the medium was analyzed for fatty acid content using an enzymatic colorimetric method (NEFA C; Wako Chemicals).

Triacylglycerol lipase activity

Triacylgycerol lipase activity was determined as previously described using approximately 8 mg powdered RG muscle and [9,10-3H]triolein substrate (21). Radioactivity of the released fatty acids was determined on a β-spectrometer (Tri-Carb 1500; Packard, Canberra, Australia), and activity was normalized to the total protein content of the homogenate.

Real-time PCR

RNA was extracted from RQ muscle (∼50 mg in 1 ml Trizol reagent (Invitrogen, Mount Waverly, Australia). Four micrograms of RNA was reverse-transcribed using Superscript first-strand synthesis system for RT-PCR (Invitrogen, Australia). Changes in gene expression were normalized to the ribosomal protein L32 housekeeping gene (Rpl32; forward, CAGGGTGCGGAGAAGATTCAAGGG; reverse, CTTAGAGGACACGTTGTGAGCAATC). cDNA levels of UCP3 (Ucp3), FAT/CD36 (Cd36), and GLUT4 (Slc2a4) were measured using commercially available primer mixtures (QuantiTect primer assays; QIAGEN, Doncaster, Australia). Primers specific for the sequences of the γ3 regulatory subunit of AMPK (Prkag3; forward, TGAGTCCACCAGGCAGAAGG; reverse, GCACAGTCGGGCAAGAACAG) and Nur77 (NR4A1; forward, TGCTCTGGTCCTCATCACTG; reverse, ACAGCTAGCAATGCGGTTCT) were used to determine the level of expression of their respective gene products. All reactions were run using a commercially available reaction mixture (SYBR GreenER qPCR SuperMix for iCycler; Invitrogen, Australia). Efficiencies of each primer set were assessed using a standard curve analyzed using 0.001–10 ng control cDNA, and results are expressed relative to L32 expression for each sample.

Statistical analysis

Differences between LCR and HCR were identified using a two-tailed t test. Results are expressed as mean ± sem, and statistical significance was accepted at P < 0.05.

Results

Metabolic markers and insulin tolerance

Intrinsic treadmill running capacity was approximately 400% higher in HCR (1497 ± 4 m) than LCR (379 ± 3 m) in generation-16 animals tested at 11 wk of age (Fig. 1A). At the time of tissue collection (age 30 wk), HCR had lower body weight, fasting serum triglycerides, and fasting serum glucose levels than LCR (Table 1). HCR from generation 20 were more insulin sensitive as demonstrated by an approximately 25% lower area under the blood glucose (millimolar) vs. time (minute) curve during an insulin tolerance test (P < 0.001 vs. LCR; Fig. 1B). Rate constants for glucose disappearance (KITT) were 1.73 ± 0.12%/min for LCR and 2.34 ± 0.17%/min for HCR (P = 0.01 vs. LCR).

Figure 1.

Figure 1

Open in a new tab

Running capacity and insulin sensitivity. A, Intrinsic endurance running capacity was assessed in generation-16 LCR and HCR (11 wk old; n = 12 per group) using an incremental treadmill running protocol. B, A separate cohort of animals (generation 20; n = 8 per group) were fasted for 5 h before receiving an ip injection of insulin (0.85 U/kg body mass). Blood glucose concentrations were measured at 0, 15, 30, 45, and 60 min after the insulin dose, and the area under the blood glucose curve (AUC; millimoles per liter × minutes) was calculated for each animal. Values represent average AUC ± sem for each group. Significant differences between groups (P < 0.05) are indicated by the P value shown.

Table 1.

Metabolic characteristics of generation-16 animals selectively bred for low (LCR) and high (HCR) aerobic capacity

LCR HCR
Body weight (g) 275 ± 22 219 ± 21a
Fasting serum
Triglyceride (mm) 0.47 ± 0.03 0.25 ± 0.03a
Total cholesterol (mm) 1.5 ± 0.1 1.6 ± 0.2
NEFA (mm) 0.29 ± 0.04 0.28 ± 0.03
Glucose (mm) 6.6 ± 0.1 6.1 ± 0.2a
Open in a new tab

NEFA, Nonesterified fatty acids. 

a

P < 0.05 vs. LCR. 

Muscle substrate storage

RQ muscle glycogen levels were similar in LCR and HCR (P > 0.05; Fig. 2A). Muscle triacylglycerol levels tended to be higher in HCR (P = 0.07 vs. LCR; Fig. 2B), but no differences were observed in muscle ceramide (Fig. 2C) or diacylglycerol levels (Fig. 2D).

Figure 2.

Figure 2

Open in a new tab

Skeletal muscle carbohydrate and lipid storage. Muscle glycogen (A), triacylglycerol (B), ceramide (C), and diacylglycerol (D) content were quantified in separate aliquots of freeze-dried, powdered RQ muscle and expressed per milligram of muscle dry weight (dw) (n = 8–10 per group).

AMPK activity and subunit expression

The basal activity and Thr172 phosphorylation of the AMPK α1 (Fig. 3A) and α2 (Fig. 3B) subunits of AMPK were similar in the RQ muscle of LCR and HCR (P > 0.05). The total protein content of the α1, α2, β1, β2, and γ1 subunits was also similar between LCR and HCR (Fig. 3C). However, the protein content of the regulatory γ3 subunit of AMPK was higher in HCR than LCR (P < 0.05; Fig. 3C). Phosphorylation at Ser218 and total protein content of the AMPK substrate ACC were not different between LCR and HCR (Fig. 3D).

Figure 3.

Figure 3

Open in a new tab

Skeletal muscle AMPK activity and protein expression. A and B, AMPKα1 (A) and AMPKα2 (B) activity (picomoles per minute per milligram) and relative isoform-specific AMPK Thr172 phosphorylation were measured using the SAMS peptide assay in protein isolated by immunoprecipitation of lysates from unstimulated RQ muscle. C, Whole-muscle lysates were used to determine the protein content of individual AMPK subunits, and α-tubulin was used to confirm equal loading. Approximate molecular weights are shown. D, ACC Ser218 phosphorylation and total protein were quantified using Western blot analysis and densitometry. *, P < 0.05 LCR vs. HCR; n = 8–10 per group. IP, Immunoprecipitates; IB, immunoblots; pACC, phosphorylated ACC.

Isoproterenol-induced skeletal muscle lipolysis in vitro

Basal glycerol release was similar (P = 0.5) between LCR (0.65 ± 0.11 nmol/liter · mg · 5 h) and HCR (0.56 ± 0.07 nmol/liter · mg · 5 h). Using paired muscle strips from the same animal, isoproterenol-induced glycerol release as measured by fold change from basal was higher in HCR (1.76 ± 0.20) than LCR (1.05 ± 0.06; P = 0.004) (Fig. 4A). Muscle fatty acid release was similar in all groups (data not shown), confirming a previous report that fatty acids resulting from skeletal muscle lipolysis are primarily oxidized (20).

Figure 4.

Figure 4

Open in a new tab

Markers of lipolysis and β-adrenergic signaling. A, In vitro glycerol release was measured in isolated soleus muscle strips that were incubated at 30 C for 5 h in the absence (basal) or presence of 10 μm isoproterenol (ISO). The glycerol concentration of the incubation medium was measured using fluorometric methods, and the glycerol release rate from the muscle was calculated as nanomoles per liter per milligram per 5 h. Results are expressed as fold change in glycerol release (ISO/basal) between paired muscle strips from the same animal (n = 7 per group). B, Skeletal muscle triacylglycerol (TG) lipase activity (nanomoles per minute per milligram total protein; n = 6 per group) was measured using [9,10-3H]triolein substrate in unstimulated RG muscles from LCR and HCR. C and D, Phosphorylation of HSL at the Ser660 residue (pSer660; n = 8 per group) (C) and β2-adrenergic receptor protein content (n = 9 per group) (D) were measured in unstimulated RQ muscle by Western immunoblotting. Average values ± sem are shown. Significant differences between groups are indicated by the P values shown. AU, Arbitrary units.

Basal markers of lipolysis and β-adrenergic signaling

Triacylglycerol lipase activity in unstimulated RG muscle was 67% higher in HCR (5.5 ± 0.7 nmol/min/mg) than LCR (3.3 ± 0.7 nmol/min/mg; P = 0.05; Fig. 4B). Increased lipase activity was associated with the activation of HSL. Phosphorylation of HSL at Ser660 was 61% higher in HCR than LCR (P = 0.02; Fig. 4C), with no difference observed in total HSL protein content. Increased phosphorylation of HSL at this protein kinase A (PKA) site was associated with 90% higher protein content of β2-adrenergic receptors in HCR (P < 0.001 vs. LCR; Fig. 4D).

Protein and mRNA content of genes regulated by β-adrenergic signaling

To further assess in vivo β-adrenergic activation in muscle, the expression of genes known to be induced by β-adrenergic signaling was assessed in LCR/HCR. The mRNA and protein content of the transcription factor Nur77 was increased by 80% in the skeletal muscle of HCR (P < 0.05 vs. LCR; Fig. 5, A and B). The mRNA and protein content of the Nur77 target gene UCP3 was also increased in HCR (P < 0.05 vs. LCR). The protein content of two other Nur77 target genes, FAT/CD36 and the AMPK γ3 subunit, was elevated in HCR (P < 0.05 vs. LCR; Fig. 5B) in the absence of changes in mRNA levels (Fig. 5A). No changes were observed in GLUT4 mRNA or protein content (Fig. 5, A and B).

Figure 5.

Figure 5

Open in a new tab

Expression of Nur77 and its target genes. A, Skeletal muscle mRNA levels of the orphan nuclear receptor Nur77 and its associated target genes UCP3, FAT/CD36, AMPK γ3 subunit, and GLUT4 were measured using real-time PCR and expressed relative to the housekeeping gene ribosomal protein L32. B, The corresponding skeletal muscle protein contents were measured by Western immunoblotting. *. P < 0.05 LCR vs. HCR; n = 8–10 per group. AU, Arbitrary units.

Discussion

Rats artificially selected for high endurance capacity exhibit increased whole-body insulin sensitivity compared with those selected for low endurance capacity (4,5), an observation confirmed by results from the present study (Fig. 1). Notably, these differences in exercise capacity and metabolic health occur in the absence of exercise training. Accordingly, we used this selectively bred model of contrasting endurance capacity and health profiles to investigate the molecular mechanisms that have been hypothesized to underlie the insulin-sensitizing effects of exercise training in skeletal muscle. Our primary finding was that low intrinsic running capacity and insulin resistance are associated with the impaired stimulation of lipolysis in response to β-adrenergic signals in skeletal muscle, and this response occurred in the absence of changes in skeletal muscle substrate storage or AMPK activation.

An association has been observed between whole-body insulin resistance and the accumulation of lipids in skeletal muscle (22). However, this relationship is uncoupled in the case of endurance-trained athletes, who maintain insulin sensitivity despite high levels of muscle lipid storage (23). This phenomenon, known as the athlete’s paradox, has been corroborated by studies demonstrating that exercise training improves insulin sensitivity in the absence of decreased triacylglycerol storage in muscle (6,24,25). In line with these observations, we found no association between triacylglycerol storage and insulin sensitivity in LCR and HCR. In fact, we observed a trend (P = 0.07) toward increased triacylglycerol levels in the muscle of HCR (Fig. 2B). Several theories exist to explain the ability of exercise training to improve insulin sensitivity despite elevated or unchanged im triglyceride levels. One proposal is that rather than reducing total lipid storage, exercise training may reduce the accumulation of cytosolic lipid species that are known to impair insulin signal transduction such as diacylglycerol and ceramide (26,27). Therefore, we hypothesized that ceramide and diacylglycerol would be lower in HCR, despite the presence of elevated triacylglycerol. In contrast to this hypothesis, we found that muscle diacylglycerol and ceramide levels were similar in LCR and HCR (Fig. 2, C and D).

A second hypothesis is that exercise training exerts insulin-sensitizing effects in muscle via the chronic activation of AMPK. Exercise training induces a chronic up-regulation of AMPK (7,9,10), and chronic pharmacological activation of AMPK improves skeletal muscle insulin sensitivity (28,29). Although the precise mechanism by which AMPK enhances insulin sensitivity is not known, enhancement of the insulin signal cascade at the level of AS160 (30,31) or inhibition of the mammalian target of rapamycin (mTOR) pathway may be involved (32). Accordingly, we hypothesized that AMPK activation would be increased in the muscle HCR. Contrary to our original hypothesis, AMPK activity, Thr172 phosphorylation, and ACC Ser218 phosphorylation were similar in LCR and HCR (Fig. 3). Muscle protein content of the catalytic (α1 and α2) and regulatory (β1, β2, and γ1) subunits of AMPK were also similar in LCR and HCR, with the exception of the γ3 subunit, which was elevated in HCR. The precise physiological consequence of elevated γ3 subunit expression in HCR is unclear. However, recent evidence suggests the γ3 subunit plays a role in enhancing skeletal muscle carbohydrate and lipid metabolism and is necessary for the AMPK-mediated inhibition of insulin-induced signal transduction by the mammalian target of rapamycin (mTOR) (33). Muscle-specific overexpression of wild-type AMPK γ3 in transgenic mice results in elevated skeletal muscle glycogen storage (34). In the present study, a 30% increase in AMPK γ3 protein (Fig. 5B) was not associated with an increase in RQ muscle glycogen (Fig. 2A). Overall, our results do not support increased activation of the AMPK catalytic subunits as a mechanism for increased endurance capacity and insulin sensitivity in HCR.

Another key regulatory pathway in skeletal muscle that is responsible for the modulation of muscle metabolism in response to exercise is the β-adrenergic pathway. Catecholamines released during exercise bind to muscle β-adrenergic receptors initiating a series of intracellular signaling events involving the activation of stimulatory G (Gs) proteins and PKA, culminating in the activation of target proteins. Endurance-trained athletes have an increased capacity to secrete catecholamines (11), and functional β-adrenergic signaling is necessary for endurance training-induced muscle adaptations in humans (35) and rats (36). Furthermore, β-adrenergic receptor density (37) and sensitivity to β-adrenergic agonists (38) are increased in response to endurance training in rodents. An important function of the β-adrenergic signaling pathway in skeletal muscle during exercise is the mobilization of lipid stores from triacylglycerol and diacylglycerol via the activation of HSL (39). Accordingly, we hypothesized that aspects of the β-adrenergic signaling pathway, including the stimulation of lipolysis by HSL, would be up-regulated in HCR. To test the response of skeletal muscle to β-adrenergic stimulation, we measured the rate of basal and isoproterenol-stimulated lipolysis (glycerol release) in skeletal muscle strips from LCR and HCR. Although basal rates of lipolysis were similar between LCR and HCR, isoproterenol-induced lipolysis was greater in HCR. In fact, LCR were essentially unresponsive to isoproterenol (Fig. 4A).

In addition to our in vitro finding of increased isoproterenol-induced lipolysis in HCR, we observed an increase in TG lipase activity in muscle samples taken from unstimulated LCR and HCR. Elevated triacylglycerol lipase activity in HCR was associated with increased phosphorylation of HSL at Ser660, a stimulatory PKA phosphorylation site, suggesting increased β-adrenergic signaling in HCR in vivo, in the absence of exogenous β-adrenergic agonists (Fig. 4C). Increased triacylglycerol lipase activity in skeletal muscle may also result from increases in adipose triglyceride lipase activity. However, our observation that HCR have a 2-fold higher expression of β2-adrenergic receptor provides a possible mechanism for increased β-adrenergic activation and HSL Ser660 phosphorylation in HCR in vivo (Fig. 4D). An alternative mechanism for increased basal β-adrenergic signaling in HCR is increased circulating catecholamines. Although we did not measure basal catecholamine levels in the present study, our in vitro observations combined with reduced β-adrenergic receptor expression in LCR, provide strong evidence that reduced response to catecholamines is at least partially responsible for impaired basal signal transduction in LCR. In cultured cells, PKA-mediated phosphorylation of AMPK α1 at Ser485 reduces AMPK activity and Thr172 phosphorylation (40). Despite higher PKA-mediated HSL phosphorylation in HCR, we observed similar basal AMPK activation and Thr172 phosphorylation in HCR compared with LCR, indicating these two PKA signaling pathways may be differentially regulated.

The impaired response to β-adrenergic stimulation in LCR may have important implications for skeletal muscle insulin sensitivity and whole-body metabolism. Stimulation of β-adrenergic signal transduction via catecholamines allows for the mobilization and utilization of glucose and lipids as fuel by metabolically active tissues (12). This important role in metabolic regulation has led to the suggestion that impaired β-adrenergic function may be responsible for the metabolic abnormalities associated with obesity and type 2 diabetes. Impaired catecholamine release has been associated with insulin resistance in two independent genetic models of obesity and type 2 diabetes: Tsumura Suzuki obese diabetic (TSOD) mice (41) and obese (fa/fa) Zucker rats (42). There is also significant evidence indicating that lipolysis induced by β-adrenergic stimulation is impaired in the skeletal muscle and adipose tissue of humans with obesity or type 2 diabetes (39). We have not measured adipose tissue lipolysis in response to β-adrenergic stimulation in the present investigation. However, it is possible that alterations in adipose tissue metabolism also contribute to the overall metabolic phenotype of LCR/HCR.

With the selective β2-agonist salbutamol, an impaired response by β2-adrenoreceptors has been identified as the source of reduced lipolysis in response to adrenergic stimulation in obesity (43,44). Blunted lipolysis and fat oxidation in obese individuals has also been associated with specific gene polymorphisms in both the β2-adrenoreceptor (ADRB2) and HSL (HSL/LIPE) genes (45,46). In agreement with previous investigations, we find that increased adiposity, insulin resistance, and impaired lipolytic response to β-adrenergic stimulation are associated with reduced content of β2-adrenoreceptors in skeletal muscle. Given the importance of mobilizing muscle lipid stores to use as fuel in response to β-adrenergic stimulation during exercise, it is likely that impaired lipolysis contributes to low exercise capacity in LCR. Impaired β-adrenergic response in LCR may also impair exogenous substrate delivery to muscle by altering muscle blood flow, which was previously demonstrated to be reduced in LCR (47). In addition to reduced lipolysis in LCR, we have also observed a reduction in the mRNA and protein content of the orphan nuclear receptor Nur77. Primarily studied for its role in apoptosis and immune response, Nur77 has recently been identified as an important metabolic regulator of glucose (48) and lipid metabolism (15) in skeletal muscle and as a potential therapeutic target for the metabolic syndrome (49). The expression of Nur77 in skeletal muscle is reduced in several models of obesity and type 2 diabetes (i.e. ob/ob, db/db, and ZDF) and is increased in response to insulin-sensitizing treatments (i.e. thiazolidinediones), indicating a possible role in the regulation of insulin sensitivity (50). Maxwell et al. (15) demonstrated that small interfering RNA-based gene silencing of Nur77 leads to impaired lipolysis and reduces the expression of several genes that are associated with the regulation of glucose and lipid metabolism in skeletal muscle, including GLUT4, UCP3, FAT/CD36, and the AMPK γ3 subunit. Furthermore, transcription of Nur77 and its target genes is rapidly induced in cultured skeletal muscle cells by the β-adrenergic agonist isoprenaline (15). Therefore, our observation of increased protein content of Nur77 and three of its target genes (UCP3, FAT/CD36, and AMPKγ3; Fig. 5B) in HCR is consistent with an increased β-adrenergic response and provides a possible mechanism for increased lipolysis and insulin sensitivity in this model.

The association between high intrinsic endurance exercise capacity, insulin sensitivity, and Nur77-mediated transcription in HCR provides a novel and potentially mechanistic link between these positive metabolic traits. At present, it is unclear the extent to which Nur77-induced transcription is responsible for the metabolic adaptations to endurance training. However, it has been demonstrated that Nur77 mRNA is increased in human skeletal muscle after a single bout of endurance exercise (51). In addition, the protein content of several Nur77 target genes are known to be increased after endurance training in muscle and have been linked to exercise-mediated insulin sensitization. For example, a 75% increase in skeletal muscle UCP3 protein content was associated with improved insulin sensitivity in patients with type 2 diabetes after 1 yr exercise training (150 min/wk) (52). The precise mechanism by which increased UCP3 expression leads to insulin sensitization is not known. However, Choi et al. (53) have demonstrated that overexpression of UCP3 in skeletal muscle in transgenic mice protected against lipid-induced insulin resistance and improved insulin signal transduction at the level of IRS-1. Similar to UCP3, the mitochondrial protein content of the FAT CD36 is increased by endurance exercise (54), and its muscle-specific overexpression results in improved insulin sensitivity in transgenic mice (55). It has been proposed that increased expression of CD36 may protect against insulin resistance by increasing futile lipid cycling in muscle without altering total lipid storage (56). Our results support this premise and link increased expression of Nur77, UCP3, and CD36 with elevated endurance capacity and whole-body insulin sensitivity in HCR. Although we observed enhanced whole-body insulin sensitivity in HCR, it is unclear whether improved β-adrenergic signaling and Nur77 expression is associated with increased skeletal muscle-specific insulin sensitivity in the present investigation. A previous investigation demonstrated that insulin-stimulated glycogen synthesis in skeletal muscle was not different between LCR and HCR fed a chow diet (5). Therefore, further research is warranted to determine whether Nur77-induced transcription is necessary for exercise-mediated insulin sensitization in skeletal muscle.

In summary, we have used a novel model of genetically imparted endurance exercise capacity and metabolic health to study several mechanisms that have been proposed to be responsible for exercise-induced improvements to insulin sensitivity. Our results demonstrate that rats bred for low aerobic capacity display reduced whole-body insulin sensitivity and an impaired response to β-adrenergic stimulation in skeletal muscle. Impaired β-adrenergic response was associated with decreased muscle lipolysis and reduced expression of genes that are critical regulators of muscle glucose and lipid metabolism. Our investigation identifies impaired β-adrenergic signal transduction as a potential mechanism for impaired metabolic health after artificial selection for low intrinsic exercise capacity.

Acknowledgments

We thank Lori Gilligan and Nathan Kanner the expert care of the LCR and HCR rat colony.

Footnotes

Part of this work was supported by a grant from the National Center for Research Resources (R24 RR17718), National Institutes of Health, U.S. Public Health Service to L.G.K. and S.L.B. J.A.H. and B.E.K. are supported by the Australian Research Council. B.E.K. is a National Health and Medical Research Council Fellow.

Disclosure Summary: The authors have nothing to disclose.

First Published Online October 9, 2009

Abbreviations: ACC, Acetyl-coenzyme A carboxylase; AMPK, AMP-activated protein kinase; FAT, fatty acid translocase; GLUT, glucose transporter; HCR, high running capacity; HSL, hormone-sensitive lipase; KHB, Krebs-Henseleit buffer; LCR, low running capacity; PKA, protein kinase A; RG, red gastrocnemius; RQ, red quadriceps; UCP, uncoupling protein.

References

  1. Houmard JA, Tanner CJ, Slentz CA, Duscha BD, McCartney JS, Kraus WE 2004 Effect of the volume and intensity of exercise training on insulin sensitivity. J Appl Physiol 96:101–106 [DOI] [PubMed] [Google Scholar]
  2. Pedersen BK, Saltin B 2006 Evidence for prescribing exercise as therapy in chronic disease. Scand J Med Sci Sports 16(Suppl 1):3–63 [DOI] [PubMed] [Google Scholar]
  3. Hawley JA, Lessard SJ 2008 Exercise training-induced improvements in insulin action. Acta Physiol (Oxf) 192:127–135 [DOI] [PubMed] [Google Scholar]
  4. Wisløff U, Najjar SM, Ellingsen O, Haram PM, Swoap S, Al-Share Q, Fernström M, Rezaei K, Lee SJ, Koch LG, Britton SL 2005 Cardiovascular risk factors emerge after artificial selection for low aerobic capacity. Science 307:418–420 [DOI] [PubMed] [Google Scholar]
  5. Noland RC, Thyfault JP, Henes ST, Whitfield BR, Woodlief TL, Evans JR, Lust JA, Britton SL, Koch LG, Dudek RW, Dohm GL, Cortright RN, Lust RM 2007 Artificial selection for high-capacity endurance running is protective against high-fat diet-induced insulin resistance. Am J Physiol Endocrinol Metab 293:E31–E41 [DOI] [PubMed] [Google Scholar]
  6. Bruce CR, Thrush AB, Mertz VA, Bezaire V, Chabowski A, Heigenhauser GJ, Dyck DJ 2006 Endurance training in obese humans improves glucose tolerance and mitochondrial fatty acid oxidation and alters muscle lipid content. Am J Physiol Endocrinol Metab 291:E99–E107 [DOI] [PubMed] [Google Scholar]
  7. Frøsig C, Jørgensen SB, Hardie DG, Richter EA, Wojtaszewski JF 2004 5′-AMP-activated protein kinase activity and protein expression are regulated by endurance training in human skeletal muscle. Am J Physiol Endocrinol Metab 286:E411–E417 [DOI] [PubMed] [Google Scholar]
  8. Frøsig C, Rose AJ, Treebak JT, Kiens B, Richter EA, Wojtaszewski JF 2007 Effects of endurance exercise training on insulin signaling in human skeletal muscle: interactions at the level of phosphatidylinositol 3-kinase, Akt, and AS160. Diabetes 56:2093–2102 [DOI] [PubMed] [Google Scholar]
  9. Sriwijitkamol A, Ivy JL, Christ-Roberts C, DeFronzo RA, Mandarino LJ, Musi N 2006 LKB1-AMPK signaling in muscle from obese insulin-resistant Zucker rats and effects of training. Am J Physiol Endocrinol Metab 290:E925–932 [DOI] [PubMed] [Google Scholar]
  10. Wojtaszewski JF, Birk JB, Frøsig C, Holten M, Pilegaard H, Dela F 2005 5′AMP activated protein kinase expression in human skeletal muscle: effects of strength training and type 2 diabetes. J Physiol 564:563–573 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kjaer M 1998 Adrenal medulla and exercise training. Eur J Appl Physiol Occup Physiol 77:195–199 [DOI] [PubMed] [Google Scholar]
  12. Zouhal H, Jacob C, Delamarche P, Gratas-Delamarche A 2008 Catecholamines and the effects of exercise, training and gender. Sports Med 38:401–423 [DOI] [PubMed] [Google Scholar]
  13. Mulder H, Sörhede-Winzell M, Contreras JA, Fex M, Ström K, Ploug T, Galbo H, Arner P, Lundberg C, Sundler F, Ahrén B, Holm C 2003 Hormone-sensitive lipase null mice exhibit signs of impaired insulin sensitivity whereas insulin secretion is intact. J Biol Chem 278:36380–36388 [DOI] [PubMed] [Google Scholar]
  14. Chabowski A, Momken I, Coort SL, Calles-Escandon J, Tandon NN, Glatz JF, Luiken JJ, Bonen A 2006 Prolonged AMPK activation increases the expression of fatty acid transporters in cardiac myocytes and perfused hearts. Mol Cell Biochem 288:201–212 [DOI] [PubMed] [Google Scholar]
  15. Maxwell MA, Cleasby ME, Harding A, Stark A, Cooney GJ, Muscat GE 2005 Nur77 regulates lipolysis in skeletal muscle cells. Evidence for cross-talk between the beta-adrenergic and an orphan nuclear hormone receptor pathway. J Biol Chem 280:12573–12584 [DOI] [PubMed] [Google Scholar]
  16. Koch LG, Britton SL 2001 Artificial selection for intrinsic aerobic endurance running capacity in rats. Physiol Genomics 5:45–52 [DOI] [PubMed] [Google Scholar]
  17. Lessard SJ, Lo Giudice SL, Lau W, Reid JJ, Turner N, Febbraio MA, Hawley JA, Watt MJ 2004 Rosiglitazone enhances glucose tolerance by mechanisms other than reduction of fatty acid accumulation within skeletal muscle. Endocrinology 145:5665–5670 [DOI] [PubMed] [Google Scholar]
  18. Lessard SJ, Chen ZP, Watt MJ, Hashem M, Reid JJ, Febbraio MA, Kemp BE, Hawley JA 2006 Chronic rosiglitazone treatment restores AMPKα2 activity in insulin-resistant rat skeletal muscle. Am J Physiol Endocrinol Metab 290:E251–E257 [DOI] [PubMed] [Google Scholar]
  19. Chen Z, Heierhorst J, Mann RJ, Mitchelhill KI, Michell BJ, Witters LA, Lynch GS, Kemp BE, Stapleton D 1999 Expression of the AMP-activated protein kinase β1 and β2 subunits in skeletal muscle. FEBS Lett 460:343–348 [DOI] [PubMed] [Google Scholar]
  20. Enoksson S, Hagström-Toft E, Nordahl J, Hultenby K, Pettersson N, Isaksson B, Permert J, Wibom R, Holm C, Bolinder J, Arner P 2005 Marked reutilization of free fatty acids during activated lipolysis in human skeletal muscle. J Clin Endocrinol Metab 90:1189–1195 [DOI] [PubMed] [Google Scholar]
  21. Watt MJ, Stellingwerff T, Heigenhauser GJ, Spriet LL 2003 Effects of plasma adrenaline on hormone-sensitive lipase at rest and during moderate exercise in human skeletal muscle. J Physiol 550:325–332 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kelley DE, Goodpaster BH, Storlien L 2002 Muscle triglyceride and insulin resistance. Annu Rev Nutr 22:325–346 [DOI] [PubMed] [Google Scholar]
  23. Goodpaster BH, He J, Watkins S, Kelley DE 2001 Skeletal muscle lipid content and insulin resistance: evidence for a paradox in endurance-trained athletes. J Clin Endocrinol Metab 86:5755–5761 [DOI] [PubMed] [Google Scholar]
  24. Bruce CR, Kriketos AD, Cooney GJ, Hawley JA 2004 Disassociation of muscle triglyceride content and insulin sensitivity after exercise training in patients with type 2 diabetes. Diabetologia 47:23–30 [DOI] [PubMed] [Google Scholar]
  25. Lessard SJ, Rivas DA, Chen ZP, Bonen A, Febbraio MA, Reeder DW, Kemp BE, Yaspelkis 3rd BB, Hawley JA 2007 Tissue-specific effects of rosiglitazone and exercise in the treatment of lipid-induced insulin resistance. Diabetes 56:1856–1864 [DOI] [PubMed] [Google Scholar]
  26. Horowitz JF 2007 Exercise-induced alterations in muscle lipid metabolism improve insulin sensitivity. Exerc Sport Sci Rev 35:192–196 [DOI] [PubMed] [Google Scholar]
  27. Schenk S, Horowitz JF 2007 Acute exercise increases triglyceride synthesis in skeletal muscle and prevents fatty acid-induced insulin resistance. J Clin Invest 117:1690–1698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jessen N, Pold R, Buhl ES, Jensen LS, Schmitz O, Lund S 2003 Effects of AICAR and exercise on insulin-stimulated glucose uptake, signaling, and GLUT-4 content in rat muscles. J Appl Physiol 94:1373–1379 [DOI] [PubMed] [Google Scholar]
  29. Pold R, Jensen LS, Jessen N, Buhl ES, Schmitz O, Flyvbjerg A, Fujii N, Goodyear LJ, Gotfredsen CF, Brand CL, Lund S 2005 Long-term AICAR administration and exercise prevents diabetes in ZDF rats. Diabetes 54:928–934 [DOI] [PubMed] [Google Scholar]
  30. Kramer HF, Witczak CA, Fujii N, Jessen N, Taylor EB, Arnolds DE, Sakamoto K, Hirshman MF, Goodyear LJ 2006 Distinct signals regulate AS160 phosphorylation in response to insulin, AICAR, and contraction in mouse skeletal muscle. Diabetes 55:2067–2076 [DOI] [PubMed] [Google Scholar]
  31. Treebak JT, Birk JB, Rose AJ, Kiens B, Richter EA, Wojtaszewski JF 2007 AS160 phosphorylation is associated with activation of α2β2γ1- but not α2β2γ3-AMPK trimeric complex in skeletal muscle during exercise in humans. Am J Physiol 292:E715–E722 [DOI] [PubMed] [Google Scholar]
  32. Winder WW, Thompson DM 2008 AMPK: the master switch for type 2 diabetes? In: Hawley JA, Zierath JR, eds. Physical activity and type 2 diabetes: therapeutic effects and mechanisms of action. Champaign, IL: Human Kinetics; 177–185 [Google Scholar]
  33. Deshmukh AS, Treebak JT, Long YC, Viollet B, Wojtaszewski JF, Zierath JR 2008 Role of adenosine 5′-monophosphate-activated protein kinase subunits in skeletal muscle mammalian target of rapamycin signaling. Mol Endocrinol 22:1105–1112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yu H, Hirshman MF, Fujii N, Pomerleau JM, Peter LE, Goodyear LJ 2006 Muscle-specific overexpression of wild type and R225Q mutant AMP-activated protein kinase γ3-subunit differentially regulates glycogen accumulation. Am J Physiol 291:E557–E565 [DOI] [PubMed] [Google Scholar]
  35. Sable DL, Brammell HL, Sheehan MW, Nies AS, Gerber J, Horwitz LD 1982 Attenuation of exercise conditioning by β-adrenergic blockade. Circulation 65:679–684 [DOI] [PubMed] [Google Scholar]
  36. Ji LL, Lennon DL, Kochan RG, Nagle FJ, Lardy HA 1986 Enzymatic adaptation to physical training under β-blockade in the rat. Evidence of a β2-adrenergic mechanism in skeletal muscle. J Clin Invest 78:771–778 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Buckenmeyer PJ, Goldfarb AH, Partilla JS, Piñeyro MA, Dax EM 1990 Endurance training, not acute exercise, differentially alters β-receptors and cyclase in skeletal fiber types. Am J Physiol 258:E71–E77 [DOI] [PubMed] [Google Scholar]
  38. Plourde G, Rousseau-Migneron S, Nadeau A 1993 Effect of endurance training on β-adrenergic system in three different skeletal muscles. J Appl Physiol 74:1641–1646 [DOI] [PubMed] [Google Scholar]
  39. Jocken JW, Blaak EE 2008 Catecholamine-induced lipolysis in adipose tissue and skeletal muscle in obesity. Physiol Behav 94:219–230 [DOI] [PubMed] [Google Scholar]
  40. Hurley RL, Barré LK, Wood SD, Anderson KA, Kemp BE, Means AR, Witters LA 2006 Regulation of AMP-activated protein kinase by multisite phosphorylation in response to agents that elevate cellular cAMP. J Biol Chem 281:36662–36672 [DOI] [PubMed] [Google Scholar]
  41. Takahashi A, Tabuchi M, Suzuki W, Iizuka S, Nagata M, Ikeya Y, Takeda S, Shimada T, Aburada M 2006 Insulin resistance and low sympathetic nerve activity in the Tsumura Suzuki obese diabetic mouse: a new model of spontaneous type 2 diabetes mellitus and obesity. Metabolism 55:1664–1669 [DOI] [PubMed] [Google Scholar]
  42. Pacak K, McCarty R, Palkovits M, Cizza G, Kopin IJ, Goldstein DS, Chrousos GP 1995 Decreased central and peripheral catecholaminergic activation in obese Zucker rats. Endocrinology 136:4360–4367 [DOI] [PubMed] [Google Scholar]
  43. Blaak EE, Schiffelers SL, Saris WH, Mensink M, Kooi ME 2004 Impaired β-adrenergically mediated lipolysis in skeletal muscle of obese subjects. Diabetologia 47:1462–1468 [DOI] [PubMed] [Google Scholar]
  44. Schiffelers SL, Saris WH, Boomsma F, van Baak MA 2001 β1- and β2-adrenoceptor-mediated thermogenesis and lipid utilization in obese and lean men. J Clin Endocrinol Metab 86:2191–2199 [DOI] [PubMed] [Google Scholar]
  45. Jocken JW, Blaak EE, Schiffelers S, Arner P, van Baak MA, Saris WH 2007 Association of a β-2 adrenoceptor (ADRB2) gene variant with a blunted in vivo lipolysis and fat oxidation. Int J Obes (Lond) 31:813–819 [DOI] [PubMed] [Google Scholar]
  46. Jocken JW, Blaak EE, van der Kallen CJ, van Baak MA, Saris WH 2008 Blunted β-adrenoceptor-mediated fat oxidation in overweight subjects: a role for the hormone-sensitive lipase gene. Metabolism 57:326–332 [DOI] [PubMed] [Google Scholar]
  47. Howlett RA, Gonzalez NC, Wagner HE, Fu Z, Britton SL, Koch LG, Wagner PD 2003 Selected contribution: skeletal muscle capillarity and enzyme activity in rats selectively bred for running endurance. J Appl Physiol 94:1682–1688 [DOI] [PubMed] [Google Scholar]
  48. Chao LC, Zhang Z, Pei L, Saito T, Tontonoz P, Pilch PF 2007 Nur77 coordinately regulates expression of genes linked to glucose metabolism in skeletal muscle. Mol Endocrinol 21:2152–2163 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Smith AG, Muscat GE 2006 Orphan nuclear receptors: therapeutic opportunities in skeletal muscle. Am J Physiol Cell Physiol 291:C203–C217 [DOI] [PubMed] [Google Scholar]
  50. Fu Y, Luo L, Luo N, Zhu X, Garvey WT 2007 NR4A orphan nuclear receptors modulate insulin action and the glucose transport system: potential role in insulin resistance. J Biol Chem 282:31525–31533 [DOI] [PubMed] [Google Scholar]
  51. Mahoney DJ, Parise G, Melov S, Safdar A, Tarnopolsky MA 2005 Analysis of global mRNA expression in human skeletal muscle during recovery from endurance exercise. FASEB J 19:1498–1500 [DOI] [PubMed] [Google Scholar]
  52. Mensink M, Hesselink MK, Borghouts LB, Keizer H, Moonen-Kornips E, Schaart G, Blaak EE, Schrauwen P 2007 Skeletal muscle uncoupling protein-3 restores upon intervention in the prediabetic and diabetic state: implications for diabetes pathogenesis? Diabetes Obes Metab 9:594–596 [DOI] [PubMed] [Google Scholar]
  53. Choi CS, Fillmore JJ, Kim JK, Liu ZX, Kim S, Collier EF, Kulkarni A, Distefano A, Hwang YJ, Kahn M, Chen Y, Yu C, Moore IK, Reznick RM, Higashimori T, Shulman GI 2007 Overexpression of uncoupling protein 3 in skeletal muscle protects against fat-induced insulin resistance. J Clin Invest 117:1995–2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Holloway GP, Bezaire V, Heigenhauser GJ, Tandon NN, Glatz JF, Luiken JJ, Bonen A, Spriet LL 2006 Mitochondrial long chain fatty acid oxidation, fatty acid translocase/CD36 content and carnitine palmitoyltransferase I activity in human skeletal muscle during aerobic exercise. J Physiol 571:201–210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Héron-Milhavet L, Haluzik M, Yakar S, Gavrilova O, Pack S, Jou WC, Ibrahimi A, Kim H, Hunt D, Yau D, Asghar Z, Joseph J, Wheeler MB, Abumrad NA, LeRoith D 2004 Muscle-specific overexpression of CD36 reverses the insulin resistance and diabetes of MKR mice. Endocrinology 145:4667–4676 [DOI] [PubMed] [Google Scholar]
  56. Bastie CC, Hajri T, Drover VA, Grimaldi PA, Abumrad NA 2004 CD36 in myocytes channels fatty acids to a lipase-accessible triglyceride pool that is related to cell lipid and insulin responsiveness. Diabetes 53:2209–2216 [DOI] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES