Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Dec 14.
Published in final edited form as: Cancer Res. 2009 Dec 15;69(24):9306–9314. doi: 10.1158/0008-5472.CAN-09-1213

Gonadotropin-regulated Lymphangiogenesis in Ovarian Cancer is mediated by LEDGF induced expression of VEGF-C

Stav Sapoznik 1, Batya Cohen 1, Yael Tzuman 1, Gila Meir 1, Shifra Ben-Dor 2, Alon Harmelin 3, Michal Neeman 1
PMCID: PMC2794933  NIHMSID: NIHMS152703  PMID: 19934313

Abstract

The risk and severity of ovarian carcinoma, the leading cause of gynecological malignancy death, are significantly elevated in postmenopausal women. Ovarian failure at menopause, associated with a reduction in estrogen secretion, results in rise of the gonadotropic luteinizing and follicle stimulating hormones (LH and FSH), suggesting a role for these hormones in facilitating the progression of ovarian carcinoma. The current study examined the influence of hormonal stimulation on lymphangiogenesis in ovarian cancer cells. In vitro stimulation of ES2 ovarian carcinoma cells with LH and FSH induced expression of VEGF-C. In vivo, ovariectomy of mice resulted in activation of the VEGF-C promoter in ovarian carcinoma xenografts, increased VEGF-C mRNA level, and enhanced tumor lymphangiogenesis and angiogenesis. Seeking for the molecular mechanism, we examined the role of lens epithelial derived growth factor (LEDGF/p75), and the possible contribution of its putative target, a conserved stress response element (STRE) identified in silico in the VEGF-C promoter. Using chromatin immunoprecipitation we showed that LEDGF/p75 indeed binds the VEGF-C promoter, and binding is augmented by FSH. A corresponding hormonally regulated increase in the LEDGF/p75 mRNA and protein levels was observed. Suppression of LEDGF/p75 expression using siRNA, suppression of LH and FSH production using the gonadotropin-releasing hormone antagonist cetrorelix, or mutation of the conserved STRE suppressed the hormonally induced expression of VEGF-C. Overall our data suggests a possible role for elevated gonadotropins in augmenting ovarian tumor lymphangiogenesis in postmenopausal women.

Keywords: Menopause, Gonadotropins, VEGF-C, LEDGF/p75, lymphangiogenesis

Introduction

Ovarian carcinoma is the leading cause of gynecological malignancy death (1). The risk for the disease as well as its severity are higher in postmenopausal women. Epidemiological studies suggested that whereas the initial transformation occurs during ovulation, tumors remain dormant throughout the fertile age, and become clinically evident only at menopause. Hormonal alternations which are associated with menopause such as a decrease in estrogen and progesterone secretion, and a consequent increase in the systemic level of the gonadotropic hormones luteinizing hormone (LH) and follicular-stimulating hormone (FSH) could have a role in the manifestation of the disease.

Ovarian cancer cells were reported to express LH and FSH receptors (2, 3). Stimulation by these hormones affected gene expression and steroid production in a way which enhanced invasiveness, cell growth and angiogenesis (4–7). Clinical significance of gonadotropins in ovarian cancer patients was demonstrated by the correlation of increased LH and FSH concentrations in both the serum and ascitic fluid with increased disease severity (8).

Ovarian cancer metastasis occurs by direct multifocal seeding in the peritoneum as well as by migration through the lymphatic system. Extra-abdominal metastases of ovarian cancer were reported in the paraaortic, jugular and supra-clavicular lymph nodes (9–11), and lymphatic vessels were detected in human ovarian tumors (12–14). The expression level of VEGF-C, a key regulator of lymphangiogenesis was found to correlate significantly with lymph node and peritoneal metastasis as well as with poor survival (15, 16). In preclinical studies, down regulation of VEGF-C activity, either by a specific siRNA, by blockage of its receptor VEGFR3, or by usage of soluble VEGFR3 as a trap, was found to inhibit tumor lymphangiogenesis and metastasis and to enhance survival (17–20). These studies implicate lymphatic vessels in ovarian tumor progression. The aim of the current study was to investigate the possible role of LH and FSH stimulation on lymphangiogenesis in ovarian cancer. We show that gonadotropin stimulation induced VEGF-C promoter activation, and increased VEGF-C mRNA and protein levels in vitro. Accordingly, elevation of gonadotropin levels in vivo by ovariectomy resulted in VEGF-C activation, enhanced lymphangiogenesis and angiogenesis.

We recently reported an in silico analysis of the VEGF-C promoter region, as well as in vitro and in vivo studies of hyperthermia and oxidative stress induced expression of VEGF-C, suggesting a role for lens-epithelium derived growth factor LEDGF/p75 as a putative upstream regulator of VEGF-C expression (21). LEDGF/p75, a member of the HDGF family, was shown to protect cells from stress induced cell death by activation of several stress related genes, such as Hsp27, αB-crystallin, AOP2, ADH, ALDH and PKC γ (22)(23)(24). Transcriptional co-activation by LEDGF/p75 was reported in a number of studies to be mediated by binding of the protein to heat shock elements (HSE) and stress-related elements (STRE) found in the promoter region of its downstream targets (23)(25)(26)(27)(28). Alternatively, LEDGF/p75 was reported to induce MYC regulated transcription by interaction with JPO2 (29), and through an STRE independent DNA binding mediated by the LEDGF/p75 nuclear localization signal (NLS) and a dual copy of the AT-hook DNA binding motif (30). Recent findings indicate that LEDGF/p75 also plays a role in survival of cancer cells, resistance to chemotherapy and tumor progression (31), (32).

The results reported here, showing that lymphangiogenesis is hormonally regulated in ovarian cancer and the co-activation of VEGF-C and LEDGF/p75 by gonadotropins provide better understanding of the disease pathophysiology in postmenopausal women, and suggest LEDGF/p75 as a possible target for intervention.

Materials and Methods

Cell culture and in vitro hormonal stimulation

For in vitro hormonal stimulation studies, human epithelial ovarian carcinoma ES2 cells (kindly provided by Prof. Hauptmann, Charite, Berlin) were serum starved 24 hours prior to hormonal stimulation, and then administered with 1 ng/ml human LH or human FSH (kindly provided by Dr. Fortune kohen, Weizmann Institute, Rehovot, Israel).

Reverse transcription and real time PCR

Total RNA was extracted using PerfectPure RNA Cultured Cell or Tissue Kit (5 PRIME, Gaithersburg, MD, USA). 1.5 micrograms of total RNA were used for reverse transcription using SuperScript II RNase H–reverse (Invitrogen, Carlsbad, CA, USA). Real time PCR was performed using StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with the following primers: human VEGFC(NM005429.2) – 5’tgccagcaacactaccacag and 5’gtgattattccacatgtaattggtg, human LEDGF/p75 (NM_033222.3) – 5’gggccaaacaaaaagctaga and 5’ttcattgctctccccgttat, human B2M (NM_004048.2) – 5’ttctggcctggaggctatc and 5’tcaggaaatttgactttccattc.

Immunoblot assays

Whole-cell lysates were prepared in ice-cold RIPA buffer (20 mM Tris, pH 7.4, 137 mM NaCl, 10% glycerol, 0.5% (wt/vol) sodium deoxycholate, 0.1% (wt/vol) sodium dodecyl sulfate (SDS), 1% Triton X-100, 2 mM EDTA) containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Sigma, St. Louis, MO, USA) and fractionated by SDS-PAGE. Primary antibodies were used for the detection of VEGF-C (C-20, Santa Cruz, Santa Cruz, CA, USA), LEDGF/p75 (C16, Santa Cruz) and beta-tubulin (Santa Cruz). HRP-conjugated anti-goat or anti-rabbit secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) were used respectively. Densitometric evaluation was carried out using ImageJ software.

In vitro luciferase assay

To create a reporter plasmid for the VEGF-C promoter region, human genomic DNA was used for PCR amplification of a 468bp sequence upstream to the VEGF-C cds, using the following primers: 5’ccgccgcagcgcccgcg and 3’gggccaggaaggtggtac. The PCR product was inserted into the pLuc plasmid, which encodes for the firefly luciferase gene. Another construct was used, in which two STREs and an AGG box in the promoter region of VEGF-C were disrupted by nine mutations using specific PCR primers (5′gccagagccctcgtttttctcctttcttttcttccccgaagtgagag) as previously reported (21). For in vitro luciferase assay, ES2 cells were co-transfected with the luciferase reporter plasmid and with pSV-Renilla using Lipofetamine 2000 (Invitrogen). Following transfection, cells were hormonally stimulated (1ng/ml LH or FSH in a serum free medium; 18 h). The luciferase assay was performed using Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA). Measurement of renilla luciferase activity was used for calibration. Experiments were done 3 times in triplicates. Down regulation of LEDGF/p75 was achieved by transfection of the cells with a specific siRNA (5’agacagcaugaggaagcgdtdt Dharmacon, Lafayette, CO, USA). A non specific sequence was used as a control.

In vivo tumor xenografts

All experiments were approved by the Weizmann Institutional Animal Care and Use Committee (IACUC).

Tumors were generated by s.c. injection of 1.75 × 106 ES2 cells stably transfected with the pVEGF-C-Luc construct (see the in vitro luciferase assay section) to the hind limb of 7.5 week old CD1 nude female either control or ovariectomized (OVX) mice. Blockade of GnRH-induced secretion of LH and FSH was achieved by s.c. daily injection of 0.5mg/kg Cetrorelix (as Cetrotide, Merck Serono, Geneva, Switzerland), starting 15 days prior to induction of the tumors and throughout the whole period of the experiment. For time lapse luciferase bioluminescence analysis, mice were i.p. injected with 1.5 mg D-luciferin (Caliper Life Sciences, Hopkinton, MA, USA) and imaged after 15 min, using the IVIS100 system (Caliper Life Sciences). The total flux of photons from the tumor area was measured. Measurements of the tumor three dimensions were conducted manually using a caliper. Values which were below the detection threshold were defined as zero. 16 days following tumor induction, mice were euthanized, and tumors were removed for RNA analysis, or fixed in 4% PFA for histological analysis.

Histology

Following fixation in 4% PFA, tissues were embedded in paraffin and sectioned serially at 4 µm thickness. Staining was carried out using anti CD34 (Cedarlane laboratories, Burlington, NC, USA) anti LYVE-1 AP (Fitzgerald Industries, Concord, MA, USA) or anti Prox1 AP (Novus Biologicals, Littleton, CO, USA) antibodies. Detection of the anti CD34 antibody was carried out using a biotin-SP-conjugated anti rat antibody (Jackson ImmunoResearch Laboratories) and Cy3-conjugated Streptavidin (Jackson ImmunoResearch Laboratories). For the detection of the anti LYVE-1 AP and anti Prox1 AP antibodies we used an alkaline phosphatase-conjugated anti rabbit antibody (Jackson ImmunoResearch Laboratories) and Fast Red substrate (Sigma). Staining was detected using a fluorescence microscope (Zeiss Axioscope II, Yena, Germany, Simple PCI software). The percentage of fluorescent staining coverage in each field of view was calculated using ImageJ software.

In situ hybridization

For preparation of VEGF-C and LEDGF/p75 mRNA probes, RT-PCR was carried out using the following pairs of primers respectively: 5’ctgtgtccagcgtagatgagc and 5’gtagacggacacacatggagg, 5’cacacagagatgattactacactg and 5’ccatcttgagcatcagatcctc. Following cloning of the fragments using the pGEM®-T Easy Vector System (Promega), digoxigenin-labeled riboprobes were prepared by in vitro transcription using the DIG RNA Labeling Kit (Roche, Basel, Switzerland).

Tissues fixed in 4% PFA were embedded in paraffin and sectioned serially at 7 µm thickness. Sections were deparaffinized, hydrated, digested with proteinase K (Sigma), rinsed with TBS, incubated in 4% PFA, dehydrated and then incubated with a hybridization mixture for 30 minutes at 55°c. Hybridization with the specific probes was carried out overnight at 65°c, using 1 µg/ml riboprobes. Following the hybridization procedure, sections were washed with SSC and TBS, and then blocked with 1% BSA. For detection of the digoxigenin-labeled riboprobes, sections were incubated with antidigoxigenin alkaline phosphatase (Roche) and stained with NBT/BCIP (Roche). Staining was detected using E800 microscope and digital camera DXM 1200 (Nikon, Tokyo, Japan).

ChIP Assays

ES2 cells were serum starved for 24 hours and then stimulated with 1 ng/ml LH or FSH or either 1 or 4 hours. Chromatin immunoprecipitation was performed with the EZ ChIP™ Chromatin Immunoprecipitation Kit (Upstate, Lake Placid, FL, USA) using anti-LEDGF/p75 antibodies (C16, Santa Cruz). PCR was performed using primers designed for the VEGF-C promoter region (see the in vitro luciferase assay section).

Statistical Analysis

Data are presented as mean value ± standard error. Statistical significance (p < 0.05) was assessed by t test unless indicated differently.

Results

Hormonal stimulation induces VEGF-C elevation in vitro

In order to study the effects of gonadotropin stimulation on lymphangiogenesis in ovarian cancer, we first examined the regulation of the VEGF-C promoter activity by LH and FSH stimulation in vitro. ES2 human ovarian carcinoma cells were transfected with a luciferase reporter plasmid in which the VEGF-C promoter region regulates the firefly luciferase transcription. Co-transfection with a renila luciferase construct served for calibration. Following transfection, cells were stimulated for 18 hours with either 1ng/ml LH, 1ng/ml FSH or a combination of the two hormones together in a serum free medium. Measurements of luciferase activity showed about a 2 fold increase in the activation level of the VEGF-C promoter following stimulation with either LH or FSH (Table 1; P=0.034, P=0.036 respectively, n=6). Stimualtion of the cells with both LH and FSH resulted in a 3.4 fold increase, suggesting that the effect of the hormonal stimulation is additive (P=0.007).

Table 1.

In vitro luciferase assay as well as RT-PCR analysis of VEGF-C show LEDGF/p75 dependent hormonal regulation of VEGF-C promoter activity.

No Stimulation LH FSH LH + FSH
Luciferase
 WT 1 1.96 ± 0.07a 1.98±0.17a 3.4 ± 0.27a
 Promoter (P=0.03) (P=0.04) (P=0.007)
 Control 0.96 ±0.03 1.7 ± 0.02b 1.81 ± 0.02b 2.69 ± 0.2b
 siRNA (P=0.03) (P=0.01) (P=0.03)
 LEDGF/p75 0.75 ±0.06 1.14±0.02c 1.17 ± 0.03c 1.53 ± 0.06 c
 siRNA (P=0.2) (P=0.19) (P=0.08)
 Mutated 1 1 ± 0.05 d 1.06 ± 0.04 d 1.06 ± 0.007 d
 Promoter (P=0.49) (P=0.11) (P=0.07)
RT-PCR
 Control siRNA VEGF-C 1 2.3b 1.9b 3.3b
 Control siRNA LEDGF 1 2.04 b 1.7b 2.9b
 LEDGF/p75 siRNA VEGF-C 1 0.99c 1.12c 0.96c
 LEDGF/p75 siRNA LEDGF 1 1.25c 1.17c 1.22c
Open in a new tab

All values are presented as fold induction compared to control ± standard error. Statistical significance was determined by Student t-tests as follows:

a

compared to non stimulated cells.

b

compared to non stimulated, control siRNA transfected cells.

c

compared to non stimulated, LEDGF/p75 siRNA transfected cells.

d

compared to non stimulated cells transfected with a mutated construct.

Hormonal stimulation induces expression of LEDGF/p75

LEDGF/p75 was previously reported to induce expression of several downstream target genes (23)(26)(25) including VEGF-C (21), possibly by binding to STRE in the promoter of the target genes. We hypothesized that LEDGF/p75 may mediate VEGF-C activation as a response to hormonal stimulation. To study this hypothesis we down regulated LEDGF/p75 using a specific siRNA. ES2 cells transfected with the siRNA were further stimulated with LH, FSH or a combination of both hormones. Luciferase assay revealed an attenuated enhancement of the VEGF-C promoter following hormonal stimulation in cells transfected with the siRNA as compared to untransfected cells or cells transfected with a non specific siRNA sequence (Table 1).

These results were further verified by RT-PCR. Whereas hormonal stimulation of cells transfected with control non specific siRNA resulted in a significant increase in both VEGF-C and LEDGF/p75 mRNA levels, cells transfected with the specific LEDGF/p75 siRNA showed only attenuated response to the hormonal stimulation (Table 1). Treatment with LEDGF/p75 siRNA was found to be very effective and resulted in a 22 fold reduction in the LEDGF/p75 mRNA level. The slight increase observed in the VEGF-C promoter activity following hormonal stimulation of LEDGF/p75 siRNA treated cells, might suggest the minute involvement of other molecules in this pathway. The role of the conserved-STRE in the VEGF-C promoter in hormonal mediated VEGF-C activation, was analyzed using ES2 cells transfected with a construct in which the luciferase gene was regulated by a mutated VEGF-C promoter sequence, with 9 mutations disrupting the conserved STRE (21). Using this construct the hormonal-activation of the VEGF-C promoter was abolished, suggesting the STRE sequence to be crucial for VEGF-C activation by LH and FSH (Table 1). Following administration of either 1ng/ml LH or 1ng/ml FSH to ES2 cells for 1 or 4 hours, chromatin immunoprecipitation was carried out using anti LEDGF/p75 antibodies, as well as VEGF-C promoter specific primers. An increase in the amount of VEGF-C promoter attached to LEDGF/p75 was detected following stimulation with FSH but not with LH (Fig 1A; n=2).

Figure 1. Hormonal stimulation induces VEGF-C elevation in vitro.

Figure 1

Open in a new tab

A. ChIP carried out on hormonally stimulated or control ES2 cells using anti LEDGF/p75 antibody and primers specific for the VEGF-C promoter area (upper panel), or GAPDH for input samples (lower panel). IgG antibody was used as a negative control. B. Real time PCR using VEGF-C specific primers (left) or LEDGF/p75 specific primers (right) carried out on RNA derived from ES2 hormonally stimulated cells. (n=3) C. Western blot analysis using anti VEGF-C, anti LEDGF/p75 or β-tubulin antibodies carried out on total cell lysate derived from ES2 hormonally stimulated cells. (n=3) D. Densitometric analysis of C.

We next examined whether the enhanced activation of the VEGF-C promoter following hormonal stimulation results in a correlated elevation of the VEGF-C and LEDGF/p75 mRNA and protein levels. Following 24 hour starvation in a serum free medium, ES2 cells were hormonally stimulated for varying periods of time (0, 6, 12, 24, 30h). For examination of the mRNA levels, total RNA was extracted, reverse transcribed, and analyzed by real time PCR using VEGF-C and LEDGF/p75 specific primers. An elevation of the LEDGF/p75 mRNA level was detected in ES2 cells following stimulation with either LH or FSH, reaching its maximal values (2.3 and 1.7 fold increase respectively) 12 hours following hormones application (Fig 1B; right panel). Signed rank test showed statistical significance for both LH and FSH stimulation (P=0.003 and P=0.008 respectively). Detection of the LEDGF/p75 protein level by western blot analysis showed an increase in the amount of LEDGF/p75 protein compared to control (Fig 1C,D. P=0.004, P=0.035 for LH and FSH stimulation respectively). Similarly, an elevation of the VEGF-C mRNA level was observed following stimulation with either LH or FSH, starting as early as 6 hours following treatment and reaching its maximal values (2.6 and 2.5 fold increase respectively) 12 hours following hormones application (Fig 1B; left panel). Signed rank test showed statistical significance for both LH and FSH stimulation (P=0.00025 and P=0.0261 respectively). For detection of VEGF-C protein levels a whole cell lysate was prepared and analyzed by western blot analysis using a VEGF-C specific antibody. An increase in the protein level was observed for both LH and FSH treatments (Fig 1C,D. P=0.027, P=0.028 for LH and FSH stimulation respectively).

Ovariectomy induces VEGF-C promoter activation in ovarian tumors

The impact of menopause induced ovarian failure along with the corresponding changes in the hormonal milieu, was tested in vivo using ovariectomized mice. Two weeks following ovariectomy, subcutaneous hind limb tumors were initiated by inoculation of ES2 cells stably expressing a luciferase reporter regulated by the VEGF-C promoter. Time lapse imaging using the IVIS100 system enabled a follow up of the VEGF-C promoter activation level (Fig 2A,B. OVX: n=5. Control: n=5). Bioluminescence was detected as early as 2 days post injection and was restricted to the tumor area. At all time points examined, the total flux of photons from the tumor was higher in the ovariectomized group compared to untreated controls, indicating a higher activation level of the VEGF-C promoter. In order to statistically analyze the data, we calculated for each animal the rate of signal enhancement, by deriving the total photon flux as a function of time. Comparing the results by t-test resulted in a significant (P=0.013) difference between the ovariectomized and the control groups. The tumor length, width and height were measured manually, and analysis of the tumor volume showed an increase of the tumor mass both in the ovariectomized and the control groups (Fig 2C; OVX, n=5; Control, n=5). Interestingly, no significant differences in tumor volume were found among the groups (P=0.88, P=0.96, P=0.68, P=0.96, P=0.55, P=0.82 for 2, 3, 5, 7, 9 and 14 days following tumor induction respectively), indicating that the higher bioluminescence signal observed in the ovariectomized group is indeed a consequence of an increased VEGF-C promoter activity, and not a mere result of tumor size differences.

Figure 2. Ovariectomy induces VEGF-C promoter activation in ovarian tumors.

Figure 2

Open in a new tab

A. Time lapse bioluminescence imaging of ovariectomized (OVX) and control (−) mice subcutaneously injected with ES2 cells which stably express the firefly luciferase gene under VEGF-C promoter regulation. B. Total flux of photons derived from the tumor area of OVX and control mice subcutaneously injected with ES2 cells, which stably express the firefly luciferase gene under VEGF-C promoter regulation. C. Volume of tumors induced in OVX and control mice. (OVX n=5, control n=5).

In order to evaluate metastatic spread of the tumors we carried out pathological examination of histological sections taken from the adjacent lymphnodes. No definite lymphnode involvement in either control or OVX mice could be detected at these early time points (data not shown).

In order to verify to role of gonadotropins elevation in VEGF-C promoter activation, either ovariectomized or control mice were s.c daily injected with 0.5mg/kg cetrorelix, a GnRH antagonist (Fig 3A,B. Ovx: n=5, Ovx + cetrorelix: n=5, Control n=4, Control + cetrorelix n=4). VEGF-C promoter activity, as reflected by the total flux of photons from the tumor area was found to be higher in the ovariectomized group compared to all other groups in each of the time points examined. GnRH blockade showed no effect in the control group, whereas in the ovariectomized group this treatment prevented the induction of VEGF-C expression, suggesting that the VEGF-C promoter is indeed activated in a gonadotropin dependent manner. The statistical significance of the data was verified using a t-test by comparing the rate of signal enhancement in each of the groups (Ovx vs. Control: P=0.04, Ovx vs. Ovx + cetrorelix: P=0.04, Ovx vs. Control + cetrorelix: P=0.03).

Figure 3. GnRH blockade prevents the VEGF-C promoter enhanced activation in ovariectomized mice.

Figure 3

Open in a new tab

A. Bioluminescence imaging of ovariectomized (OVX) and control tumor bearing mice either treated or untreated with cetrorelix. Mice were imaged 7 days following tumor induction. B. Total flux of photons derived from the tumor area of OVX and control tumor bearing mice, either treated or untreated with cetrorelix. (OVX n=5, OVX+cetrorelix n=5, control n=4, control+cetrorelix n=4).

Ovariectomy induces an elevation in VEGF-C and LEDGF/p75 mRNA levels in tumors

Following mRNA extraction from tumors derived from each of the experimental groups, VEGF-C and LEDGF/p75 mRNA levels were determined (Fig 4A,B. OVX: n=4, Control: n=4, OVX + cetrorelix: n=5, Control + cetrorelix: n=3). In the ovariectomized group VEGF-C mRNA was 1.9 fold higher compared to the non ovariectomized control (P=0.0009). Treatment with cetrorelix significantly blocked the increase in the VEGF-C mRNA (OVX vs. OVX + cetrorelix: P=0.0006, OVX vs. control + cetrorelix: P=0.006). A 1.8 fold increase was observed in the LEDGF/p75 mRNA levels in the ovariectomized mice as compared to control (P=0.005). This increased transcription was blocked by treatment with cetrorelix (OVX vs. OVX + cetrorelix: P=0.0003, OVX vs. control + cetrorelix: P=0.005).

Figure 4. Ovariectomy induces an elevation in VEGF-C and LEDGF/p75 mRNA levels in tumors.

Figure 4

Open in a new tab

A. Real time PCR using VEGF-C specific primers carried out on RNA extracted from tumors. Data are presented as fold induction compared to control group. (OVX: n=4, Control: n=4, OVX + cetrorelix: n=5, Control + cetrorelix: n=3). B. Real time PCR using LEDGF/p75 specific primers carried out on RNA extracted from tumors. Data are presented as fold induction compared to control group (OVX: n=4, Control: n=4, OVX + cetrorelix: n=5, Control + cetrorelix: n=3). C. In situ hybridization using a VEGF-C specific probe of histological sections derived from tumors induced in OVX and control mice (OVX n=5, control n=5). D. In situ hybridization using a LEDGF/p75 specific probe of histological sections derived from tumors induced in OVX and control mice (OVX n=5, control n=5).

To further investigate the influence of ovariectomy on VEGF-C and LEDGF/p75 transcription in ovarian tumor bearing mice, an in situ hybridization was carried out on histological sections derived from tumors induced in ovariectomized versus control mice. The staining indicated an increase both in the VEGF-C and LEDGF/p75 mRNA levels in the ovariectomized group compared to untreated control (Fig 4C,D; OVX: n=5. Control: n=5).

Ovariectomy induces lymphangiogenesis and angiogenesis in ovarian tumors

Histological sections of the tumors were stained for blood and lymphatic vessels (Figure 5). Analyzing both the tumor area and the skin area in the vicinity of the tumor by an immunohistochemical staining using an anti LYVE-1 antibody we found an enhanced staining in the ovariectomized group, indicating enhanced lymphangiogenesis (Figure 5A; OVX: n=5. Control: n=5). Analysis of the data was carried out by calculating the percentage of fluorescent staining coverage in each field of view, showing a significant difference between the ovariectomized and control group for both the tumor and skin areas (t-test; P= 0.04 and 0.03 respectively). To verify the specificity of the LYVE-1 staining as a marker for lymphatic vessels, an anti Prox-1 antibody was used for immunohistological staining of adjacent sections (Figure 5C). A similar pattern of vascular staining was observed for the two antibodies.

Figure 5. Ovariectomy induces lymphangiogenesis and angiogenesis in ovarian tumors.

Figure 5

Open in a new tab

A. Immunohistochemical staining using anti LYVE-1 antibody of histological sections derived from tumors (upper panel) or the skin area in the vicinity of the tumors (lower panel) induced in OVX and control mice (OVX n=5, control n=5). Analysis of the data was carried out by calculating the percentage of fluorescent staining coverage in each field of view. B. Immunohistochemical staining using anti CD34 antibody of histological sections derived from tumors (upper panel) or the skin area in the vicinity of the tumors (lower panel) induced in OVX and control mice (OVX n=5, control n=5). Analysis of the data was carried out by calculating the percentage of fluorescent staining coverage in each field of view. C. Immunohistochemical staining using anti LYVE-1 antibody (upper panel) or anti Prox-1 antibody (lower panel) of histological sections derived from OVX and control mice.

Having some proangiogenic activity, we hypothesized that the VEGF-C activation in ovariectomized tumor bearing mice may result in enhanced tumor angiogenesis. Immunohistochemical staining of both the tumor area and the skin area in the vicinity of the tumor using an anti CD34 antibody showed an enhanced staining in the ovariectomized group (Figure 5B; P=0.02, P=0.04 for tumor and skin areas respectively).

Discussion

Lymphangiogenesis, an important step in tumor progression, serves as a route for metastasizing cells. Lymphangiogenesis was reported to play a role in ovarian cancer progression both clinically and in experimental models (12, 20). In addition, the risk and aggressiveness of ovarian cancer were found to rise with menopause. In the current study we tied both findings, demonstrating the role of the gonadotropic hormones LH and FSH, whose level rise at menopause, in regulation of lymphangiogenesis in ovarian cancer.

In vitro stimulation of ovarian cancer cells by gonadotropins was previously reported to enhance cell invasiveness and to induce cell growth, activation of oncogenes and inhibition of apoptosis (1, 5, 6)(33). We have previously shown that gonadotropin stimulation of ovarian cancer induced expression of vascular endothelial growth factor (VEGF), integrins and CD44 (7, 34). In the current study we show that in vitro stimulation by gonadotropins activated the VEGF-C promoter, and augmented VEGF-C mRNA and protein levels in human ovarian carcinoma ES2 cells.

The role of VEGF-C in peritumor lymphatic remodeling and lymph node metastatic spread, was previously demonstrated for multiple types of cancers (35–37). Over-expression of VEGF-C increased tumor growth, lymphatic involvement and metastasis (38)(39)(40). Clinically, high levels of VEGF-C were correlated with metastasis, low survival and poor prognosis (15, 16).

The involvement of gonadotropins elevation in VEGF-C activation was examined in ovariectomized mice and was further verified using Cetrorelix, a GnRH antagonist. In previous studies this drug was effectively used to reduce gonadotropins levels in vivo in mice (41), (42). Treatment with the cetrorelix significantly suppressed the ovariectomy-induced activation of the VEGF-C promoter in the ovarian carcinoma tumors.

Consistent with the in vivo bioluminescence imaging, VEGF-C mRNA level was found to be higher in tumors derived from ovariectomized mice compared to control mice. Accordingly, the density of lymph vessels detected by immunohistochemistry was elevated. In addition to its lymphangiogenic activity, VEGF-C is known to bind VEGFR-2 and to induce endothelial cell survival, mitogenesis and migration. We therefore hypothesized ovariectomy to induce angiogenesis of the tumors. Indeed, immunohistochemical staining with an anti CD34 antibody revealed enhanced density of blood vessels in the ovariectomized group. This may result as well from VEGF-A enhanced activation previously shown to take place in ovariectomized mice (7).

The role of the LEDGF/p75 in initiation and progression of malignant tumors was exemplified in different cancer types. It was found to inhibit the caspase independent lysosomal cell death pathway in various human cancers (31), to confer resistance to chemotherapy in acute myelogenous leukemia patients (32), and to play a role in the initiation of leukemic transformation by MLL oncoproteins (43). High levels of LEDGF/p75 autoantibodies were found in prostate cancer patients (44), and the level of the protein was found to be elevated in various human cancers (31). We reported recently the role of LEDGF/p75 in stress induced expression of VEGF-C in response to hyperthermia and oxidative stress and the contribution of a conserved STRE in the VEGF-C promoter in this stress induced expression (21).

As reported here, chromatin immunoprecipitation showed that LEDGF/p75 binds the VEGF-C promoter. Strong enhancement of this binding was observed following stimulation with FSH. Interestingly, no such enhancement was observed following LH stimulation, suggesting a different pattern of regulation regarding these two hormones. Down regulation of LEDGF/p75 by siRNA as well as mutations in the STRE binding site located in the VEGF-C promoter sequence resulted in an attenuated enhancement of the VEGF-C promoter following hormonal stimulation, emphasizing the contribution of LEDGF/p75 to the hormonally mediated VEGF-C activation. In vitro studies conducted in ES2 cells showed LH and FSH stimulation to increase both LEDGF/p75 mRNA and protein levels. LEDGF/p75 mRNA levels were measured at different time points following hormonal administration, starting from 6 hour stimulation in which an elevation in the LEDGF/p75 mRNA level was already detected. The chromatin immunoprecipitation data however, show FSH-induced binding to LEDGF/p75 as early as one hour following gonadotropin administration, suggesting that the initial stages of VEGF-C activation do not require de novo LEDGF/p75 mRNA synthesis. In accordance with the in vitro data, LEDGF/p75 mRNA levels were found to be elevated in ovariectomized tumor bearing mice, and the enhanced transcription could be blocked by treatment with Cetrorelix.

In summary, we showed here that enhanced LH and FSH stimulation, both in vitro or by ovariectomy, enhanced LEDGF/p75 dependent activation of VEGF-C expression, and resulted in enhanced lymphangiogenesis and angiogenesis of ovarian carcinoma tumors.

Acknowledgement

This work was supported by the USA NIH R01 CA75334, by the Israel Science Foundation 93/07 and the 7th Framework European Research Council Advanced grant 232640-IMAGO (MN). MN is incumbent of the Helen and Morris Mauerberger Chair.

References

  • 1.Mandai M, Konishi I, Kuroda H, Fujii S. LH/hCG action and development of ovarian cancer--a short review on biological and clinical/epidemiological aspects. Mol Cell Endocrinol. 2007;269:61–64. doi: 10.1016/j.mce.2006.11.014. [DOI] [PubMed] [Google Scholar]
  • 2.Parrott JA, Doraiswamy V, Kim G, Mosher R, Skinner MK. Expression and actions of both the follicle stimulating hormone receptor and the luteinizing hormone receptor in normal ovarian surface epithelium and ovarian cancer. Mol Cell Endocrinol. 2001;172:213–222. doi: 10.1016/s0303-7207(00)00340-3. [DOI] [PubMed] [Google Scholar]
  • 3.Syed V, Ulinski G, Mok SC, Yiu GK, Ho SM. Expression of gonadotropin receptor and growth responses to key reproductive hormones in normal and malignant human ovarian surface epithelial cells. Cancer Res. 2001;61:6768–6776. [PubMed] [Google Scholar]
  • 4.Lukanova A, Kaaks R. Endogenous hormones and ovarian cancer: epidemiology and current hypotheses. Cancer Epidemiol Biomarkers Prev. 2005;14:98–107. [PubMed] [Google Scholar]
  • 5.Choi JH, Choi KC, Auersperg N, Leung PC. Gonadotropins activate proteolysis and increase invasion through protein kinase A and phosphatidylinositol 3-kinase pathways in human epithelial ovarian cancer cells. Cancer Res. 2006;66:3912–3920. doi: 10.1158/0008-5472.CAN-05-1785. [DOI] [PubMed] [Google Scholar]
  • 6.Konishi I. Gonadotropins and ovarian carcinogenesis: a new era of basic research and its clinical implications. Int J Gynecol Cancer. 2006;16:16–22. doi: 10.1111/j.1525-1438.2006.00425.x. [DOI] [PubMed] [Google Scholar]
  • 7.Schiffenbauer YS, Abramovitch R, Meir G, et al. Loss of ovarian function promotes angiogenesis in human ovarian carcinoma. Proc Natl Acad Sci U S A. 1997;94:13203–13208. doi: 10.1073/pnas.94.24.13203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Thomas CM, Boss EA, Boonstra H, van Tienoven D, Sweep CG, Massuger LF. Gonadotropins and female sex steroid hormones in cyst fluid and serum from patients with ovarian tumors. Eur J Gynaecol Oncol. 2008;29:468–472. [PubMed] [Google Scholar]
  • 9.Van Trappen PO, Pepper MS. Lymphangiogenesis in human gynaecological cancers. Angiogenesis. 2005;8:137–145. doi: 10.1007/s10456-005-9008-7. [DOI] [PubMed] [Google Scholar]
  • 10.Fanti S, Nanni C, Castellucci P, et al. Supra-clavicular lymph node metastatic spread in patients with ovarian cancer disclosed at 18F-FDG-PET/CT: an unusual finding. Cancer Imaging. 2006;6:20–23. doi: 10.1102/1470-7330.2006.0005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gontier E, Wartski M, Guinebretiere JM, Alberini JL. 18F-FDG PET/CT in a patient with lymph node metastasis from ovarian adenocarcinoma. AJR Am J Roentgenol. 2006;187:W285–W289. doi: 10.2214/AJR.05.1483. [DOI] [PubMed] [Google Scholar]
  • 12.Sangoi AR, McKenney JK, Dadras SS, Longacre TA. Lymphatic vascular invasion in ovarian serous tumors of low malignant potential with stromal microinvasion: a case control study. Am J Surg Pathol. 2008;32:261–268. doi: 10.1097/PAS.0b013e318141fc7a. [DOI] [PubMed] [Google Scholar]
  • 13.Sundar SS, Zhang H, Brown P, et al. Role of lymphangiogenesis in epithelial ovarian cancer. Br J Cancer. 2006;94:1650–1657. doi: 10.1038/sj.bjc.6603144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Schoppmann SF, Horvat R, Birner P. Lymphatic vessels and lymphangiogenesis in female cancer: mechanisms, clinical impact and possible implications for anti-lymphangiogenic therapies (Review) Oncol Rep. 2002;9:455–460. [PubMed] [Google Scholar]
  • 15.Su JL, Yang PC, Shih JY, et al. The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells. Cancer Cell. 2006;9:209–223. doi: 10.1016/j.ccr.2006.02.018. [DOI] [PubMed] [Google Scholar]
  • 16.Ueda M, Hung YC, Terai Y, et al. Vascular endothelial growth factor-C expression and invasive phenotype in ovarian carcinomas. Clin Cancer Res. 2005;11:3225–3332. doi: 10.1158/1078-0432.CCR-04-1148. [DOI] [PubMed] [Google Scholar]
  • 17.Burton JB, Priceman SJ, Sung JL, et al. Suppression of prostate cancer nodal and systemic metastasis by blockade of the lymphangiogenic axis. Cancer Res. 2008;68:7828–7837. doi: 10.1158/0008-5472.CAN-08-1488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Shibata MA, Morimoto J, Shibata E, Otsuki Y. Combination therapy with short interfering RNA vectors against VEGF-C and VEGF-A suppresses lymph node and lung metastasis in a mouse immunocompetent mammary cancer model. Cancer Gene Ther. 2008;15:776–786. doi: 10.1038/cgt.2008.43. [DOI] [PubMed] [Google Scholar]
  • 19.Chen Z, Varney ML, Backora MW, et al. Down-regulation of vascular endothelial cell growth factor-C expression using small interfering RNA vectors in mammary tumors inhibits tumor lymphangiogenesis and spontaneous metastasis and enhances survival. Cancer Res. 2005;65:9004–9011. doi: 10.1158/0008-5472.CAN-05-0885. [DOI] [PubMed] [Google Scholar]
  • 20.Jeon BH, Jang C, Han J, et al. Profound but dysfunctional lymphangiogenesis via vascular endothelial growth factor ligands from CD11b+ macrophages in advanced ovarian cancer. Cancer Res. 2008;68:1100–1109. doi: 10.1158/0008-5472.CAN-07-2572. [DOI] [PubMed] [Google Scholar]
  • 21.Cohen B, Addadi Y, Sapoznik S, et al. Transcriptional regulation of vascular endothelial growth factor c by oxidative and thermal stress is mediated by lens epithelium-derived growth factor/p75. Neoplasia. 2009 doi: 10.1593/neo.09636. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nguyen TA, Boyle DL, Wagner LM, Shinohara T, Takemoto DJ. LEDGF activation of PKC gamma and gap junction disassembly in lens epithelial cells. Exp Eye Res. 2003;76:565–572. doi: 10.1016/s0014-4835(03)00049-6. [DOI] [PubMed] [Google Scholar]
  • 23.Shinohara T, Singh DP, Fatma N. LEDGF, a survival factor, activates stress-related genes. Prog Retin Eye Res. 2002;21:341–358. doi: 10.1016/s1350-9462(02)00007-1. [DOI] [PubMed] [Google Scholar]
  • 24.Wu X, Daniels T, Molinaro C, Lilly MB, Casiano CA. Caspase cleavage of the nuclear autoantigen LEDGF/p75 abrogates its pro-survival function: implications for autoimmunity in atopic disorders. Cell Death Differ. 2002;9:915–925. doi: 10.1038/sj.cdd.4401063. [DOI] [PubMed] [Google Scholar]
  • 25.Fatma N, Singh DP, Shinohara T, Chylack LT., Jr Transcriptional regulation of the antioxidant protein 2 gene, a thiol-specific antioxidant, by lens epithelium-derived growth factor to protect cells from oxidative stress. J Biol Chem. 2001;276:48899–48907. doi: 10.1074/jbc.M100733200. [DOI] [PubMed] [Google Scholar]
  • 26.Singh DP, Fatma N, Kimura A, Chylack LT, Jr., Shinohara T. LEDGF binds to heat shock and stress-related element to activate the expression of stress-related genes. Biochem Biophys Res Commun. 2001;283:943–955. doi: 10.1006/bbrc.2001.4887. [DOI] [PubMed] [Google Scholar]
  • 27.Singh DP, Kubo E, Takamura Y, et al. DNA binding domains and nuclear localization signal of LEDGF: contribution of two helix-turn-helix (HTH)-like domains and a stretch of 58 amino acids of the N-terminal to the trans-activation potential of LEDGF. J Mol Biol. 2006;355:379–394. doi: 10.1016/j.jmb.2005.10.054. [DOI] [PubMed] [Google Scholar]
  • 28.Shin JH, Piao CS, Lim CM, Lee JK. LEDGF binding to stress response element increases alphaB-crystallin expression in astrocytes with oxidative stress. Neurosci Lett. 2008;435:131–136. doi: 10.1016/j.neulet.2008.02.029. [DOI] [PubMed] [Google Scholar]
  • 29.Maertens GN, Cherepanov P, Engelman A. Transcriptional co-activator p75 binds and tethers the Myc-interacting protein JPO2 to chromatin. J Cell Sci. 2006;119:2563–2571. doi: 10.1242/jcs.02995. [DOI] [PubMed] [Google Scholar]
  • 30.Turlure F, Maertens G, Rahman S, Cherepanov P, Engelman A. A tripartite DNA-binding element, comprised of the nuclear localization signal and two AT-hook motifs, mediates the association of LEDGF/p75 with chromatin in vivo. Nucleic Acids Res. 2006;34:1653–1675. doi: 10.1093/nar/gkl052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Daugaard M, Kirkegaard-Sorensen T, Ostenfeld MS, et al. Lens epithelium-derived growth factor is an Hsp70-2 regulated guardian of lysosomal stability in human cancer. Cancer Res. 2007;67:2559–2567. doi: 10.1158/0008-5472.CAN-06-4121. [DOI] [PubMed] [Google Scholar]
  • 32.Huang TS, Myklebust LM, Kjarland E, et al. LEDGF/p75 has increased expression in blasts from chemotherapy-resistant human acute myelogenic leukemia patients and protects leukemia cells from apoptosis in vitro. Mol Cancer. 2007:6–31. doi: 10.1186/1476-4598-6-31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Dorward AM, Shultz KL, Beamer WG. LH analog and dietary isoflavones support ovarian granulosa cell tumor development in a spontaneous mouse model. Endocr Relat Cancer. 2007;14:369–379. doi: 10.1677/erc.1.01232. [DOI] [PubMed] [Google Scholar]
  • 34.Schiffenbauer YS, Meir G, Maoz M, Even-Ram SC, Bar-Shavit R, Neeman M. Gonadotropin stimulation of MLS human epithelial ovarian carcinoma cells augments cell adhesion mediated by CD44 and by alpha(v)-integrin. Gynecol Oncol. 2002;84:296–302. doi: 10.1006/gyno.2001.6512. [DOI] [PubMed] [Google Scholar]
  • 35.Tian X, Cong M, Zhou W, Zhu J, Liu Q. Relationship between protein expression of VEGF-C, MMP-2 and lymph node metastasis in papillary thyroid cancer. J Int Med Res. 2008;36:699–703. doi: 10.1177/147323000803600411. [DOI] [PubMed] [Google Scholar]
  • 36.Boone B, Blokx W, De Bacquer D, Lambert J, Ruiter D, Brochez L. The role of VEGF-C staining in predicting regional metastasis in melanoma. Virchows Arch. 2008;453:257–265. doi: 10.1007/s00428-008-0641-6. [DOI] [PubMed] [Google Scholar]
  • 37.Mattila MM, Ruohola JK, Karpanen T, Jackson DG, Alitalo K, Harkonen PL. VEGF-C induced lymphangiogenesis is associated with lymph node metastasis in orthotopic MCF-7 tumors. Int J Cancer. 2002;98:946–951. doi: 10.1002/ijc.10283. [DOI] [PubMed] [Google Scholar]
  • 38.Karpanen T, Egeblad M, Karkkainen MJ, et al. Vascular endothelial growth factor C promotes tumor lymphangiogenesis and intralymphatic tumor growth. Cancer Res. 2001;61:1786–1790. [PubMed] [Google Scholar]
  • 39.Hoshida T, Isaka N, Hagendoorn J, et al. Imaging steps of lymphatic metastasis reveals that vascular endothelial growth factor-C increases metastasis by increasing delivery of cancer cells to lymph nodes: therapeutic implications. Cancer Res. 2006;66:8065–8075. doi: 10.1158/0008-5472.CAN-06-1392. [DOI] [PubMed] [Google Scholar]
  • 40.Mandriota SJ, Jussila L, Jeltsch M, et al. Vascular endothelial growth factor-C-mediated lymphangiogenesis promotes tumour metastasis. Embo J. 2001;20:672–682. doi: 10.1093/emboj/20.4.672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Meirow D, Assad G, Dor J, Rabinovici J. The GnRH antagonist cetrorelix reduces cyclophosphamide-induced ovarian follicular destruction in mice. Hum Reprod. 2004;19:1294–1299. doi: 10.1093/humrep/deh257. [DOI] [PubMed] [Google Scholar]
  • 42.Arencibia JM, Bajo AM, Schally AV, Krupa M, Chatzistamou I, Nagy A. Effective treatment of experimental ES-2 human ovarian cancers with a cytotoxic analog of luteinizing hormone-releasing hormone AN-207. Anticancer Drugs. 2002;13:949–956. doi: 10.1097/00001813-200210000-00007. [DOI] [PubMed] [Google Scholar]
  • 43.Yokoyama A, Cleary ML. Menin critically links MLL proteins with LEDGF on cancer-associated target genes. Cancer Cell. 2008;14:36–46. doi: 10.1016/j.ccr.2008.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Daniels T, Zhang J, Gutierrez I, et al. Antinuclear autoantibodies in prostate cancer: immunity to LEDGF/p75, a survival protein highly expressed in prostate tumors and cleaved during apoptosis. Prostate. 2005;62:14–26. doi: 10.1002/pros.20112. [DOI] [PubMed] [Google Scholar]

RESOURCES