Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2009 Oct 5;53(12):5275–5278. doi: 10.1128/AAC.01032-09

Mutations in Ribosomal Protein L3 Are Associated with Oxazolidinone Resistance in Staphylococci of Clinical Origin▿

Jeffrey B Locke 1, Mark Hilgers 1, Karen Joy Shaw 1,*
PMCID: PMC2786331  PMID: 19805557

Abstract

Following recent reports of ribosomal protein L3 mutations in laboratory-derived linezolid-resistant (LZDr) Staphylococcus aureus, we investigated whether similar mutations were present in LZDr staphylococci of clinical origin. Sequence analysis of a variety of LZDr isolates revealed two L3 mutations, ΔSer145 (S. aureus NRS127) and Ala157Arg (Staphylococcus epidermidis 1653059), both occurring proximal to the oxazolidinone binding site in the peptidyl transferase center. The oxazolidinone torezolid maintained a ≥8-fold potency advantage over linezolid for both strains.


Oxazolidinone resistance in clinical staphylococci is most often associated with mutations in 23S rRNA domain V, in particular G2576T (Escherichia coli numbering) (24, 30). Other 23S rRNA mutations, such as G2447T, until recently (19) were strictly associated with laboratory-derived strains (28). Methylation of 23S rRNA (A2503) by the horizontally transmitted Cfr methyltransferase also confers resistance to linezolid (LZD) as well as phenicols, lincosamides, pleuromutilins, and streptogramin A (12, 29). Incidences of LZD resistance in strains lacking 23S rRNA mutations or the cfr gene have prompted analysis of other structural components of the ribosome which may have the potential to influence oxazolidinone binding.

A number of 50S large-subunit ribosomal proteins have regions which interact closely with the oxazolidinone binding site in the peptidyl transferase center (PTC), most notably L3 and L4. In rare cases, mutations in L4 have been implicated in LZD nonsusceptibility in clinical Streptococcus pneumoniae isolates (32) and in laboratory-derived Staphylococcus aureus strains (17). Mutations in L3 have typically been associated with resistance to pleuromutilins (whose binding site overlaps with that of oxazolidinones in the PTC) such as tiamulin (TIA) and retapamulin (1, 2, 8, 13, 20, 22). However, we recently described a variety of L3 mutations in S. aureus following in vitro selection with oxazolidinones LZD and torezolid (TR-700) (17) a novel oxazolidinone with enhanced potency against a broad range of gram-positive pathogens, including strains resistant to LZD (11, 14, 26, 27).

To investigate the relevance of L3 mutations to clinical oxazolidinone resistance, we sequenced L3-encoding rplC genes in 11 Lzdr clinical isolates, 2 of which included the uncharacterized Staphylococcus epidermidis strain 1653059 (cfr negative; methicillin [meticillin]-resistant S. epidermidis [MRSE]; Eurofins Medinet, Inc., Chantilly, VA) and S. aureus strain NRS127 (cfr negative; methicillin resistant; Network of Antimicrobial Resistance in Staphylococcus aureus [NARSA] collection, Chantilly, VA), previously reported as having an unknown, non-23S rRNA-based resistance mechanism (27).

(Portions of this work were presented at the 49th Interscience Conference on Antimicrobial Agents and Chemotherapy [16], San Francisco, CA, 12 to 15 September 2009.)

Chromosomal DNA was isolated, and PCR amplification of the six S. aureus rrn alleles was performed as previously described (17, 21). The 3′ portions of S. epidermidis 23S rRNA genes were amplified using the VdomainF primer in conjunction with 23S rRNA allele-specific downstream flanking reverse primers (Se_rrlA-FR) designed using the S. epidermidis RP62A genome sequence (GenBank accession no. NC_002976) (Table 1). Genes encoding ribosomal proteins L3 (rplC), L4 (rplD), and L22 (rplV) were amplified as a single amplicon (∼3.3 kb) from S. aureus (rplCF/rplVR) (17) and S. epidermidis (rplCF/Se_rplVR) (Table 1). Sequencing of PCR products (Retrogen, Inc., San Diego, CA) was performed with primers flanking the 23S rRNA domain V region (21) and individual ribosomal protein genes (Table 1).

TABLE 1.

Primers used to amplify and sequence 23S rRNA and ribosomal protein genes

Primer Sequence (5′ to 3′) Reference(s)
rrn1F GCGGTGTTTTGAGAGATTATTTA 21
rrn1R GCTTCATGATATACGCTTCCTTT 21
rrn2F GCAGACGCACAGGACTTA 21
rrn2R GATACCGTCTTACTGCTCTTCTC 21
rrn3F AGGCCGGCAATATGTAAG 21
rrn3R GTCGTCAAACGGCACTAATA 21
rrn4F TGTGGACGGTGCATCTGTAG 21
rrn4R ATCACCCGCTCCATAGATAAT 21
rrn5F GCCGATAGCTCTACCACTG 21
rrn5R AGGTGCGATGGCAAAACA 21
rrn6F GAAAGGCGTAACGATTTGGG 18, 23
rrn6R CGTTGACATATTGTCATTCAG 18, 23
Se_rrlAR CTTAACTAACTTCTTAATCATTG This study
Se_rrlBR GTTACCTTACCAACTAGCTAATG This study
Se_rrlCR TGGAATGCATTTTACAATAACTG This study
Se_rrlDR TGAGCTACTTCCCGTAAAATAAG This study
Se_rrlER GAAACATCATGATGATCTCATTC This study
Se_rrlFR CCATATTGATTATTATACCAATC This study
VdomainF GCGGTCGCCTCCTAAAAG 21
rplCF ATGGGCTTAAACTTACCATC 17
rplDF AAAAGGTTTAGTAGAAATCAG 17
rplVF GTACATTCAAAGGACACGTTG 17
rplVR AATCACGGATAATACCAACACG 17
Se_rplDF AAAAGGTTTAGTAGAAATCAC This study
Se_rplVF CGTACTTTTAAAGGACATGCA This study
Se_rplVR AATCACGGATAACACCGACAC This study

S. aureus NRS127 possessed a ΔT433-to-T435 mutation in rplC, resulting in a novel ΔSer145 deletion in L3 (Table 2). Contrary to a recent report of a G2447T mutation in an NRS127 isolate (LZD MIC, 1.5 μg/ml) (7), but consistent with previous sequence analysis (D. Shinabarger and G. Zurenko, unpublished data) of NRS127 (LZD MIC, 8 μg/ml) (27), we did not detect domain V mutations in any of the six 23S rRNA alleles. S. epidermidis 1653059 possessed G469A and C470G mutations in rplC, leading to an Ala157Arg substitution in L3 (Table 2). In addition, this strain possessed five copies of G2447T (we were unable to amplify allele no. 2, rrlB), a 23S rRNA gene mutation previously only associated with laboratory-derived LZDr strains (Table 2) (28). Similar coupling of G2447T and L3 mutations was observed in our previous in vitro LZD serial passage studies with S. aureus ATCC 29213 (G2447T and L3 Gly152Asp) (17).

TABLE 2.

Characteristics of clinical LZDr staphylococci with L3 mutations

Organisma Strain Source Ribosomal protein mutationb
MIC (μg/ml)c
rplC L3 TR-700 LZD TIA CHL VAN
S. aureus 29213 ATCC 0.5 2 1 8 1
NRS127 NARSA ΔT433 to T435 ΔSer145 1 8 4 8 2
S. epidermidis 12228 ATCC 0.25 1 0.5 1 2
1653059 Eurofins G469A/C470G Ala157Arg 16 256 8 2 2
a

S. aureus ATCC 29213 (methicillin susceptible) and S. epidermidis ATCC 12228 (MRSE) are provided as a reference for typical MICs found for LZDs strains, although they are not isogenic to NRS127 or 1653059.

b

Ribosomal protein L3 mutations (staphylococcal numbering) are reported for the gene (rplC) and protein (L3), respectively. S. epidermidis 1653059 additionally possessed five copies of the G2447T 23S rRNA mutation (E. coli numbering).

c

MIC determinations (broth microdilution) were performed for the indicated drugs. CHL, chloramphenicol; VAN, vancomycin.

MICs were determined via broth microdilution (CLSI) (4) for TR-700 (Trius Therapeutics, Inc., San Diego, CA), LZD (ChemPacific Corp., Baltimore, MD), TIA (Wako Pure Chemical Industries, Ltd., Richmond, VA), chloramphenicol (Sigma-Aldrich Corp., St. Louis, MO), and vancomycin (Sigma-Aldrich Corp., St. Louis, MO) as previously described (17). Cross-resistance was observed between TR-700 and LZD; however, TR-700 maintained 8- and 16-fold potency advantages over LZD for strains NRS127 and 1653059, respectively (Table 2). Although there are no isogenic, wild-type comparators for these strains, S. aureus ATCC 29213 and S. epidermidis ATCC 12228 generate LZD and TR-700 MICs representative of these species (Table 2), in line with previously published MIC90 determinations for methicillin-resistant S. aureus (4 versus 0.5 μg/ml, respectively) and MRSE (2 versus 0.5 μg/ml, respectively) isolates (26). In addition, both isolates had elevated MICs for TIA, consistent with previous associations of L3 mutations with resistance to pleuromutilins.

We investigated the potential mechanistic rationale behind Ala157Arg and ΔSer145 mutations contributing to oxazolidinone resistance through analysis of the Deinococcus radiodurans LZD-bound 50S crystal structure (Protein Data Bank accession code 3DLL) (Fig. 1) (31). Sequence alignments showed that the regions of the 50S subunit discussed in this study are highly conserved, so the structural rationales proposed on the basis of the D. radiodurans model would be expected to hold for S. aureus and other species. Both L3 mutations involve residues within a central extension of the protein that projects toward the PTC. Mutation of Ala157 (Asn149 in E. coli) has been implicated in resistance to pleuromutilins (22). Although the identity of this residue is not conserved, this residue is located adjacent to critical bases of the PTC (including G2505 and U2506) that are involved in LZD binding, and perturbations at this position would be expected to affect LZD susceptibility (5, 31). The coupled 23S rRNA mutation G2447U, which directly interacts with U2504 (5), could be synergistic with Ala157Arg due to its simultaneous perturbation this same set of key bases of the PTC. This is the first report of the ΔSer145 mutation; however, we have observed this mutation in a laboratory-derived LZDr S. aureus strain (16), and a mutation in the adjacent amino acid (Gly144Asp) has been associated with pleuromutilin resistance (13). Unlike Ala157, Ser145 does not directly interact with bases lining the PTC; thus, the mechanism of resistance is less clear (Fig. 1).

FIG. 1.

FIG. 1.

Structural analysis of ribosomal mutations in clinical LZDr strains. Mutations of ribosomal protein L3 (ΔSer145 and Ala157Arg) and 23S rRNA (G2447U) are shown in red. A PTC-bound LZD molecule is shown in salmon. 23S rRNA bases A2503 (site of methylation by Cfr), 2504 to 2506 (key residues lining the oxazolidinone binding site in the PTC), and ribosomal protein L4 are shown for reference. Images were generated with PyMOL (6), using the coordinates of the D. radiodurans LZD-bound 50S subunit (31). In the D. radiodurans L3 protein, residue 157 (staphylococcal numbering) is an arginine that interacts with the sugar-phosphate backbone between G2505 and U2506. Although the identity of this residue varies across species, it maintains a similar orientation with respect to G2505/U2506 in the disparate orthologs for which crystal structures exist (D. radiodurans, Haloarcula marismortui, and E. coli).

Earlier work documenting LZD resistance in clinical isolates has focused on mutations in 23S rRNA domain V, largely G2576T. This study and a growing number of other reports (7, 17, 32) show that oxazolidinone resistance mechanisms are not limited to 23S rRNA mutations. L3 mutations, in addition to some recently described oxazolidinone resistance determinants, including inactivation of an endogenous ribosomal methyltransferase and enhanced drug efflux (7), may help to explain some of the numerous reports of LZDr strains with unknown resistance mechanisms (3, 9, 10, 15, 25).

Expanding knowledge of oxazolidinone resistance mechanisms and increasing incidences of clinical LZDr isolates underscore the need for novel oxazolidinones with activity against resistant strains. This study highlights the clinical relevance of L3 mutations and demonstrates the enhanced potency of TR-700 against an additional class of mutation-associated LZD resistance in staphylococci.

Acknowledgments

We thank Eurofins Medinet, Inc., for the S. epidermidis 1653059 strain.

NRS127 was obtained through the Network of Antimicrobial Resistance in Staphylococcus aureus (NARSA) program supported under NIAID/NIH contract no. HHSN272200700055C.

Footnotes

▿

Published ahead of print on 5 October 2009.

REFERENCES

  • 1.Böck, A., F. Turnowsky, and G. Högenauer. 1982. Tiamulin resistance mutations in Escherichia coli. J. Bacteriol. 151:1253-1260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bøsling, J., S. M. Poulsen, B. Vester, and K. S. Long. 2003. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein L3. Antimicrob. Agents Chemother. 47:2892-2896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Carsenti-Dellamonica, H., M. Galimand, F. Vandenbos, C. Pradier, P. M. Roger, B. Dunais, M. Sabah, G. Mancini, and P. Dellamonica. 2005. In vitro selection of mutants of Streptococcus pneumoniae resistant to macrolides and linezolid: relationship with susceptibility to penicillin G or macrolides. J. Antimicrob. Chemother. 56:633-642. [DOI] [PubMed] [Google Scholar]
  • 4.CLSI. 2006. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard. CLSI document M7-A7, 7th ed., vol. 26, no. 2. CLSI, Wayne, PA.
  • 5.Davidovich, C., A. Bashan, and A. Yonath. 2008. Structural basis for cross-resistance to ribosomal PTC antibiotics. Proc. Natl. Acad. Sci. USA 105:20665-20670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.DeLano, W. L. 2002. The PyMOL molecular graphics system. DeLano Scientific, Palo Alto, CA.
  • 7.Feng, J., A. Lupien, H. Gingras, J. Wasserscheid, K. Dewar, D. Legare, and M. Ouellette. 2009. Genome sequencing of linezolid-resistant Streptococcus pneumoniae mutants reveals novel mechanisms of resistance. Genome Res. 19:1214-1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gentry, D. R., S. F. Rittenhouse, L. McCloskey, and D. J. Holmes. 2007. Stepwise exposure of Staphylococcus aureus to pleuromutilins is associated with stepwise acquisition of mutations in rplC and minimally affects susceptibility to retapamulin. Antimicrob. Agents Chemother. 51:2048-2052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hillemann, D., S. Rüsch-Gerdes, and E. Richter. 2008. In vitro-selected linezolid-resistant Mycobacterium tuberculosis mutants. Antimicrob. Agents Chemother. 52:800-801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Jones, R. N., T. R. Fritsche, H. S. Sader, and J. E. Ross. 2007. LEADER surveillance program results for 2006: an activity and spectrum analysis of linezolid using clinical isolates from the United States (50 medical centers). Diagn. Microbiol. Infect. Dis. 59:309-317. [DOI] [PubMed] [Google Scholar]
  • 11.Jones, R. N., G. J. Moet, H. S. Sader, R. E. Mendes, and M. Castanheira. 2009. TR-700 in vitro activity against and resistance mutation frequencies among Gram-positive pathogens. J. Antimicrob. Chemother. 63:716-720. [DOI] [PubMed] [Google Scholar]
  • 12.Kehrenberg, C., S. Schwarz, L. Jacobsen, L. H. Hansen, and B. Vester. 2005. A new mechanism for chloramphenicol, florfenicol and clindamycin resistance: methylation of 23S ribosomal RNA at A2503. Mol. Microbiol. 57:1064-1073. [DOI] [PubMed] [Google Scholar]
  • 13.Kosowska-Shick, K., C. Clark, K. Credito, P. McGhee, B. Dewasse, T. Bogdanovich, and P. C. Appelbaum. 2006. Single- and multistep resistance selection studies on the activity of retapamulin compared to other agents against Staphylococcus aureus and Streptococcus pyogenes. Antimicrob. Agents Chemother. 50:765-769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Livermore, D. M., S. Mushtaq, M. Warner, and N. Woodford. 2009. Activity of oxazolidinone TR-700 against linezolid-susceptible and -resistant staphylococci and enterococci. J. Antimicrob. Chemother. 63:713-715. [DOI] [PubMed] [Google Scholar]
  • 15.Lobritz, M., R. Hutton-Thomas, S. Marshall, and L. B. Rice. 2003. Recombination proficiency influences frequency and locus of mutational resistance to linezolid in Enterococcus faecalis. Antimicrob. Agents Chemother. 47:3318-3320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Locke, J. B., M. Hilgers, and K. J. Shaw. 2009. Abstr. 49th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C1-1349.
  • 17.Locke, J. B., M. Hilgers, and K. J. Shaw. 2009. Novel ribosomal mutations in Staphylococcus aureus strains identified through selection with the oxazolidinones linezolid and torezolid (TR-700). Antimicrob. Agents Chemother. [DOI] [PMC free article] [PubMed]
  • 18.Meka, V. G., S. K. Pillai, G. Sakoulas, C. Wennersten, L. Venkataraman, P. C. DeGirolami, G. M. Eliopoulos, R. C. Moellering, and H. S. Gold. 2004. Linezolid resistance in sequential Staphylococcus aureus isolates associated with a T2500A mutation in the 23s rRNA gene and loss of a single copy of rRNA. J. Infect. Dis. 190:311-317. [DOI] [PubMed] [Google Scholar]
  • 19.Mendes, R. E., L. M. Deshpande, M. Castanheira, J. E. Ross, and R. N. Jones. 2009. Abstr. 49th Intersci. Conf. Antimicrobial Agents Chemother., abstr. C2-135.
  • 20.Miller, K., C. J. Dunsmore, C. W. Fishwick, and I. Chopra. 2008. Linezolid and tiamulin cross-resistance in Staphylococcus aureus mediated by point mutations in the peptidyl transferase center. Antimicrob. Agents Chemother. 52:1737-1742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Pillai, S. K., G. Sakoulas, C. Wennersten, G. M. Eliopoulos, R. C. Moellering, Jr., M. J. Ferraro, and H. S. Gold. 2002. Linezolid resistance in Staphylococcus aureus: characterization and stability of resistant phenotype. J. Infect. Dis. 186:1603-1607. [DOI] [PubMed] [Google Scholar]
  • 22.Pringle, M., J. Poehlsgaard, B. Vester, and K. S. Long. 2004. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates. Mol. Microbiol. 54:1295-1306. [DOI] [PubMed] [Google Scholar]
  • 23.Prunier, A. L., B. Malbruny, D. Tande, B. Picard, and R. Leclercq. 2002. Clinical isolates of Staphylococcus aureus with ribosomal mutations conferring resistance to macrolides. Antimicrob. Agents Chemother. 46:3054-3056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Prystowsky, J., F. Siddiqui, J. Chosay, D. L. Shinabarger, J. Millichap, L. R. Peterson, and G. A. Noskin. 2001. Resistance to linezolid: characterization of mutations in rRNA and comparison of their occurrences in vancomycin-resistant enterococci. Antimicrob. Agents Chemother. 45:2154-2156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sander, P., L. Belova, Y. G. Kidan, P. Pfister, A. S. Mankin, and E. C. Bottger. 2002. Ribosomal and non-ribosomal resistance to oxazolidinones: species-specific idiosyncrasy of ribosomal alterations. Mol. Microbiol. 46:1295-1304. [DOI] [PubMed] [Google Scholar]
  • 26.Schaadt, R., D. Sweeney, D. Shinabarger, and G. Zurenko. 2009. In vitro activity of TR-700, the active ingredient of the antibacterial prodrug TR-701, a novel oxazolidinone antibacterial agent. Antimicrob. Agents Chemother. 53:3236-3239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shaw, K. J., S. Poppe, R. Schaadt, V. Brown-Driver, J. Finn, C. M. Pillar, D. Shinabarger, and G. Zurenko. 2008. In vitro activity of TR-700, the antibacterial moiety of the prodrug TR-701, against linezolid-resistant strains. Antimicrob. Agents Chemother. 52:4442-4447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Swaney, S. M., D. L. Shinabarger, R. D. Schaadt, J. H. Bock, J. L. Slightom, and G. E. Zurenko. 1998. Abstr. 38th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C-104.
  • 29.Toh, S. M., L. Xiong, C. A. Arias, M. V. Villegas, K. Lolans, J. Quinn, and A. S. Mankin. 2007. Acquisition of a natural resistance gene renders a clinical strain of methicillin-resistant Staphylococcus aureus resistant to the synthetic antibiotic linezolid. Mol. Microbiol. 64:1506-1514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tsiodras, S., H. S. Gold, G. Sakoulas, G. M. Eliopoulos, C. Wennersten, L. Venkataraman, R. C. Moellering, and M. J. Ferraro. 2001. Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet 358:207-208. [DOI] [PubMed] [Google Scholar]
  • 31.Wilson, D. N., F. Schluenzen, J. M. Harms, A. L. Starosta, S. R. Connell, and P. Fucini. 2008. The oxazolidinone antibiotics perturb the ribosomal peptidyl-transferase center and effect tRNA positioning. Proc. Natl. Acad. Sci. USA 105:13339-13344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wolter, N., A. M. Smith, D. J. Farrell, W. Schaffner, M. Moore, C. G. Whitney, J. H. Jorgensen, and K. P. Klugman. 2005. Novel mechanism of resistance to oxazolidinones, macrolides, and chloramphenicol in ribosomal protein L4 of the pneumococcus. Antimicrob. Agents Chemother. 49:3554-3557. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES