Abstract
Iron accumulation is associated with age-related neurodegenerations and may contribute to age-related increased susceptibility of neurons to damage. We compared young and old rodent retinas to assess iron homeostasis during normal aging and the effects of increased iron on the susceptibility of retinal neurons to degeneration. Retinal iron was significantly increased with age. Quantitative RT-PCR showed that transferrin and ferritin genes were upregulated in the aged retina. At the protein level, we found decreased transferrin, and increased transferrin receptor, ferritin, ferroportin, and ceruloplasmin in the aged retina. These results support an increased steady state of iron with age in the retina. We tested susceptibility of retinal neurons with increased intracellular iron to damage in vitro. Exposure of RGC-5 cells to increased iron potentiated the neurotoxicity induced by paraquat, glutamate and TNF α. Our results demonstrate that iron homeostasis in the retina is altered with age and suggest that iron accumulation, due to altered levels of iron regulatory proteins in the aged retina, could be a susceptibility factor in age-related retinal diseases.
Keywords: iron, aging, susceptibility, neurodegeneration, RGC-5, stress
1. Introduction
Iron is an essential element for many metabolic processes, serving as a cofactor for heme and nonheme proteins (Rouault and Tong, 2005). Cellular iron deficiency arrests cell growth and leads to cell death; but, like most transition metals, an excess of intracellular iron is toxic. Intracellular ferric iron (Fe3+) is bound to proteins. Excess ferrous iron (Fe2+) in the cytoplasm participates in the Fenton reaction and generates highly reactive hydroxyl radicals which damage lipid membranes, proteins and nucleic acids (Crichton, 2001). Thus, cellular iron balance is critical for meeting physiologic demands while avoiding the toxicity associated with iron overload.
To maintain iron homeostasis locally in tissues, there are a series of iron regulatory proteins that tightly control cellular iron uptake, storage, export and intracelluar iron distribution. Dysregulation of these iron regulatory proteins can lead to intracellular iron overload. With age, iron accumulates in many regions of the brain (Bartzokis et al., 1997;Zecca et al., 2001). Furthermore, local mismanagement of iron homeostasis is associated with age-related neurodegenerations, such as Parkinson’s disease (PD) (Jellinger et al., 1993;Sofic et al., 1991) and Alzheimer’s disease (AD) (Bishop et al., 2002).
In the human retina, iron levels increase normally with age (Hahn et al., 2006;Sergeant et al., 2004). Recently, changes of iron homeostasis have been associated with photoreceptor degeneration, such as in RCS (Royal College of Surgeons) rats (Yefimova et al., 2002) and with age-related retinal diseases, such as age-related macular degeneration (AMD) (Dunaief, 2006;He et al., 2007) and glaucoma. Iron deposits are found in the macula of AMD patients (Dentchev et al., 2005) and increases in the protein levels of iron regulatory proteins transferrin (Tf), ferritin (Ft), and ferroportin (Fpn) are reported in the macula of AMD patients (Chowers et al., 2006;Dentchev et al., 2005). In an animal model, mice deficient in both ceruloplasmin (Cp) and its homolog hephaestin show age-dependent retinal iron accumulation and retinal degeneration with features of AMD (Hahn et al., 2004b). In patients with glaucoma, increased Tf, Ft, and Cp are found in the central and peripheral retina (Farkas et al., 2004;Stasi et al., 2007),
The retina has a very high metabolic rate and oxygen consumption. Moreover, the retina is exposed to an intense level of light, which induces oxidative stress (Rozanowska et al., 1995). We, like other investigators (Chowers et al., 2006;Farkas et al., 2004), hypothesize that the changes in iron homeostasis in the aged retina may potentiate damage to retinal neurons. Thus, an animal model will be useful to gain an overview of the changes in iron homeostasis with age and to test how increased iron may contribute to age-related retinal diseases. We have studied young and old mice and rats to characterize changes in the state of iron homeostasis in the aging retina. In addition, we present evidence that increased iron in retinal neurons leads to markedly increased susceptibility to degeneration when exposed to oxidative stress, glutamate excitotoxicity or cytokines.
2. Materials and Methods
2.1. Animals
All experimental protocols were in compliance with the National Institutes of Health guidelines and were approved by the Center for Comparative Medicine Committee at Northwestern University. C57BL/6 male mice, 4–5 (young) and 26 (old) months of age and Brown Norway male rats, 4 (young) and 30 (old) months of age (National Institute on Aging, Bethesda, MD) were used in this study. The animals were housed under standard conditions and were maintained in temperature-controlled rooms on a normal 12-hour light/12-hour dark cycle. The animals were anesthetized by intraperitoneal injection of xylazine (13 mg/kg) and ketamine (87 mg/kg) and eyes and blood were collected.
2.2. Quantitative retinal iron and manganese detection
Iron levels in the retinas from 3 young and 3 old rats were detected by inductively coupled plasma-optical emission spectrophotometry (Vista-MPX CCD simultaneous ICP-OES, Varian Inc, Palo Alto, CA) using methods as previously described (Niazi et al., 1993). Briefly, samples of the retina were placed in separate Eppendorf tubes and dried overnight at room temperature. Samples were weighed and then 143 μl ultra-pure nitric acid was added into the tubes. Samples were digested for 20 minutes at 105°C and then centrifuged at 1000rpm for 10 minutes. The supernatant solution was diluted with deionized water to obtain a final concentration of 2% nitric acid for direct analysis by ICP-OES. Manganese levels in each sample were measured at the same time as an internal control. Standards were prepared from atomic absorption standard solutions of Fe and Mn (1g/l) (Thermo Fisher Scientific, Waltham, MA). Standards, blanks and standard curves were used as previously specified (Niazi et al., 1993).
2.3. Serum iron
Blood was obtained intracardially from the above rats under general anesthesia. After centrifuging at 1000rpm for 10 minutes, the serum was collected and stored at −80°C. Serum iron level was detected by QuantiChrom Iron Assay Kit (Bioassay Systems, Hayward, CA) as another internal control for retinal iron level.
2.4. Culture of RGC-5 cells
The rat retinal ganglion cell line, RGC-5, that was transformed with adenovirus, carrying E1A (Krishnamoorthy et al., 2001) was cultured in DMEM (Mediatech, Herndon, VA) containing 1 g/l glucose, 4mM L-glutamine and 1mM sodium pyruvate supplemented with 10% fetal bovine serum, 100U penicillin, 100μg streptomycin, and 0.25μg amphotericin B at 5% CO2 and 37°C. RGC-5 cells were treated with γ-irradiation to arrest proliferation for the experiments. Briefly, cells were trypsinized and transferred to tubes with a total volume of 50 ml media in each tube. Cells were γ-irradiated with 5000 rads in a 137Cesium irradiator (Gammacell 40, Atomic Energy of Canada, LTD.) (Langenbach et al., 1979). Subsequently, the cells were washed twice with media, transferred to cryovials, and stored at −140°C for further use.
2.5. Treatment of RGC-5 cells
γ-irradiated cells were plated in 96-well plates at a density of 10,000 cells/well. After one day in culture, the cells were treated either with iron complex or with iron complex together with paraquat, glutamate or tumor necrosis factor alpha (TNF α). The iron complex was added into the low-iron culture media as the complex FeCl3-sodium nitrilotriacetate (Fe-NTA) at final concentrations of 25–500 μM (Nunez et al., 2004) to test the effects of iron complex on cell viability. To detect the effects of iron on cell susceptibility to different stresses, we added Fe-NTA at the non-toxic dose of 50 μM, 100 μM, and 200 μM (see Figure 7A), combined with each chemical at the following concentrations: paraquat: 50–800 μM; glutamate: 1–20mM; TNF α: 10–500ng/ml. Fe-NTA and each chemical were added to the medium at the same time. After the cells were treated for 16 hours, the cell viability was quantitated by MTT assay (Promega, Madison, WI) following the manufacturer’s instructions. All assays were done in triplicates, and all experiments were repeated three times.
Figure 7.
Elevated iron increases the susceptibility of retinal neurons to stress in vitro. Cell viability was measured via the MTT assay and expressed as a percentage of viability compared to control. A. The effect of Fe-NTA on the viability of RGC-5 cells. Fe-NTA less than or equal to 400 μM in the media does not cause a significant decrease of cell viability (p>0.05). 500 μM Fe-NTA in the media has a small cytotoxic effect on the RGC-5 cells (*p<0.05). The concentrations of 50 μM, 100 μM and 200 μM Fe-NTA in the media were chosen for further experiments (arrows). B–D. Cell survival curves for RGC-5 cells exposure to paraquat, glutamate and TNF α. B. Paraquat alone has a neurotoxic effect on RGC-5 cells following a dose-response relationship. Fe-NTA in the media causes the cell survival curve to shift markedly to the left in a dose-response manner. C. Glutamate was neurotoxic to RGC-5 cells when its concentration was higher than 5mM. Fe-NTA in the media causes the cell survival curve to shift markedly to the left in a dose-response manner. D. TNF α alone has a small neurotoxic effect on the viability of RGC-5 cells. Fe-NTA in the media potentiates the neurotoxic effect of TNF α in a dose-response manner. Pa, paraquat; G, glutamate; TNF α, tumor necrosis factor alpha; Fe50, 50 μM Fe-NTA in the media; Fe100, 100 μM Fe-NTA in the media; Fe200, 200 μM Fe-NTA in the media.
2.6. Real-time RT-PCR
Total RNA was extracted from each mouse retina using RNeasy Protect Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The concentration of RNA isolated was quantitated spectrophotometrically. Two hundred nanograms of total RNA from each sample was reverse transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad laboratories Inc., Hercules, CA.) according to the manufacturer’s instructions and used as a template for real-time PCR reactions. Specific primers (Table 1) were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA). The real-time PCR reactions were performed using iCycler (Bio-Rad Laboratories Inc.). All samples were tested in triplicate PCR reactions and the mean of the reactions was used for calculating the expression levels. All the data were collected from the linear range of the amplification. Expression levels were normalized to the average of 18S mRNA levels from the same samples.
Table 1.
Gene-specific primers used in the study
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Tf | Gggatgacaccaaatgtttc | agcacttcctcatgttaccg |
| TrfR | Ttcctgtcgccctatgtatc | cgaagcttcaagttctccac |
| L-Ft | Cagccgcctttacaagtctc | taggagctaaccgcgaagag |
| H-Ft | Tgatgaagctgcagaaccag | gcacactccattgcattcag |
| Fpn | Ctctgtcagcctgctgtttg | ggagttctgcacaccattga |
| Cp | Ggccacagcttccaatacaa | gcatggacatggtcagtcac |
| Hp* | Ctgcacagcagaacagaagg | ggagataggtggtgctgctc |
| 18S | Gtaacccgttgaaccccatt | ccatccaatcggtagtagcg |
TrfR, transferrin receptor; L-Ft, ferritin light chain; H-Ft, ferritin heavy chain; Hp, hepcidin;
hepcidin primers amplify both hepcidin-1 and hepcidin-2 genes.
2.7. Immunohistochemistry
Mice eyes were enucleated and the anterior segments were removed. The posterior segments were fixed by immersion in 4% paraformaldehyde in 0.1 M phosphate buffer saline (PBS, pH 7.4) for 2–4 hours. After washing in PBS, the tissues were transferred to 70% ethanol overnight, then dehydrated and embedded in paraffin. The 5-μm-thick paraffin tissue sections were dewaxed and then rehydrated. Endogenous peroxidase activity was blocked by placing the sections in 3% H2O2 in methanol for 30 minutes. For antigen retrieval, the sections were heated in 10mM sodium citrate buffer (pH 6.0) at a sub-boiling temperature for 10 minutes followed by cooling 30 minutes. Then the tissue sections were incubated with specific primary antibodies diluted in 5% bovine serum albumin (BSA) in PBS for overnight at 4°C. The following primary antibodies were used: rabbit polyclonal anti-transferrin (M-70) (1:200; Santa Cruz Biotechnology Inc, Santa Cruz, CA), mouse monoclonal anti-transferrin receptor (1:200; Zymed Laboratories, San Francisco, CA), rabbit polyclonal anti-ferritin (1:800; Sigma, St Louis, MO), rabbit polyclonal anti-ferroportin (1:400; Orbigen, San Diego, CA), mouse monoclonal anti-ceruloplasmin (1:200, BD Biosciences, San Jose, CA) and rabbit polyclonal anti-hepcidin (1:50; Alpha Diagnostic, TX). The sections incubated with PBS without primary antibody were used as negative controls. After several wash steps, the tissue sections were incubated with the secondary antibody, biotinylated goat anti-rabbit IgG or horse anti-mouse IgG (1:200; Vector Laboratory, Burlingame, CA) for 1 hour at room temperature. The tissue sections were then incubated with ABC solution (Vector Laboratory) in PBS for 30 minutes at room temperature. Diaminobenzidine (DAB) (Sigma) was applied to the sections for 1–3 minutes. The sections were counterstained with hematoxylin, dehydrated, cleared in xylene, and coverslipped. The staining was repeated three or more times for each antibody and each age and the results were consistent.
2.8. Western blot analysis
The mice neural retinas were dissected from the RPE and choroids and lysed in the extraction buffer containing 50 mM Tris-HCl (pH8.0), 150 mM NaCl, 1 mM EDTA plus protease inhibitors and phosphatase inhibitors (Pierce, Germany). Lysates from the retinas were stored at −70°C until use. The lysate proteins were sonicated for 5 seconds before protein concentration determination by the Bradford colorimetric assay. Proteins were size-separated through denaturing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). An equal amount of protein (15 μg) was loaded onto 4–12% gels and then electrotransferred on polyvinylidene fluoride (PVDF) membranes (Amersham Biosciences, Piscataway, NJ). The membrane was blocked for 1 hour at room temperature in a blocking solution containing 5% nonfat milk and 0.05% Tween 20 in Tris-buffered saline (TBS) (25 mM Tris-HCl and 150 mM NaCl). The membrane was then incubated with primary antibodies in blocking solution at 4°C overnight. The following primary antibodies were used: rabbit anti-transferrin (M-70) (1:800; Santa Cruz), mouse anti-transferrin receptor (1:10,000; Zymed), rabbit anti-ferritin (1:2000; Sigma), rabbit anti-ferroportin (1:500; Orbigen), mouse anti-ceruloplasmin (1:500, BD Biosciences) and mouse anti-β-actin (1:20,000; Sigma). The membrane was rinsed with 0.05% Tween 20 in TBS and incubated with peroxidase-conjugated donkey anti-rabbit IgG (1:15,000; Santa Cruz) or goat anti-mouse IgG (1:10,000, Santa Cruz) for 1 hour at room temperature. Finally, the blots on membrane were developed by enhanced chemiluminescence (ECL) (Amersham) on Hyperfilm (Amersham), according to the manufacturer’s protocol. The blots were exposed to the films for different time to optimize the exposure time and ensure that the signal was within the linear range of the ECL. Films were scanned and relative band density was determined using ImageJ (National Institutes of Health, Bethesda, MD). β-actin was used as loading and quality control.
2.9. Statistical analyses
The density and expression level data are presented as mean ± standard error of the mean (SEM) with statistical differences between groups analyzed by a standard two-tailed t-test using GraphPad Prism. For the MTT data, one-way ANOVA was used to test differences in mean values, and Tukey’s post test was used for comparisons using GraphPad Prism. A p value of less than 0.05 was considered statistically significant.
3. Results
3.1. Increased iron levels in aged retinas
We used ICP-OES to quantify and to compare the iron levels in the retinas of young and old rats. The results showed that the iron levels were significantly increased in aged retinas, in the young retina: 27.4±1.6 μg/g (dry weight) and in the aged retina: 36.9±1.7 μg/g (Fig. 1A). Our results were consistent with similar analyses in the human retina and rat retina (Hahn et al., 2006;Yefimova et al., 2000). We also measured the manganese levels in the retina as an internal control. The manganese levels in the young and aged retina were 2.8±0.03 μg/g and 2.8±0.06 μg/g, respectively and were not significantly different (Fig. 1B). To determine the systemic iron level, we measured the serum iron, which also showed no significant difference between young and old rats, 181.6 ± 25.3 μg/dl and 164.4 ± 51.7 μg/dl, respectively (Fig. 1C). Thus, there is a modest, but significant, increase in the tissue levels of iron in the retinas of old animals.
Figure 1.

Changes of iron level in the retinas of young and old rats measured by ICP-OES analysis. A. The iron levels were significantly increased in the retinas of old rats. (*p<0.05; n=3). B. Manganese levels in the retinas of young and old rats were not significantly different (p>0.05; n=3). C. Serum iron of the young and old animals were not significantly different (p>0.05; n=3). Y, young; O, old.
3.2. Changes in iron regulatory molecules in the aged retina
We copmpared the cellular localization, protein levels and gene expressions of six iron regulatory molecules including Tf, transferrin receptor (TrfR), Ft, Fpn, Cp, and hepcidin in the retinas of young and old mice by immunohistochemical labeling, Western blot and real time RT-PCR.
Transferrin (Tf) is the major serum iron transport protein (Hentze et al., 2004) but Tf is also synthesized in the retina (Farkas et al., 2004). Immunohistochemical labeling showed Tf protein was present in several neuronal types in the retina. Tf localized in the nerve fiber layer (NFL), ganglion cell layer (GCL), inner nuclear layer (INL), outer plexiform layer (OPL), and inner segments (IS) of photoreceptors in the retinas of both young (Fig. 2A) and old animals (Fig. 2B). No localization of Tf was apparent in the M ller cell end feet, as reported in human and monkey retina (Chowers et al., 2006;Farkas et al., 2004). By immunohistochemical labeling, Tf protein appeared decreased in the aged retinas, especially in the NFL, GCL and IS of photoreceptors (insets, Fig. 2A–B). Western blot confirmed that Tf protein was significantly decreased in the aged retinas compared to young retinas (Fig. 2C). Real-time RT-PCR showed that the retina expressed mRNA for Tf and that Tf mRNA expression was significantly increased in the aged retinas (Fig. 2D). Although mRNA expression for Tf is increased with age, the amount of protein synthesized was decreased, suggesting post-transcriptional regulation of the levels of Tf protein in the aged retina.
Figure 2.

Cellular localization, protein level and gene expression of transferrin (Tf) in the retinas of young and old mice. A–B. Cellular localization of Tf in the retina of young (A) and old mice (B). The insets show higher magnification of the inner segments (IS) of photoreceptors. Tf localizes in the NFL (white arrows), GCL (arrows), INL, OPL (white arrowheads), and IS of photoreceptors (arrowheads) in the retinas. Tf protein appears decreased in the aged retinas. Note that there is decreased intensity in the NFL, GCL and IS of photoreceptors (insets) in the aged retinas. C. Western blot shows Tf protein decreases significantly in the aged retinas compared to young retinas. Densitometric measurements confirm a significant decrease in Tf in aged retinas (*p < 0.05, n=3). D. Graph showing the relative expression of Tf mRNA increases in the retina of aged animals (*p < 0.05, n=6). Scale bar: 20 μm; NFL, nerve fiber layer; GCL, ganglion cell layer; INL, inner nuclear layer; OPL, outer plexiform layer; IS, inner segments.
Transferrin Receptor (TrfR) is the cell surface receptor for Tf and the binding of Tf to TrfR enables the cells to take up iron via endocytosis (Hentze et al., 2004). Immunohistochemical labeling showed TrfR protein was present in the GCL, INL, OPL, and IS of photoreceptors in the retinas of both young (Fig. 3A) and aged animals (Fig. 3B). The distribution of TrfR protein was consistent with a previous report studying young rat retina (Yefimova et al., 2000). By immunohistochemical labeling, TrfR protein appeared increased in the aged retinas, including the GCL and IS of photoreceptors (insets, Fig. 3A–B). Western blot confirmed that TrfR protein was significantly increased in the aged retinas compared to young retinas (Fig. 3C). Real-time RT-PCR showed that the retina expressed mRNA for TrfR, but the TrfR mRNA expression in the retina did not show significant difference between young and old animals (Fig. 3D).
Figure 3.

Cellular localization, protein level and gene expression of transferrin receptor (TrfR) in the retina of young and old mice. A–B. Cellular localization of TrfR in the retinas of young (A) and old mice (B). The insets show higher magnification of the inner segment of photoreceptors. TrfR localizes in GCL (arrows), INL, OPL (white arrowheads), and IS of photoreceptors (arrowheads) in the retinas. TrfR protein appears increased in the aged retinas. Note that there is increased intensity in the GCL and IS of photoreceptors (insets). C. Western blot shows TrfR protein increases significantly in the aged retinas compared to young retinas. Densitometric measurements confirm a significant increase in TrfR in aged retinas (*p < 0.05, n=4). D. Graph showing no significant difference of relative expression of TrfR mRNA between the young and aged retinas (p > 0.05, n=6). Scale bar: 20 μm.
Ferritin (Ft), comprised of 24 subunits of both ferritin light chain (L-Ft) and ferritin heavy chain (H-Ft), is the main iron storage protein in all cells (Hentze et al., 2004). The antibody used in this study recognizes both L-Ft and H-Ft. Immunohistochemical labeling showed Ft protein localized in the GCL, INL, OPL, and IS of photoreceptors in the retinas of both young (Fig. 4A) and aged animals (Fig. 4B), consistent with previous studies on young mice and rats (Hahn et al., 2004b;Hahn et al., 2004a;Yefimova et al., 2000). The presence of Ft in the INL and OPL was consistent with a previous finding of Ft localization in rod bipolar cells in young mice retina (Hahn, 2004a). By immunohistochemical labeling, Ft protein appeared increased in the aged retinas, especially in the GCL and IS of photoreceptors (insets, Fig. 4A–B). Western blot confirmed that Ft protein was significantly increased in the aged retinas (Fig. 4C). Real-time RT-PCR showed that L-Ft mRNA expression was significantly increased in the aged retinas, but H-Ft mRNA expression did not show a significant difference between young and old animals (Fig. 4D).
Figure 4.

Cellular localization, protein level and gene expression of ferritin (Ft) in the retinas of young and old mice. A–B. Cellular localization of Ft in the retina of young (A) and old mice (B). The insets show higher magnification of the inner segment of photoreceptors. Ft localizes in GCL (arrows), INL, OPL (white arrowheads), and IS of photoreceptors (arrowheads) in the retinas. Ft protein appears increased in the aged retinas. Note that there is increased intensity in the GCL and IS of photoreceptors (insets). C. Western blot shows Ft protein increases significantly in the aged retinas compared to young retinas. Densitometric measurements confirm a significant increase in Ft in aged retinas (*p < 0.05, n=3). D. Graph showing the relative expression of L-Ft mRNA increases in the aged retinas (*p < 0.05, n=6), but there was no significantly different expression of H-Ft mRNA between young and aged retinas (p > 0.05, n=6). Scale bar: 20 μm.
Ferroportin (Fpn) is the only putative iron exporter identified to date (Donovan et al., 2000). Immunohistochemical labeling showed Fpn protein was present in the NFL, GCL and INL in the retinas of both young (Fig. 5A) and aged animals (Fig. 5B). We did not find the presence of Fpn in the M ller cell end feet, as demonstrated in the young mice by Hahn et al (Hahn et al., 2004a). By immunohistochemical labeling, Fpn protein appeared increased in the aged retinas, especially in the GCL. Western blot confirmed that Fpn protein was significantly increased in the aged retinas compared to young retinas (Fig. 5C). Real-time RT-PCR showed that the retina expressed mRNA for Fpn, but the Fpn mRNA expression in the retina did not show a significant difference between young and old animals (Fig. 5D).
Figure 5.

Cellular localization, gene expression and protein level of ferroportin (Fpn) in the retinas of young and old mice. A–B. Cellular localization of Fpn in the retinas of young (A) and old mice (B). Fpn localizes in the NFL (white arrows), GCL (arrows) and INL in the retinas. Fpn protein appears increased in the aged retinas. Note that there is increased intensity in the NFL and GCL. C. Western blot shows Fpn protein increased significantly in the aged retinas compared to young retinas. Densitometric measurements confirm a significant increase in Fpn in aged retinas (*p < 0.05, n=3). D. Graph showing no significant difference of relative expression of Fpn mRNA between the young and aged retinas (p > 0.05, n=6). Scale bar: 20 μm.
Ceruloplasmin (Cp) functions as a ferroxidase to convert ferrous iron (Fe2+) into ferric iron (Fe3+) and participates in the release of iron from cells (Williams et al., 1974). Ferric iron is the only form that can be carried by Tf in the serum. Immunohistochemical labeling showed Cp protein was localized in the NFL, INL, outer nuclear layer (ONL) and also in the endothelial cells of the capillaries in the retinas of both young (Fig. 6A) and aged animals (Fig. 6B). Western blot showed that Cp protein was significantly increased in the aged retinas (Fig. 6C). Real-time RT-PCR showed that the retina expressed mRNA for Cp, but the Cp mRNA expression in the retina did not show a significant difference between young and old animals (Fig. 6D).
Figure 6.

Cellular localization, gene expression and protein level of ceruloplasmin (Cp) in the retinas of young and old mice. A–B. Cellular localization of Cp in the retina of young (A) and old mice (B). Cp localizes in NFL (white arrows), INL, ONL and capillary endothelial cells (arrows) in the retinas. The inset shows no staining in the negative control (arrowheads). C. Western blot shows Cp protein increased significantly in the aged retinas compared to young retinas. Densitometric measurements confirm a significant increase in Cp in aged retinas (*p < 0.05, n=3). D. Graph showing no significant difference of relative expression of Cp mRNA between the young and aged retinas (p > 0.05, n=6). Scale bar: 20 μm; ONL, outer nuclear layer.
Hepcidin is a regulatory effector that modulates intestinal iron absorption, iron release from tissue macrophages and hepatocytes (Rossi, 2005). Immunohistochemical labeling showed hepcidin protein was only present in the GCL of the retina and there was not much difference between young and old animals (data not shown). Real-time RT-PCR showed that hepcidin mRNA expression was low in the retina and showed no significant difference between young and aged retinas (data not shown).
3.3. Elevated intracellular iron increased the susceptibility of retinal neurons to stress in vitro
Our above results showed that there was increased iron, probably due to age-related changes in the levels of iron regulatory molecules, in retinas from aged animals compared to retinas from young animals. This age-related, altered regulation of iron homeostasis leading to increased intracellular iron may be a susceptibility factor that potentiates the degeneration of retinal neurons following different stresses. We therefore determined if increased intracellular iron would make certain retinal neurons more susceptible to oxidative stress, glutamate excitotoxicity or TNF α. Using a model rat retinal ganglion cell line, RGC-5 cells, we quantitated cell viability under these various conditions.
First, we determined in vitro sub-lethal concentrations of Fe-NTA that would not cause death of non-proliferating (γ-irradiated) RGC-5 cells. NTA is an iron carrier and Fe-NTA enters cells rapidly and independently of TrfR-mediated iron uptake. Increased Fe-NTA concentrations in the culture media increases the intracellular iron level (Aguirre et al., 2005). We found that increased Fe-NTA levels up to 400 μM in the media did not cause a significant decrease of cell viability (p>0.05) (Fig. 7A). Only 500 μM Fe-NTA in the media had a small cytotoxic effect on the RGC-5 cells (p<0.05). Therefore, we chose the concentrations of 50 μM, 100 μM, and 200 μM Fe-NTA in the media (arrows in Fig. 7A) for our further experiments to test for increased iron as a susceptibility factor for neuronal degeneration.
Paraquat is an agricultural chemical postulated to be a primary risk factor for PD (Liou et al., 1997). The mechanism of neurotoxicity associated with exposure to paraquat is most likely mediated via oxidative stress (Bus and Gibson, 1984). Fig. 7B is a cell survival curve for in vitro exposure to paraquat. The results showed that paraquat induced neurotoxicity occurred in a dose-response manner; increasing the paraquat concentration caused more cell death. However, when RGC-5 cells were cultured in media containing increasing concentrations of Fe-NTA, the cell survival curve in response to paraquat shifted markedly to the left in a dose-response manner. The same concentration of paraquat caused much more RGC-5 cell death when non-toxic concentrations of Fe-NTA were present in the media. Thus, when the media contained concentrations of 50 μM, 100 μM and 200 μM Fe-NTA, the effect of 200 μM paraquat, which alone caused 10% cell death, was markedly potentiated, killing approximately 40%, 53% and 72% of the cells, respectively.
Glutamate, an excitatory neurotransmitter in the vertebrate retina, has long been known to have neurotoxic effects on retinal ganglion cells (Calzada et al., 2002). In our study, glutamate was neurotoxic to RGC-5 cells when its concentration was higher than 5mM (Fig. 7C). Similar to the response to paraquat, increased Fe-NTA shifted the cell survival curve to the left in a dose-response manner, demonstrating that the same concentration of glutamate caused much more RGC-5 cell death when non-toxic concentrations of Fe-NTA were present in the media. With Fe-NTA in the media, concentrations as low as 1mM of glutamate affected the viability of RGC-5 cells. 5mM glutamate alone only killed 2.5% cells; however, combined with 50 μM, 100 μM, and 200 μM Fe-NTA in the media, the toxic effect of glutamate was potentiated and the same dose of glutamate killed approximately 42%, 63%, and 79% cells, respectively (Fig. 7C).
Previous studies have shown that the cytokine, TNF α can induce retinal ganglion cell apoptosis (Tezel and Wax, 2000;Yuan and Neufeld, 2000). In vitro, RGC-5 cells were relatively resistant to TNFα. Even a very high dose of 500ng/ml TNF α killed only 20% of the cells. Although the effect of TNF α was relatively small, Fe-NTA in the media still potentiated the killing effect of TNF α on the cells. With the presence of 50 μM, 100 μM, and 200 μM Fe-NTA in the media, 500ng/ml TNF α killed approximately 31%, 37%, and 49% of the cells, respectively (Fig. 7D).
4. Discussion
Accumulation of redox-active iron in the CNS is associated with several neurodegenerative diseases, for which age is a major risk factor. Therefore, the changes of iron homeostasis with age may contribute to the underlying molecular basis of increased risk associated with age. We determined the changes of iron levels and expression of iron regulatory molecules with normal aging and assessed the effects of iron on the susceptibility of retinal neurons to several stresses in vitro. Our results suggest that there are age-related changes in iron regulatory proteins which lead to increased iron in the normal aged neural retina and that, at least in vitro and likely in vivo, elevated intracellular free iron increases the susceptibility of retinal neurons to damage.
4.1. Iron accumulation in the neural retina with age
The age-related changes of iron levels in the retina are local and do not reflect changes of iron in the blood. Mice deficient in Cp and Hephaestin are anemic, but abnormal iron accumulation is found in their retinas and these mice are suggested to be a mouse model of AMD (Hahn et al., 2004b). Aceruloplasminemia patients are anemic but have a retinal iron overload (Dunaief et al., 2005). Our results further confirm the lack of correlation between blood levels and retinal levels of iron. Although the systemic iron level was within the normal range in old animals, there was increased iron accumulation in the aged retina. The retina is protected by a blood-retinal barrier, which limits iron flow into the retina. Iron requirements in the CNS are much greater than the observed rate of iron uptake (Bradbury, 1997) and this is likely to be true for the retina. Therefore, most retinal iron is derived from recycling behind the blood-retinal barrier, between the retinal pigment epithelium and the neural retina (Yefimova et al., 2000;Yefimova et al., 2002). Thus, the retina is protected from the effects of systemic iron overload or deficiency and has a tissue-specific iron-regulating mechanism (Hahn et al., 2004b;Hahn et al., 2004a).
Much of the iron in the retina is stored in the inner segments of the photoreceptors, a subcellular region rich in mitochondria and an important site for iron sequestration. H-Ft, L-Ft and mitochondria ferritin, the main storage proteins, are localized to this region and are presumably present to detoxify Fe2+ and minimize the cytoplasmic free iron level (Hahn et al., 2004a). Our immunohistochemical data demonstrate that three iron regulatory molecules are apparent in the IS of the photoreceptors: Tf, TrfR and Ft. There is decreased Tf, increased TrfR and increased Ft in the IS of the aged retinas, suggesting increased iron overload in this region with age. Our Western blot data, although on whole retina, are also consistent with the immunohistochemical observations. Clearly the iron homeostasis mechanisms have changed markedly in this critical region of the photoreceptors with age. Whether the increased iron in this region contributes to photoreceptor degeneration in AMD is unknown.
Tf is mostly synthesized in the rat RPE (Yefimova et al., 2000;Yefimova et al., 2002) and transported to the photoreceptors (Davis and Hunt, 1993). With age, we detected an increase in mRNA expression level but a decrease in protein level of Tf, the serum iron transport protein. This discrepancy has also been reported in the brain (Han et al., 2003). Thus, the level of Tf protein must be post-transcriptionally down-regulated with age. However, an increase in Tf gene expression and protein synthesis has been recently reported in the macula of patients with AMD (Chowers et al., 2006). Apparently in AMD, the post-transcriptional fate of mRNA for Tf is upregulated to produce more Tf protein. These findings are consistent with increased iron in the photoreceptors with age. Tf is an extracellular protein and binds extracellular iron. Chowers et al. (Chowers et al., 2006) suggest that perhaps Tf is protective against photoreceptor degeneration in AMD.
In the NFL and GCL, all of the studied iron regulatory molecules are present: Tf, TrfR, Ft, Fpn, and Cp. There appear to be changes with age in these layers using immunohistochemistry but the changes are not as clear as they are in the IS. Nevertheless, some of the increases observed by Western blots may relate to this area of the retina. Our findings with RGC-5 cells clearly demonstrate that iron can potentiate the degeneration of these cells caused by different agents. Increased Tf, Ft, and Cp, suggesting iron overload, have recently been reported in this region of the retina in glaucoma (Farkas et al., 2004;Stasi et al., 2007). Elevated iron as a function of age may be a susceptibility factor for retinal ganglion cell (RGC) degeneration in glaucoma. Interestingly, Cp is clearly localized to the axons of the RGCs. Thus, Cp is not performing a serum transport function but is perhaps acting as a ferroxidase to minimize the level of Fe2+ in the axons.
Our results suggest that in the retina, as a normal, functional, age-related change, there is a phenotypic alteration in iron homeostasis that causes an increased steady state of iron in retinal neurons. Although these changes in iron homeostasis may not cause neurodegeneration, they may lead to increased susceptibility of retinal neurons to damage and may contribute to progression of retinal neurodegenerative diseases. These age-related changes may be an underlying component of the clinical finding that age is a risk factor for several neurodegenerative diseases of the retina.
4.2. Increased iron in the neural retina as a susceptibility factor
We used an in vitro retinal ganglion cell model, RGC-5, to determine the effects of iron accumulation on these cultured neurons. RGC-5 is a retinal ganglion cell line that has been widely used to model retinal ganglion cells for in vitro experiments (Aoun et al., 2003;Maher and Hanneken, 2005;Martin et al., 2004). We increased intracellular free iron by using Fe-NTA in the media (Aguirre et al., 2005;Swaiman and Machen, 1989;Swaiman and Machen, 1991;Yamaoka et al., 2002). This model of iron loading attempts to model the effects of neuronal iron accumulation that occurs with age. Our data showed that non-toxic iron levels markedly potentiated the neuronal toxicity induced by paraquat, glutamate and TNF-α. We interpret these data to indicate that elevated, but non-toxic, intracellular levels of iron increased the susceptibility of RGC-5 cells to these different stresses. Our results with RGC-5 cells may not generalize to RGCs or other retinal neurons in the aged retina in vivo. However, our findings with paraquat are consistent with a recent report on the synergistic effect of iron and paraquat in the pathogenesis of PD (Peng et al., 2007).
Large amounts of iron deposits in neural tissues are toxic and cause neuronal death by generating oxidative stress. However, the low level of iron accumulation we observed in the normal, aged retina may not be sufficient to cause retinal degeneration. This interpretation is consistent with studies which show an increase of iron in the normal brain and normal human retina with age (Bartzokis et al., 1997;Hahn et al., 2006;Jeong and David, 2006;Zecca et al., 2001). Most of the age-related neurodegenerative diseases are multi-factorial disorders. In Parkinson’s Alzheimer’s and Huntingon’s disease, iron levels are abnormally elevated early in the disease process, suggesting that increased iron levels may serve as a susceptibility factor for neurodegenerative diseases and may impact the clinical manisfestations, such as age of onset (Bartzokis et al., 1999;Bartzokis and Tishler, 2000). For example, the contribution of brain iron deposition to AD is supported by the association of the hemochromatosis gene, that increases body iron load, with the risk of developing early onset AD in younger individuals (Combarros et al., 2003;Sampietro et al., 2001).
In summary, our study suggests that there is an age-related change in iron homeostasis causing iron accumulation in the rodent neural retina. Local accumulation of free iron in the aged, neural retina may lead to increased susceptibility of retinal neurons to damage and may contribute to the pathogenesis and/or progression of age-related retinal diseases. Iron chelators, which cross the blood-brain barrier, are being developed as treatments of neurodegenerative diseases (Richardson, 2004). Therapeutic strategies to ameliorate age-related iron accumulation in retinal neurons may provide new treatments for age-related retinal diseases, such as AMD and glaucoma.
Acknowledgments
This work was supported by NIH grant EY12017 and a generous gift from the Forsythe Foundation. The authors thank Neeraj Agarwal of the University of North Texas Health Science Center for providing the RGC-5 cell line.
Footnotes
The authors do not have any conflict of interests or financial interests.
This work was supported by NIH grant EY12017 and a generous gift from the Forsythe Foundation.
The data contained in the manuscript being submitted have not been previously published, have not been submitted elsewhere and will not be submitted elsewhere while under consideration at Neurobiology of Aging.
All coauthors have seen and agree with the contents of the manuscript.
Disclosure Statement
The authors do not have any conflict of interests or any financial interests.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Aguirre P, Mena N, Tapia V, Arredondo M, Nunez MT. Iron homeostasis in neuronal cells: a role for IREG1. BMC Neurosci. 2005;6:3. doi: 10.1186/1471-2202-6-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Aoun P, Simpkins JW, Agarwal N. Role of PPAR-gamma ligands in neuroprotection against glutamate-induced cytotoxicity in retinal ganglion cells. Invest Ophthalmol Vis Sci. 2003;44:2999–3004. doi: 10.1167/iovs.02-1060. [DOI] [PubMed] [Google Scholar]
- Bartzokis G, Beckson M, Hance DB, Marx P, Foster JA, Marder SR. MR evaluation of age-related increase of brain iron in young adult and older normal males. Magn Reson Imaging. 1997;15:29–35. doi: 10.1016/s0730-725x(96)00234-2. [DOI] [PubMed] [Google Scholar]
- Bartzokis G, Cummings JL, Markham CH, Marmarelis PZ, Treciokas LJ, Tishler TA, Marder SR, Mintz J. MRI evaluation of brain iron in earlier- and later-onset Parkinson’s disease and normal subjects. Magn Reson Imaging. 1999;17:213–222. doi: 10.1016/s0730-725x(98)00155-6. [DOI] [PubMed] [Google Scholar]
- Bartzokis G, Tishler TA. MRI evaluation of basal ganglia ferritin iron and neurotoxicity in Alzheimer’s and Huntingon’s disease. Cell Mol Biol (Noisy -le-grand) 2000;46:821–833. [PubMed] [Google Scholar]
- Bishop GM, Robinson SR, Liu Q, Perry G, Atwood CS, Smith MA. Iron: a pathological mediator of Alzheimer disease? Dev Neurosci. 2002;24:184–187. doi: 10.1159/000065696. [DOI] [PubMed] [Google Scholar]
- Bradbury MW. Transport of iron in the blood-brain-cerebrospinal fluid system. J Neurochem. 1997;69:443–454. doi: 10.1046/j.1471-4159.1997.69020443.x. [DOI] [PubMed] [Google Scholar]
- Bus JS, Gibson JE. Paraquat: model for oxidant-initiated toxicity. Environ Health Perspect. 1984;55:37–46. doi: 10.1289/ehp.845537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Calzada JI, Jones BE, Netland PA, Johnson DA. Glutamate-induced excitotoxicity in retina: neuroprotection with receptor antagonist, dextromethorphan, but not with calcium channel blockers. Neurochem Res. 2002;27:79–88. doi: 10.1023/a:1014854606309. [DOI] [PubMed] [Google Scholar]
- Chowers I, Wong R, Dentchev T, Farkas RH, Iacovelli J, Gunatilaka TL, Medeiros NE, Presley JB, Campochiaro PA, Curcio CA, Dunaief JL, Zack DJ. The iron carrier transferrin is upregulated in retinas from patients with age-related macular degeneration. Invest Ophthalmol Vis Sci. 2006;47:2135–2140. doi: 10.1167/iovs.05-1135. [DOI] [PubMed] [Google Scholar]
- Combarros O, Garcia-Roman M, Fontalba A, Fernandez-Luna JL, Llorca J, Infante J, Berciano J. Interaction of the H63D mutation in the hemochromatosis gene with the apolipoprotein E epsilon 4 allele modulates age at onset of Alzheimer’s disease. Dement Geriatr Cogn Disord. 2003;15:151–154. doi: 10.1159/000068480. [DOI] [PubMed] [Google Scholar]
- Crichton RR. Inorganic Biochemistry of Iron Metabolism: From Molecular Mechanisms to Clinical Consequences. Chichester, John Wiley & Sons; 2001. Ref Type: Generic. [Google Scholar]
- Davis AA, Hunt RC. Transferrin is made and bound by photoreceptor cells. J Cell Physiol. 1993;156:280–285. doi: 10.1002/jcp.1041560209. [DOI] [PubMed] [Google Scholar]
- Dentchev T, Hahn P, Dunaief JL. Strong labeling for iron and the iron-handling proteins ferritin and ferroportin in the photoreceptor layer in age-related macular degeneration. Arch Ophthalmol. 2005;123:1745–1746. doi: 10.1001/archopht.123.12.1745. [DOI] [PubMed] [Google Scholar]
- Donovan A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, Paw BH, Drejer A, Barut B, Zapata A, Law TC, Brugnara C, Lux SE, Pinkus GS, Pinkus JL, Kingsley PD, Palis J, Fleming MD, Andrews NC, Zon LI. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature. 2000;403:776–781. doi: 10.1038/35001596. [DOI] [PubMed] [Google Scholar]
- Dunaief JL. Iron induced oxidative damage as a potential factor in age-related macular degeneration: the Cogan Lecture. Invest Ophthalmol Vis Sci. 2006;47:4660–4664. doi: 10.1167/iovs.06-0568. [DOI] [PubMed] [Google Scholar]
- Dunaief JL, Richa C, Franks EP, Schultze RL, Aleman TS, Schenck JF, Zimmerman EA, Brooks DG. Macular degeneration in a patient with aceruloplasminemia, a disease associated with retinal iron overload. Ophthalmology. 2005;112:1062–1065. doi: 10.1016/j.ophtha.2004.12.029. [DOI] [PubMed] [Google Scholar]
- Farkas RH, Chowers I, Hackam AS, Kageyama M, Nickells RW, Otteson DC, Duh EJ, Wang C, Valenta DF, Gunatilaka TL, Pease ME, Quigley HA, Zack DJ. Increased expression of iron-regulating genes in monkey and human glaucoma. Invest Ophthalmol Vis Sci. 2004;45:1410–1417. doi: 10.1167/iovs.03-0872. [DOI] [PubMed] [Google Scholar]
- Hahn P, Dentchev T, Qian Y, Rouault T, Harris ZL, Dunaief JL. Immunolocalization and regulation of iron handling proteins ferritin and ferroportin in the retina. Mol Vis. 2004a;10:598–607. [PubMed] [Google Scholar]
- Hahn P, Qian Y, Dentchev T, Chen L, Beard J, Harris ZL, Dunaief JL. Disruption of ceruloplasmin and hephaestin in mice causes retinal iron overload and retinal degeneration with features of age-related macular degeneration. Proc Natl Acad Sci U S A. 2004b;101:13850–13855. doi: 10.1073/pnas.0405146101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hahn P, Ying GS, Beard J, Dunaief JL. Iron levels in human retina: sex difference and increase with age. Neuroreport. 2006;17:1803–1806. doi: 10.1097/WNR.0b013e3280107776. [DOI] [PubMed] [Google Scholar]
- Han J, Day JR, Connor JR, Beard JL. Gene expression of transferrin and transferrin receptor in brains of control vs. iron-deficient rats Nutr Neurosci. 2003;6:1–10. [PubMed] [Google Scholar]
- He X, Hahn P, Iacovelli J, Wong R, King C, Bhisitkul R, Massaro-Giordano M, Dunaief JL. Iron homeostasis and toxicity in retinal degeneration. Prog Retin Eye Res. 2007;26:649–673. doi: 10.1016/j.preteyeres.2007.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hentze MW, Muckenthaler MU, Andrews NC. Balancing acts: molecular control of mammalian iron metabolism. Cell. 2004;117:285–297. doi: 10.1016/s0092-8674(04)00343-5. [DOI] [PubMed] [Google Scholar]
- Jellinger KA, Kienzl E, Rumpelmaier G, Paulus W, Riederer P, Stachelberger H, Youdim MB, Ben-Shachar D. Iron and ferritin in substantia nigra in Parkinson’s disease. Adv Neurol. 1993;60:267–272. [PubMed] [Google Scholar]
- Jeong SY, David S. Age-related changes in iron homeostasis and cell death in the cerebellum of ceruloplasmin-deficient mice. J Neurosci. 2006;26:9810–9819. doi: 10.1523/JNEUROSCI.2922-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Krishnamoorthy RR, Agarwal P, Prasanna G, Vopat K, Lambert W, Sheedlo HJ, Pang IH, Shade D, Wordinger RJ, Yorio T, Clark AF, Agarwal N. Characterization of a transformed rat retinal ganglion cell line. Brain Res Mol Brain Res. 2001;86:1–12. doi: 10.1016/s0169-328x(00)00224-2. [DOI] [PubMed] [Google Scholar]
- Langenbach R, Malick L, Tompa A, Kuszynski C, Freed H, Huberman E. Maintenance of adult rat hepatocytes on C3H/10T1/2 cells. Cancer Res. 1979;39:3509–3514. [PubMed] [Google Scholar]
- Liou HH, Tsai MC, Chen CJ, Jeng JS, Chang YC, Chen SY, Chen RC. Environmental risk factors and Parkinson’s disease: a case-control study in Taiwan. Neurology. 1997;48:1583–1588. doi: 10.1212/wnl.48.6.1583. [DOI] [PubMed] [Google Scholar]
- Maher P, Hanneken A. The molecular basis of oxidative stress-induced cell death in an immortalized retinal ganglion cell line. Invest Ophthalmol Vis Sci. 2005;46:749–757. doi: 10.1167/iovs.04-0883. [DOI] [PubMed] [Google Scholar]
- Martin PM, Ola MS, Agarwal N, Ganapathy V, Smith SB. The sigma receptor ligand (+)-pentazocine prevents apoptotic retinal ganglion cell death induced in vitro by homocysteine and glutamate. Brain Res Mol Brain Res. 2004;123:66–75. doi: 10.1016/j.molbrainres.2003.12.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niazi SB, Littlejohn D, Halls DJ. Rapid partial digestion of biological tissues with nitric acid for the determination of trace elements by atomic spectrometry. Analyst. 1993;118:821–825. doi: 10.1039/an9931800821. [DOI] [PubMed] [Google Scholar]
- Nunez MT, Gallardo V, Munoz P, Tapia V, Esparza A, Salazar J, Speisky H. Progressive iron accumulation induces a biphasic change in the glutathione content of neuroblastoma cells. Free Radic Biol Med. 2004;37:953–960. doi: 10.1016/j.freeradbiomed.2004.06.005. [DOI] [PubMed] [Google Scholar]
- Peng J, Peng L, Stevenson FF, Doctrow SR, Andersen JK. Iron and paraquat as synergistic environmental risk factors in sporadic Parkinson’s disease accelerate age-related neurodegeneration. J Neurosci. 2007;27:6914–6922. doi: 10.1523/JNEUROSCI.1569-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Richardson DR. Novel chelators for central nervous system disorders that involve alterations in the metabolism of iron and other metal ions. Ann N Y Acad Sci. 2004;1012:326–341. doi: 10.1196/annals.1306.026. [DOI] [PubMed] [Google Scholar]
- Rossi E. Hepcidin--the iron regulatory hormone. Clin Biochem Rev. 2005;26:47–49. [PMC free article] [PubMed] [Google Scholar]
- Rouault TA, Tong WH. Iron-sulphur cluster biogenesis and mitochondrial iron homeostasis. Nat Rev Mol Cell Biol. 2005;6:345–351. doi: 10.1038/nrm1620. [DOI] [PubMed] [Google Scholar]
- Rozanowska M, Jarvis-Evans J, Korytowski W, Boulton ME, Burke JM, Sarna T. Blue light-induced reactivity of retinal age pigment. In vitro generation of oxygen-reactive species. J Biol Chem. 1995;270:18825–18830. doi: 10.1074/jbc.270.32.18825. [DOI] [PubMed] [Google Scholar]
- Sampietro M, Caputo L, Casatta A, Meregalli M, Pellagatti A, Tagliabue J, Annoni G, Vergani C. The hemochromatosis gene affects the age of onset of sporadic Alzheimer’s disease. Neurobiol Aging. 2001;22:563–568. doi: 10.1016/s0197-4580(01)00219-6. [DOI] [PubMed] [Google Scholar]
- Sergeant C, Vesvres MH, Pravikoff MS, Deves G, Yefimova M, Jonet L, Valtink M, Courtois Y, Jeanny JC. Trace metals in human retina during aging period. Metal Ions in Biology and Medicine. 2004;8:491–495. [Google Scholar]
- Sofic E, Paulus W, Jellinger K, Riederer P, Youdim MB. Selective increase of iron in substantia nigra zona compacta of parkinsonian brains. J Neurochem. 1991;56:978–982. doi: 10.1111/j.1471-4159.1991.tb02017.x. [DOI] [PubMed] [Google Scholar]
- Stasi K, Nagel D, Yang X, Ren L, Mittag T, Danias J. Ceruloplasmin upregulation in retina of murine and human glaucomatous eyes. Invest Ophthalmol Vis Sci. 2007;48:727–732. doi: 10.1167/iovs.06-0497. [DOI] [PubMed] [Google Scholar]
- Swaiman KF, Machen VL. Effect of ferric nitrilotriacetate on predominantly cortical neuronal cell cultures. Neurochem Res. 1989;14:683–688. doi: 10.1007/BF00964879. [DOI] [PubMed] [Google Scholar]
- Swaiman KF, Machen VL. Effect of ferric nitrilotriacetate on rostral mesencephalic cells. Neurochem Res. 1991;16:1269–1274. doi: 10.1007/BF00966657. [DOI] [PubMed] [Google Scholar]
- Tezel G, Wax MB. Increased production of tumor necrosis factor-alpha by glial cells exposed to simulated ischemia or elevated hydrostatic pressure induces apoptosis in cocultured retinal ganglion cells. J Neurosci. 2000;20:8693–8700. doi: 10.1523/JNEUROSCI.20-23-08693.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams DM, Lee GR, Cartwright GE. Ferroxidase activity of rat ceruloplasmin. Am J Physiol. 1974;227:1094–1097. doi: 10.1152/ajplegacy.1974.227.5.1094. [DOI] [PubMed] [Google Scholar]
- Yamaoka K, Mori S, Nomura T, Taguchi T, Ito T, Hanamoto K, Kojima S. Elevation of antioxidant potency in mice brain by low-dose X-ray irradiation and its effect on Fe-NTA-induced brain damage. Physiol Chem Phys Med NMR. 2002;34:119–132. [PubMed] [Google Scholar]
- Yefimova MG, Jeanny JC, Guillonneau X, Keller N, Nguyen-Legros J, Sergeant C, Guillou F, Courtois Y. Iron, ferritin, transferrin, and transferrin receptor in the adult rat retina. Invest Ophthalmol Vis Sci. 2000;41:2343–2351. [PubMed] [Google Scholar]
- Yefimova MG, Jeanny JC, Keller N, Sergeant C, Guillonneau X, Beaumont C, Courtois Y. Impaired retinal iron homeostasis associated with defective phagocytosis in Royal College of Surgeons rats. Invest Ophthalmol Vis Sci. 2002;43:537–545. [PubMed] [Google Scholar]
- Yuan L, Neufeld AH. Tumor necrosis factor-alpha: a potentially neurodestructive cytokine produced by glia in the human glaucomatous optic nerve head. Glia. 2000;32:42–50. [PubMed] [Google Scholar]
- Zecca L, Gallorini M, Schunemann V, Trautwein AX, Gerlach M, Riederer P, Vezzoni P, Tampellini D. Iron, neuromelanin and ferritin content in the substantia nigra of normal subjects at different ages: consequences for iron storage and neurodegenerative processes. J Neurochem. 2001;76:1766–1773. doi: 10.1046/j.1471-4159.2001.00186.x. [DOI] [PubMed] [Google Scholar]

