Skip to main content
Annals of Oncology logoLink to Annals of Oncology
. 2009 Jul 21;21(1):78–86. doi: 10.1093/annonc/mdp280

Genetic variations in angiogenesis pathway genes associated with clinical outcome in localized gastric adenocarcinoma

G Lurje 1,†, H Husain 1,†, D G Power 2, D Yang 3, S Groshen 3, A Pohl 1, W Zhang 1, Y Ning 1, P C Manegold 1, A El-Khoueiry 1, S Iqbal 1, L H Tang 4, M A Shah 2, H-J Lenz 1,3,*
PMCID: PMC2795613  PMID: 19622587

Abstract

Background: Angiogenesis has been attributed to be a well-recognized aspect of human cancer biology. As such, proteinase-activated receptor (PAR)-1, endostatin (ES) and interleukin-8 (IL-8) mediate the regulation of early-onset angiogenesis and in turn impact the process of tumor-growth and disease progression.

Patients and methods: Formalin-fixed paraffin-embedded tissues were obtained from 137 patients with localized gastric cancer at University of Southern California and Memorial Sloan-Kettering Cancer Center medical facilities. DNA was extracted and genotyping was carried out using PCR–restriction fragment length polymorphism-based protocols.

Results: In false discovery rate-adjusted univariate analysis, PAR-1 −506 ins/del (P < 0.001), ES +4349 G>A (P = 0.004), and IL-8 −251 T>A (P < 0.0001) were associated with time to tumor recurrence (TTR). Further, PAR-1 −506 ins/del and IL-8 −251 were associated with overall survival (OS). After adjusting for covariates, IL-8 remained significantly associated with TTR (adjusted P = 0.003) and OS (adjusted P = 0.049), whereas ES was significantly associated with TTR (adjusted P = 0.026).

Conclusions: Polymorphisms in PAR-1, ES, and IL-8 may serve as independent molecular prognostic markers in patients with localized gastric adenocarcinoma. The assessment of the patients’ individual risk on the basis of interindividual genotypes may therefore help to identify patient subgroups at high risk for poor clinical outcome.

Keywords: angiogenesis, gastric adenocarcinoma, IL-8, PAR-1, tumor recurrence

introduction

Gastric adenocarcinoma is the fourth most common type of cancer and the second leading cause of cancer-related death worldwide [1]. Despite recent improvements in the detection [1], surgical resection [2], and adjuvant (radio)-chemotherapy [3], the mortality of patients diagnosed with localized gastric cancer (GC) still remains high, with 5-year overall survival (OS) rates of 30% [4]. Traditionally, surgical resection has offered the best hope for prolonged survival; however, the extent of surgery continues to be a subject of ongoing debate [4]. Even though combined radiochemotherapy following complete gastric resection has been demonstrated to significantly improve OS and relapse-free survival [3], tumor recurrence after curative resection continues to be a significant problem in the management of patients with localized gastric adenocarcinoma [4]. Therefore, the development of molecular markers of prognosis as an adjunct to traditional staging systems will not only be helpful in identifying patients who are more likely to recur, but they will also be important to select patient-specific treatment strategies with the means of tailoring a targeted and effective therapy to the molecular profile of both the patient and his or her tumor while minimizing and avoiding life-threatening toxic effects.

Neovascularization and sustained tumor angiogenesis have been studied in GC and the so-called ‘angiogenic switch’, the induction of tumor vasculature are considered hallmarks of the malignant process and are required for tumor propagation and disease progression [5]. Although vascular endothelial growth factor (VEGF) and its downstream pathways have received considerable interest lately, pathways that regulate the switch to an angiogenic phenotype are not fully understood. Besides hypoxia-driven up-regulation of VEGF expression [6], a significant amount of evidence is accumulating supporting other mechanisms of neovascularization in vitro and in vivo [7, 8]. As such, tumor angiogenesis is not only dependent on tumor cells and VEGF signaling but also on platelet–endothelium interaction and interleukin-8 (IL-8) signaling. Platelets, in addition to their function in hemostasis, play an important role in wound healing and tumor growth, at least in part through the release of pro- and antiangiogenic factors; thus, platelets may modulate tumor angiogenesis by releasing not only promoters such as VEGF and epidermal growth factor (EGF) but also endostatin (ES), a potent endogenous antiangiogenic growth factor [9, 10]. In addition, recent evidence indicates that pro- and antiangiogenic proteins are segregated into different sets of α-granules within platelets. Interestingly, proteinase-activated receptors (PARs) have been shown to differentially counter-regulate the local release of VEGF and its antiangiogenic counterpart ES (ES) [8, 9]. Therefore, it has been proposed that these PARs play a pivotal role in the regulation of local and early-onset angiogenesis and in turn may influence the process of tumor growth and disease progression [8]. In addition, IL-8 has been reported to play a major role in VEGF-independent tumor angiogenesis. As such, overexpression of IL-8 is frequently observed in GC [11] and induction of IL-8 preserved the angiogenic phenotype in hypoxia inducible factor 1-α (HIF1-α) deficient colon cancer cells, suggesting a critical role of IL-8 in tumor-associated angiogenesis, independent of VEGF [12]. Based on these data, we hypothesized that functional VEGF, VEGFR2, EGF, EGFR, PAR-1, ES, IL-8 and CXRC2 polymorphisms could be associated with differences in clinical outcome in patients with localized gastric adenocarcinoma.

patients and methods

patients

One hundred and thirty-seven (n = 137) patients with localized (stage Ib–IV) gastric adenocarcinoma who were treated with surgery alone or surgery and adjuvant (radio)-chemotherapy, at the University of Southern California/Norris Comprehensive Cancer Center (USC/NCCC), the Los Angeles County/University of Southern California Medical Center, or the Memorial Sloan-Kettering Cancer Center/Cornell University from 1992 to 2008, were eligible for the present study. This study was conducted at USC/NCCC and approved by the Institutional Review Boards of the University of Southern California and Cornell University for Medical Sciences. Patient data were collected through chart review. All patients involved in the study signed informed consent for the analysis of molecular correlates. Detailed clinicopathological characteristics are shown in Table 1.

Table 1.

Clinicopathological characteristics and clinical outcome

n Time to recurrence
Overall survival
Median time to recurrence, years (95% CI) Relative risk, (95% CI) P valuea Median overall survival, years, (95% CI) Relative risk, (95% CI) P valuea
Age, years 0.42 0.65
    <60 80 2.2 (1.5–14.5+) 1 4.7 (3.8–14.6+) 1
    ≥60 57 3.7 (2.1–12.3+) 0.81 (0.48–1.36) 4.5 (3.3–7.3) 1.14 (0.64–2.05)
Gender 0.85 0.32
    Male 83 2.3 (1.8–7.0) 1 4.1 (3.3–7.3) 1
    Female 54 7.0 (1.5–8.3+) 0.95 (0.56–1.63) 7.3 (3.8–8.3+) 0.72 (0.37–1.39)
Ethnicity 0.085 0.040
    Caucasian 63 1.7 (1.2–4.4) 1 3.8 (2.7–5.5) 1
    African-American 1 0.5b – 0.5b –
    Asian 28 7.0 (2.3–14.5+) 0.45 (0.23–0.91) 7.3 (3.3–14.6+) 0.45 (0.20–1.03)
    Hispanic 45 3.7 (2.1–10.7+) 0.63 (0.34–1.17) 10.7+ (3.6–10.7+) 0.36 (0.15–0.85)
Tumor stage 0.030
    I 12 4.3+ (2.2–4.3+) 1 4.4b – 0.32
    II 36 7.0 (2.9–10.7+) 1.56 (0.35–6.98) 5.4 (4.1–10.7+) 1
    III 71 1.8 (1.4–2.8) 3.24 (0.78–13.5) 3.8 (2.8–7.3) 1.31 (0.69–2.50)
    IV 18 1.6 (1.2–3.8+) 4.00 (0.86–18.5) 7.3b (1.4–7.3+) 1.33 (0.43–4.09)
T category 0.013 0.30
    T1c 4
    T2c 44 8.3b (2.9–8.3+) 1 5.4 (4.1–8.3+) 1
    T3d 79 1.7 (1.4–4.4) 2.04 (1.14–3.67) 4.5 (3.3–7.3) 1.40 (0.73–2.68)
    T4d 10
N category 0.004 0.088
    N0 27 7.0 (1.8–10.7+) 1 7.3 (3.4–10.7+) 1
    N1 64 4.4 (2.2–14.5+) 0.99 (0.47–2.11) 5.5 (4.1–14.6+) 1.07 (0.46–2.47)
    N2 31 1.3 (1.1–2.3) 2.62 (1.15–5.94) 3.3 (2.0–5.7+) 2.27 (0.85–6.07)
    N3 15 1.6 (1.0–3.8+) 1.96 (0.73–5.32) 2.4 (1.1–3.8+) 2.35 (0.66–8.41)
ECOG performance status 0.77 0.25
    0 62 2.5 (1.7–10.7+) 1 4.5 (2.8–10.7+) 1
    1 65 2.3 (1.6–14.5+) 1.00 (0.60–1.68) 5.7 (3.8–14.6+) 0.68 (0.37–1.25)
    2 10 2.2+ (1.7–2.2+) 0.60 (0.14–2.53) 2.2b (1.2–2.2+) 1.67 (0.36–7.75)
Tumor differentiation 0.15 0.098
    Moderate 27 2.1 (1.1–3.8+) 1 4.1 (2.7–4.7) 1
    Poor/moderated 10 3.7 (2.1–14.5+) 0.65 (0.36–1.19) 7.3 (3.8–14.6+) 0.59 (0.31–1.13)
    Poord 97
Lauren classification 0.87 0.74
    Diffuse 40 3.7 (1.8–8.9+) 1 7.3 (5.4–8.9+) 1
    Intestinal 50 7.0 (2.1–14.5+) 0.87 (0.45–1.67) 5.7 (3.8–14.6+) 1.10 (0.48–2.51)
    Mixed 21 12.3b (1.7–12.3+) 1.04 (0.45–2.41) 3.6 (1.9–12.3+) 1.52 (0.51–4.58)
Type of chemotherapy 0.003 0.004
    5-FU/LV 70 7.0 (2.8–10.6+) 1 7.3 (4.1–10.6+) 1
    5-FU/LV/oxaliplatin 19 1.6 (1.1–2.9) 2.66 (1.23–5.76) 2.4 (1.2–4.5+) 4.24 (1.69–10.6)
    5-FU, cisplatin, CPT11 25 1.7 (1.2–14.5+) 1.46 (0.71–3.01) 4.1 (2.2–14.6+) 1.36 (0.59–3.12)
    None 23 2.1 (0.8–2.5) 2.80 (1.48–5.27) 4.5 (2.8–5.5) 2.27 (1.09–4.74)
Radiation 0.92 0.68
    Yes 88 2.5 (1.8–14.5+) 1 4.5 (3.3–14.6+) 1
    No 48 3.7 (1.7–12.3+) 1.03 (0.60–1.76) 5.4 (3.8–12.3+) 0.89 (0.48–1.63)
a

Based on log-rank test

b

Estimates were not reached.

c,d

Grouped together for the estimates of relative risk.

CI, confidence interval; ECOG, Eastern Cooperative Oncology Group; 5-FU, 5-fluorouracil; LV, Leucovorin; CPT11, inrinotecan; –, no events occurred and estimates were not obtained.

candidate polymorphisms

The polymorphisms we tested were selected by a VEGF and EGFR pathway approach with the goal of selecting genes known to modulate tumor-associated angiogenesis (Table 2). We used the following criteria to select genes for study that (i) the gene be part of a pathway for which there is a credible scientific basis to support its involvement in tumor angiogenesis; (ii) the gene has an established, well-documented genetic polymorphism; (iii) the frequency of the polymorphism is high enough that its impact on clinical outcome will be meaningful; and/or (iv) the polymorphism has some degree of likelihood to alter the function of the gene in a biologically relevant manner.

Table 2.

Analyzed polymorphisms and their functional significance

Polymorphism Location Minor allele frequencya Function Clinical significance Reference
VEGF +936 C>T (rs3025039) 3′-UTR 15%–20% (T) T allele: ↓ VEGF plasma levels Activator of angiogenesis [13]
Associated with colon cancer tumor recurrence
VEGF −634 G>C (rs2010963) 5′-UTR 20%–35% (C) C allele: ↑ VEGFA plasma levels Activator of angiogenesis [14]
Associated with prognosis in colon cancer
VEGFR2 +4422 (AC)11–14 (rs5858315) Intron 2 20%–35% (12) Length of AC microsatellite repeat correlates inversely with EGFR gene transcription Activator of angiogenesis [15]
Associated with prognosis in colon cancer
EGF +61 A>G (rs4444903) 5′-UTR 30%–55% (A) A allele: ↓ EGF serum levels Associated with PFS in CRC [16]
EGFR +497 G>A (rs11543848) Codon 497 25%–35% (A) A allele: ↓ EGFR ligand binding, growth stimulation, tyrosine kinase activation Associated with rectal cancer tumor recurrence [17]
EGFR (CA)14–23 (rs45608036) Intron 1 25%–30% (≥20) Length of CA microsatellite repeat correlates inversely with EGFR gene transcription Associated with rectal cancer tumor recurrence [17]
IL-8 −251 T>A (rs4073) 3′-UTR 35%–40% (A) A allele: ↑ IL-8 plasma levels Mediator of VEGF independent angiogenesis [13]
Associated with colon cancer tumor recurrence
Overexpressed in gastric cancer
CXCR2 +785 C>T (rs2230054) Exon 3 30%–50% (C) C allele: ↑ PFS in ovarian cancer IL-8 receptor [18]
Associated with PFS in ovarian cancer
PAR-1 −506 ins/del (rs11267092) Promoter 15%–25% (Ins) Ins allele: ↑ Ets-protein-binding sites and gene transcription Activator of angiogenesis [8, 19]
Regulates the local release of VEGF and endostatin
PAR-1 ivs −14 A>T (rs168753) Intron 1 10%–20% (T) T allele: ↓ expression of PAR-1 Activator of angiogenesis [8, 20]
Regulates the local release of VEGF and endostatin
Endostatin +4349 G>A (rs12483377) Exon 42 5%–20% (A) A allele: ↓ binding to other molecules Potent inhibitor of angiogenesis [21]
A allele: ↓ ability to inhibit angiogenesis Associated with prostate and breast cancer risk
a

Minor alleles are indicated in parentheses.

VEGF, vascular endothelial growth factor; UTR, untranslated region; VEGFR, vascular endothelial growth factor receptor; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; PFS, progression free survival; CRC, colorectal cancer; IL-8, interleukin-8, CXCR2, chemokine receptor 2 (interleukin-8 receptor); Ets-protein, erythroblastosis virus protein; PAR-1, proteinase-activated receptor 1 (thrombin receptor).

genotyping

Formalin-fixed paraffin-embedded normal tissues were collected and genomic DNA was extracted using the QIAamp extraction kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. The majority of the samples were tested using a PCR-based restriction fragment length polymorphism or a 5′-end 33p γATP-labeled PCR technique, as previously described [13, 16]. Primers, restriction enzymes, and annealing temperatures are listed in Table 3. For quality assurance purposes, a total of 10% positive and negative duplicate controls were matched for each polymorphism and were analyzed by direct DNA sequencing where applicable. Genotype concordance was ≥99%.

Table 3.

Primer sequences, annealing temperatures, and restriction enzymes

Gene Forward primer (5′–3′) Reverse primer (5′–3′) Enzyme Annealing, °C
VEGF +936 C>T AAGGAAGAGGAGACTCTGCGCAGAGC TAAATGTATGTATGTGGGTGGGTGTGTCTACAGG NlaIII 60
VEGF−634 G>C GGATTTTGGAAACCAGCAGA GTCACTCACTTTGCCCCTGT Seq. 60
VEGFR-2(AC)n repeat GCTTGTAGTAATTGTTCATAAGTGG GAGCGTATGTCTACTATACGCCA n.a. 60
EGF+61 A>G CATTTGCAAACAGAGGCTCA TGTGACAGAGCAAGGCAAAG AluI 60
EGFR+497 G>A TGCTGTGACCCACTCTGTCT CCAGAAGGTTGCACTTGTCC BstNI 60
EGFR(CA)13–24 repeat ACCCCAGGGCTCTATGGGAA TGAGGGCACAAGAAGCCCCT n.a. 60
IL8T-251A TTGTTCTAACACCTGCCACTCT GGCAAACCTGAGTCTCACA MfeI 60
CXCR2C+785T CATCTTTGCTGTCGTCCTCA CTGTGAAGGATGCCCAGAAT Seq. 60
PAR-1−506 ins/del ACTGTCTGAGTCATCCACTC ATCGCGATCGGCTGTCAGTCC n.a. 60
PAR-1ivs −14 A>T GCTGCACTCTGCTTGTCGCTTTT TAAATGTATGTATGTGGGTGG MseI 60
Endostatin+4349 G>A GGCACGCATCTTCTCCTTT CTCTCAGAGCTGCTCACACG MseI 60

VEGF, vascular endothelial growth factor; VEGFR2, vascular endothelial growth factor receptor 2; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; IL-8, interleukin-8; CXCR2, chemokine receptor 2; PAR-1, proteinase-activated receptor.

statistical analysis

The primary end point in this study was time to tumor recurrence (TTR) in localized gastric adenocarcinoma patients, which was defined as the period from the date of diagnosis of GC to the date of first recurrence or until last contact if the patient was free of any tumor recurrence at the time of last contact. If a patient had not recurred, then TTR was censored at the time of the last follow-up or death. The secondary end point was OS that was defined as the period from diagnosis to death from any cause or the last contact if the patient was alive.

The association between each polymorphism and time to recurrence and OS was examined using Kaplan–Meier curves and log-rank test. For polymorphisms with a genotype frequency (homozygous minor allele) of <10%, the associations between genotypes and clinical outcome were analyzed in a dominant model. Otherwise, they were analyzed in a codominant or additive model. The distributions of polymorphisms across demographic characteristics were examined using Fisher's exact test. In the univariate survival analysis, the Pike estimate of relative risk (RR) and its associated 95% confidence interval (CI) was based on the log-rank test.

The Benjamini and Hochberg method was used to control the false discovery rate (FDR) of multiple testing [16]. In the univariate analysis, an FDR-adjusted P value of <0.05 was employed to select polymorphisms as candidates for inclusion in the multivariable models. With 137 patients, we would have 80% power to detect a minimum hazard ratio ∼2.0 across a range of common allele frequencies (0.2–0.5) for time to recurrence in a dominant model. For a recessive model, a minimum hazard ratio is <3.8 when the allele frequency is 0.2 and approaches 2 when the allele frequency is 0.5.

The Cox proportional hazards regression model with stratification factors (ethnicity, T category, N category, and type of adjuvant chemotherapy) was fitted to re-evaluate the association between polymorphisms and TTR and OS considering the imbalances in the distributions of baseline characteristics. The level of significance was set to P <0.05 and P values are given for two-sided testing. Analyses were carried out using the SAS statistical package version 9.1 (SAS Institute Inc., Cary, NC).

results

A total of 137 patients with localized adenocarcinoma of the stomach (stage Ib–IV) were included in this analysis. The median follow-up was 3.3 years. Sixty-one of 137 patients (45%) had tumor recurrence, with a probability of 3-year recurrence of 0.52 ± 0.05. The median TTR was 2.8 years (95% CI 2.1–7.0). Fifty-five of 137 (40%) patients showed recurrent disease within the first 3 years after surgery. Forty-five of 137 patients (33%) have died and the median OS for the cohort is 4.7 years (95% CI 3.8–7.3). T category (P = 0.013), N category (P = 0.004), and type of chemotherapy (P = 0.003) were significantly associated with TTR, whereas ethnicity of the patient (P = 0.04) and type of chemotherapy (P = 0.004) were additionally associated with OS. Detailed clinicopathological characteristics are shown in Table 1. Polymorphisms of PAR-1, ES, and IL-8 were not associated with demographic (age, gender, and ethnicity), clinical [type of (radio)-chemotherapy], or pathological characteristics (tumor grade, T category, and N category). There were no differences in allelic frequencies of PAR-1, ES, and IL-8 across ethnic groups (data not shown).

PAR-1 −506 ins/del (rs11267092) and clinical outcome in localized gastric adenocarcinoma

Genotyping for PAR-1 −506 ins/del was successful in 136 (99%) of 137 cases. In the other one patient (1%), genotyping was not successful because of limited quantity of extracted genomic DNA. Patients with the PAR-1 −506 ins/ins or ins/del genotype had a median TTR of 1.5 years (95% CI 1.1–2.3 years), compared with 7.0 years (95% CI 2.3–14.5+ years) in patients homozygous (del/del) for the −506-deletion allele (P < 0.001, log-rank test) (Table 4). For PAR-1 −506 ins/del, the FDR-adjusted P values did meet the criteria for variable selection as a candidate predictor in the multivariable TTR (FDR-adjusted P value = 0.002) and OS model (FDR-adjusted P value = 0.027) (Figures 1A and 2A, Table 4).

Table 4.

Polymorphisms and clinical outcome in localized gastric adenocarcinoma

n Time to recurrence
Overall survival
Median time to recurrence, years (95% CI) Relative risk, (95% CI) P valuea Median overall survival, years (95% CI) Relative risk (95% CI) P valuea
VEGF +936 C>T (rs3025039) 0.86 (0.87) 0.72 (0.85)
    C/C 80 2.9 (1.7–7.0) 1 4.5 (3.3–7.3) 1
    C/Td 51 2.3 (1.7–12.3+) 1.05 (0.62–1.76) 4.7 (3.4–12.3+) 0.90 (0.48–1.67)
    T/Td 6
VEGF −634 G>C (rs2010963) 0.80 (0.87) 0.15 (0.45)
    G/G 59 2.3 (1.7–7.0) 1 5.4 (3.4–7.3) 1
    G/C 55 2.9 (1.7–14.5+) 0.84 (0.48–1.48) 4.7 (3.8–14.6+) 0.83 (0.43–1.59)
    C/C 22 2.5 (1.7–8.3+) 1.02 (0.50–2.09) 2.8 (2.0–8.3+) 1.86 (0.81–4.28)
VEGFR2 +4422 (AC)11–14 (rs5858315) 0.49 (0.87) 0.26 (0.45)
    11/10c 1
    11/11c 62 2.5 (1.7–10.7+) 1 4.5 (2.8–10.7+) 1
    11/12d 62 3.7 (1.7–14.5+) 0.84 (0.51–1.39) 5.7 (3.8–14.6+) 0.72 (0.40–1.30)
    12/12d 12
EGF +61 A>G (rs4444903) 0.43 (0.87) 0.85 (0.85)
    A/A 23 8.3b (1.7–8.3+) 1 8.3b (2.0–8.3+) 1
    A/G 79 2.2 (1.5–4.4) 1.70 (0.72–4.01) 4.7 (3.6–14.6+) 0.80 (0.35–1.84)
    G/G 35 7.0 (2.1–7.0+) 1.41 (0.55–3.63) 4.1 (3.3–7.3+) 0.89 (0.34–2.29)
EGFR +497 G>A (rs11543848) 0.87 (0.87) 0.77 (0.85)
    G/G 60 2.2 (1.4–12.3+) 1 4.5 (3.3–12.3+) 1
    G/A 53 2.8 (2.1–7.0) 0.88 (0.50–1.55) 4.7 (3.3–7.3) 0.90 (0.48–1.72)
    A/A 24 2.2 (1.5–14.5+) 1.03 (0.51–2.09) 5.7 (2.8–14.6+) 0.73 (0.31–1.74)
EGFR (CA)13–24 repeat (rs45608036) 0.64 (0.87) 0.64 (0.85)
    Both (CA)n <20 54 2.1 (1.3–12.3+) 1 4.1 (3.3–7.3) 1
    One (CA)n ≥20 58 2.3 (2.1–14.5+) 0.83 (0.48–1.45) 5.5 (3.8–14.6+) 0.74 (0.39–1.40)
    Both (CA)n ≥20 23 2.9 (1.7–7.0+) 0.72 (0.33–1.53) 4.5 (2.8–7.0+) 0.80 (0.32–1.98)
IL-8 −251 T>A (rs4073) <0.0001 (<0.0001) <0.0001 (<0.0001)
    T/T 50 14.5b 1 14.6b (5.7–14.6+) 1
    T/A 66 2.2 (1.5–3.2) 3.97 (1.83–8.58) 3.8 (3.3–7.3) 5.06 (1.80–14.2)
    A/A 21 1.1 (0.8–1.7) 9.51 (3.94–22.9) 2.4 (1.4–4.7) 10.70 (3.42–33.5)
CXCR2 + 785 C>T (rs2230054) 0.69 (0.87) 0.27 (0.45)
    C/C 37 4.4 (1.7–14.5+) 1 7.3 (4.5–14.6+) 1
    C/T 80 2.3 (1.7–7.0+) 1.14 (0.62–2.08) 3.8 (3.3–7.3+) 1.66 (0.81–3.44)
    T/T 19 3.7 (0.8–8.3+) 1.44 (0.61–3.37) 5.4 (3.8–8.3+) 1.07 (0.34–3.37)
PAR-1 −506 ins/del (rs11267092) <0.001 (0.002) 0.005 (0.027)
    Del/del 91 7.0 (2.3–14.5+) 1 7.3 (4.5–14.6+) 1
    Ins/delc 34 1.5 (1.1–2.3) 2.40 (1.45–3.99) 3.6 (2.5–4.5) 2.26 (1.25–4.06)
    Ins/insc 11
PAR-1 ivs −14 A>T (rs168753) 0.79 (0.87) 0.29 (0.45)
    A/A 84 2.8 (1.8–7.0) 1 5.4 (3.4–7.3) 1
    A/T 33 2.3 (1.5–7.0+) 1.02 (0.56–1.86) 4.5 (3.3–7.0+) 1.07 (0.52–2.24)
    T/T 15 14.5b (1.5–14.5+) 0.76 (0.30–1.91) 14.6b (2.0–14.6+) 0.42 (0.13–1.36)
Endostatin +4349 G>A (rs12483377) 0.004 (0.015) 0.17 (0.45)
    G/G 115 3.7 (2.1–14.5+) 1 5.5 (4.1–14.6+) 1
    G/Ac 18 1.2 (0.8–3.2) 2.28 (1.26–4.11) 3.8 (2.0–6.8) 1.62 (0.79–3.30)
    A/Ac 4
a

Nominal P values based on log-rank test with FDR-adjusted P values (<5%) shown in parentheses.

b

Estimates were not reached.

c,d

Polymorphisms with a genotype frequency (homozygous minor allele) of <10% were grouped together in a dominant model.

CI, confidence interval; VEGF, vascular endothelial growth factor; VEGFR2, vascular endothelial growth factor receptor 2; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; IL-8, interleukin-8; CXCR2, chemokine receptor 2; PAR-1, proteinase-activated receptor.

Figure 1.

Figure 1.

Time to recurrence of patients with localized gastric cancer by (A) PAR-1 −506 ins/del, (B) endostatin +4349 G>A, (C) IL-8 −251 T>A, and (D) combination analysis. Vertical hash marks indicate the time of last follow-up for those patients who have not recurred or died at the time of the analysis of data. All censored patients and those who showed tumor recurrence are accounted for. IL-8, interleukin-8; PAR-1, proteinase-activated receptor.

Figure 2.

Figure 2.

Overall survival of patients with localized gastric cancer by (A) PAR-1 −506 ins/del and (B) IL-8 −251 T>A. Vertical hash marks indicate the time of last follow-up for those patients who have not died at the time of the analysis of data. All censored patients and those who died are accounted for. IL-8, interleukin-8; PAR-1, proteinase-activated receptor.

ES +4349 G>A (rs12483377) and TTR in localized gastric adenocarcinoma

Genotyping for ES +4349 G>A was successful in 137 (100%) of 137 cases. Patients with the ES +4349 A/A or G/A genotype had a median TTR of 1.2 years (95% CI 0.8–3.2 years), compared with 3.7 years (95% CI 2.1–14.5+ years) in patients homozygous for the G allele (P = 0.004, log-rank test) (Table 4). For ES +4349 G>A, the FDR-adjusted P value did meet the criteria for variable selection as a candidate predictor in the multivariable TTR model (Figure 1B, Table 4) (FDR-adjusted P value = 0.015).

IL-8 −251 T>A (rs4073) and clinical outcome in localized gastric adenocarcinoma

Genotyping for IL-8 −251 T>A was successful in 137 (100%) of 137 cases. Patients with the IL-8 −251 A/A genotype had a median TTR of 1.1 years (95% CI 0.8–1.7 years), compared with 2.2 years (95% CI 1.5–3.2 years) and 14.5+ years (95% CI: reference) for those heterozygous (T/A) and homozygous (T/T) for the 251 T allele, respectively (P < 0.0001, log-rank test) (Table 4). For IL-8 −251 T>A, the FDR-adjusted P values did meet the criteria for variable selection as a candidate predictor in the multivariable TTR (FDR-adjusted P value < 0.0001) and OS (FDR-adjusted P value < 0.0001) model (Figures 1C and 2B, Table 4).

multivariable analysis of PAR-1 −506 ins/del (rs11267092), ES +4349 G>A (rs12483377), and IL-8 −251 T>A (rs4073) and TTR and OS

When we analyzed PAR-1 −506 ins/del (adjusted P value = 0.57), ES +4349 G>A (adjusted P value = 0.026), and IL-8 −251 T>A (adjusted P value = 0.003) jointly, stratified by ethnicity, T category, N category, and type of adjuvant chemotherapy, polymorphisms in IL-8 and ES remained significantly associated with TTR. In addition, IL-8 −251 T>A remained significantly associated with OS (adjusted P value = 0.049) (Table 5). We observed consistent patterns in the associations between PAR-1 −506, ES, and IL-8 −251 polymorphisms and clinical outcome within subsets of patients by race, T category, N category, and type of chemotherapy (data not shown). Patients with 0 unfavorable alleles (PAR-1 −506 insertion allele, ES +4349 A allele, IL-8 A allele) were at lowest risk to develop tumor recurrence (95% CI: 1 reference), compared with patients displaying 1 (RR 9.74, 95% CI 1.22–77.6) and ≥2 (RR 13.7, 95% CI 1.68–111.0) unfavorable alleles, who were more likely to develop tumor recurrence (adjusted P > 0.0001) (Table 5, Figure 1D).

Table 5.

Multivariable analysis of IL-8 −251 T>A, PAR-1 −506 ins/del, and endostatin +4349 G>A and clinical outcome

Time to recurrence
Overall survival
Model 1a
Model 2a
Model 1a
Model 2a
Adjusted RR (95% CI)b Adjusted P valueb Adjusted RR (95% CI)b Adjusted P valueb Adjusted RR (95% CI)b Adjusted P valueb Adjusted RR (95% CI)b Adjusted P valueb
IL-8 −251 T>A (rs4073) 3.06 (1.50–6.24) 0.002 3.36 (1.53–7.38) 0.003 2.45 (1.02–5.88) 0.045 2.28 (0.93–5.59) 0.049
PAR-1 −506 ins/del (rs11267092) 2.25 (0.91–5.54) 0.079 1.32 (0.50–3.51) 0.57 1.93 (0.68–5.49) 0.22 1.51 (0.52–4.41) 0.45
Endostatin +4349 G>A (rs12483377) 2.30 (1.01–6.04) 0.047 2.71 (1.12–6.55) 0.026 1.00 (0.35–2.87) 1.00 0.99 (0.33–2.91) 0.98
Combined
    0 unfavorable – 1 (Reference) – –
    1 unfavorable 9.74 (1.22–77.6) 0.003
    ≥2 unfavorable 13.7 (1.68–111.0)
a

In all, 136 patients with complete data of three polymorphisms were included in the models. Both Model 1 and model 2 were stratified by race, T category, N category, and type of chemotherapy. One polymorphism was included in model 1, and three polymorphisms were included in model 2.

b

Based on the Wald test of Cox proportional hazards model.

RR, relative risk; CI, confidence interval; IL-8, interleukin-8; PAR-1, proteinase-activated receptor; –, estimates were not reached.

analysis of other tested germline polymorphisms involved in the tumor angiogenesis pathway

We did not observe statistically significant associations between other tested genes involved in tumor angiogenesis pathway and TTR and OS (Table 4).

discussion

Tumor angiogenesis is driven locally by the release of pro- and antiangiogenic factors, such as VEGF and ES. It is well established that platelets stimulate endothelial cells in culture and can promote the assembly of capillary-like structures in vitro [10, 22]. Accordingly, the proximity to and interaction with the endothelium allows platelets to profoundly influence tumor development [23]. As such, platelet–endothelium interaction modulates the angiogenic balance of the tumor and it has been suggested that platelets may contribute to these angiogenesis-dependent processes at least in part through the local release of pro- and antiangiogenic factors [10, 24]. A recent study by Italiano et al. [9] demonstrated that two distinct populations of α-granules containing endogenous angiogenic regulatory proteins are present in platelets and indicate that this subcellular organization is facilitating the differential release of these proteins in response to platelet–endothelial interaction.

Activation of platelets by thrombin is mediated through the cleavage of PARs, a receptor family of G-coupled proteins with seven transmembrane proteins [25]. Four distinct PARs have been identified, with PAR-1, PAR-3, and PAR-4 acting as receptors for thrombin. Interestingly, tumors may modulate PAR activity and its own angiogenic properties through the release of proteases that can either activate or disarm these receptors. In fact, a recent study by Ma et al. [8] revealed that PAR-1 and PAR-4 act in a counter-regulatory manner to influence the local release of VEGF and ES from platelets and as such may profoundly influence tumor neovascularization. Activation of the thrombin/PAR-1 receptor axis triggers multiple signaling pathways that result in endothelial cell survival, apoptosis, and angiogenesis [26, 27]. In addition, overexpression of PAR-1 mRNA and protein was found to correlate with invasive properties of colorectal cancer, breast cancer and, GC [7, 28]. DNA sequence variations within the PAR-1 gene may modulate PAR-1 production and/or activity. Among those, a 13-bp insertion/deletion polymorphism (PAR-1 −506 ins/del; rs11267092) has been identified, repeating the preceding 5′-CGGCCGCGGGAAG-3′ sequence at position −506 within the promoter region of the PAR-1 gene [29]. Interestingly, a potential recognition site (5′-GCGGGAAGC-3′) for activating Ets protein (erythroblastosis virus protein, family of transcription factors) has been identified within the polymorphic 13-bp sequence at position −506 [29]. Ets proteins play a major role in the formation of the transcriptional initiation complex in genes lacking the canonical TATA box sequence, such as the PAR-1 gene promoter [29]. Because the PAR-1 −506 ins/del polymorphism duplicates a putative binding site for Ets-1/Ets-2 and is located within the active part of the promoter, it may regulate the transcription of the PAR-1 gene [19]. Higher serum levels of ES, a potent endogenous inhibitor of angiogenesis, induce the regression of tumor growth and angiogenesis in vivo [30]. Furthermore, Down syndrome patients, who have higher serum levels of ES due to three instead of two gene copies, have a decreased incidence of solid tumors, including gastric adenocarcinoma [31]. ES +4349 G>A (rs12483377), a polymorphism located within exon 42, has been associated (A/A genotype) with increased prostate cancer risk and impaired function of ES [21]. In our study, ‘high-expression’ variants of PAR-1 −506 ins/del (ins/ins) and ‘low-expression’ variants of ES +4349 G>A were found to be significantly associated with TTR in FDR-adjusted univariate analysis (Table 4, Figure 1A and B). In addition, ES +4349 G/A showed to be an independent prognostic marker for TTR after adjustment for covariates in the multivariable model. Our findings demonstrate for the first time that PAR-1 −506 ins/del and ES +4349 G>A may be important prognostic factors for GC progression.

VEGF-driven tumor angiogenesis has been recognized to play a fundamental role in GC pathogenesis. However, progression into advanced and recurrent gastric adenocarcinoma has also been associated with activation of VEGF-independent cascades, such as the IL-8-signaling pathway [12]. As such, IL-8 participates in the pathogenesis and maintenance of several human malignancies, including GC [12]. IL-8 exerts its potent angiogenic properties on endothelial cells through interaction with its receptors chemokine receptor (CXCR) 1 and CXCR2 [32, 33] and induction of IL-8 preserved the angiogenic phenotype in HIF1-α-deficient colon cancer cells, suggesting a critical role of IL-8 in tumor-associated angiogenesis, independently of VEGF [12]. Interestingly, GC cells derived from surgical specimens of human GCs overexpress IL-8 compared with corresponding normal mucosa, and the level of IL-8 mRNA expression has been shown to directly correlate with the vascularity of the tumor. Furthermore, Kitadai et al. [11] demonstrated that transfection of GC cells with the IL-8 gene enhanced their tumorigenic and angiogenic potential in the gastric wall of nude mice . Polymorphisms in the IL-8 gene were studied for associations with inflammatory diseases and cancers [12]. Among these, the IL-8 −251 T>A polymorphism (rs4073), located −251 nucleotides relative to the transcriptional start site of the gene, affects its expression. In fact, the variant A allele of rs4073 has been associated with increased IL-8 plasma levels [34] and further functional studies including promoter assays confirmed the functional significance of the IL-8 −251 T>A polymorphism [35]. Recently, the IL-8 −251 A allele was reported to be associated with an increased risk of developing GC [35, 36]. As previously demonstrated by our group, IL-8 −251 T>A and its receptor CXCR-1 were associated with TTR and progression-free survival in colorectal [13, 37] and ovarian cancer [18]. In our study, high-expression variants of IL-8 −251 T>A (A/A) were found to be significantly associated with TTR and OS in both FDR-adjusted univariate and multivariable analysis (Tables 4 and 5, Figures 1C and 2B), supporting our hypothesis that increased angiogenic potential is critical for GC tumor relapse.

In summary, our study did not show significant associations of VEGF- and EGF-signaling genes and clinical outcome. This may be explained by a low ‘disease-specific’ significance of these genetic variants in this particular malignancy and/or clinical setting. Nevertheless, consistent with our hypothesis, high-expression variants of PAR-1 −506 ins/del (ins/ins) and IL-8 −251 T>A (A/A), as well as low-expression variants of ES +4349 G>A (A/A) were associated with decreased TTR in FDR-adjusted univariate analysis. After adjusting for covariates in the multivariable models, IL-8 −251 T>A and ES +4349 G>A were independently associated with TTR. In addition, IL-8 −251 T>A was independently associated with OS, suggesting that the assessment of the patients’ angiogenic potential on the basis of PAR-1, ES, and IL-8 genotypes might further enhance targeted treatment not only by the identification of patients at high risk but also by identifying novel targets for antiangiogenic treatment strategies. Interestingly, targeted agents against PAR-1 and IL-8 as well as recombinant ES are in different stages of preclinical and clinical development. Larger and prospective biomarker-embedded clinical trials are needed to confirm our preliminary findings.

funding

National Institutes of Health (5 P30CA14089-27I); Dhont Family Foundation.

Acknowledgments

This work was carried out in the Sharon A. Carpenter Laboratory at USC/NCCC.

disclosures

H-JL declares following conflicts of interest: Consultant of Genentech Inc. and Response Genetics Inc. Other authors have no conflicts of interest to declare.

References

  • 1.Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin. 2005;55:74–108. doi: 10.3322/canjclin.55.2.74. [DOI] [PubMed] [Google Scholar]
  • 2.Sasako M, Sano T, Yamamoto S, et al. D2 lymphadenectomy alone or with para-aortic nodal dissection for gastric cancer. N Engl J Med. 2008;359:453–462. doi: 10.1056/NEJMoa0707035. [DOI] [PubMed] [Google Scholar]
  • 3.Macdonald JS, Smalley SR, Benedetti J, et al. Chemoradiotherapy after surgery compared with surgery alone for adenocarcinoma of the stomach or gastroesophageal junction. N Engl J Med. 2001;345:725–730. doi: 10.1056/NEJMoa010187. [DOI] [PubMed] [Google Scholar]
  • 4.Macdonald JS. Treatment of localized gastric cancer. Semin Oncol. 2004;31:566–573. doi: 10.1053/j.seminoncol.2004.04.022. [DOI] [PubMed] [Google Scholar]
  • 5.Bergers G, Benjamin LE. Tumorigenesis and the angiogenic switch. Nat Rev Cancer. 2003;3:401–410. doi: 10.1038/nrc1093. [DOI] [PubMed] [Google Scholar]
  • 6.Stoeltzing O, McCarty MF, Wey JS, et al. Role of hypoxia-inducible factor 1alpha in gastric cancer cell growth, angiogenesis, and vessel maturation. J Natl Cancer Inst. 2004;96:946–956. doi: 10.1093/jnci/djh168. [DOI] [PubMed] [Google Scholar]
  • 7.Even-Ram S, Uziely B, Cohen P, et al. Thrombin receptor overexpression in malignant and physiological invasion processes. Nat Med. 1998;4:909–914. doi: 10.1038/nm0898-909. [DOI] [PubMed] [Google Scholar]
  • 8.Ma L, Perini R, McKnight W, et al. Proteinase-activated receptors 1 and 4 counter-regulate endostatin and VEGF release from human platelets. Proc Natl Acad Sci U S A. 2005;102:216–220. doi: 10.1073/pnas.0406682102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Italiano JE, Jr, Richardson JL, Patel-Hett S, et al. Angiogenesis is regulated by a novel mechanism: pro- and antiangiogenic proteins are organized into separate platelet alpha granules and differentially released. Blood. 2008;111:1227–1233. doi: 10.1182/blood-2007-09-113837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Pinedo HM, Verheul HM, D'Amato RJ, Folkman J. Involvement of platelets in tumour angiogenesis? Lancet. 1998;352:1775–1777. doi: 10.1016/s0140-6736(98)05095-8. [DOI] [PubMed] [Google Scholar]
  • 11.Kitadai Y, Takahashi Y, Haruma K, et al. Transfection of interleukin-8 increases angiogenesis and tumorigenesis of human gastric carcinoma cells in nude mice. Br J Cancer. 1999;81:647–653. doi: 10.1038/sj.bjc.6690742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Strieter RM. Masters of angiogenesis. Nat Med. 2005;11:925–927. doi: 10.1038/nm0905-925. [DOI] [PubMed] [Google Scholar]
  • 13.Lurje G, Zhang W, Schultheis AM, et al. Polymorphisms in VEGF and IL-8 predict tumor recurrence in stage III colon cancer. Ann Oncol. 2008;19:1734–1741. doi: 10.1093/annonc/mdn368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kim JG, Chae YS, Sohn SK, et al. Vascular endothelial growth factor gene polymorphisms associated with prognosis for patients with colorectal cancer. Clin Cancer Res. 2008;14:62–66. doi: 10.1158/1078-0432.CCR-07-1537. [DOI] [PubMed] [Google Scholar]
  • 15.Kariyazono H, Ohno T, Khajoee V, et al. Association of vascular endothelial growth factor (VEGF) and VEGF receptor gene polymorphisms with coronary artery lesions of Kawasaki disease. Pediatr Res. 2004;56:953–959. doi: 10.1203/01.PDR.0000145280.26284.B9. [DOI] [PubMed] [Google Scholar]
  • 16.Lurje G, Nagashima F, Zhang W, et al. Polymorphisms in cyclooxygenase-2 and epidermal growth factor receptor are associated with progression-free survival independent of K-ras in metastatic colorectal cancer patients treated with single-agent cetuximab. Clin Cancer Res. 2008;14:7884–7895. doi: 10.1158/1078-0432.CCR-07-5165. [DOI] [PubMed] [Google Scholar]
  • 17.Zhang W, Park DJ, Lu B, et al. Epidermal growth factor receptor gene polymorphisms predict pelvic recurrence in patients with rectal cancer treated with chemoradiation. Clin Cancer Res. 2005;11:600–605. [PubMed] [Google Scholar]
  • 18.Schultheis AM, Lurje G, Rhodes K, et al. Polymorphisms and clinical outcome in recurrent ovarian cancer treated with cyclophosphamide and bevacizumab. Clin Cancer Res. 2008;14:7554–7563. doi: 10.1158/1078-0432.CCR-08-0351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Arnaud E, Nicaud V, Poirier O, et al. Protective effect of a thrombin receptor (protease-activated receptor 1) gene polymorphism toward venous thromboembolism. Arterioscler Thromb Vasc Biol. 2000;20:585–592. doi: 10.1161/01.atv.20.2.585. [DOI] [PubMed] [Google Scholar]
  • 20.Dupont A, Fontana P, Bachelot-Loza C, et al. An intronic polymorphism in the PAR-1 gene is associated with platelet receptor density and the response to SFLLRN. Blood. 2003;101:1833–1840. doi: 10.1182/blood-2002-07-2149. [DOI] [PubMed] [Google Scholar]
  • 21.Iughetti P, Suzuki O, Godoi PH, et al. A polymorphism in endostatin, an angiogenesis inhibitor, predisposes for the development of prostatic adenocarcinoma. Cancer Res. 2001;61:7375–7378. [PubMed] [Google Scholar]
  • 22.Kisucka J, Butterfield CE, Duda DG, et al. Platelets and platelet adhesion support angiogenesis while preventing excessive hemorrhage. Proc Natl Acad Sci U S A. 2006;103:855–860. doi: 10.1073/pnas.0510412103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fujimoto D, Hirono Y, Goi T, et al. Prognostic value of protease-activated receptor-1 (PAR-1) and matrix metalloproteinase-1 (MMP-1) in gastric cancer. Anticancer Res. 2008;28:847–854. [PubMed] [Google Scholar]
  • 24.Daly ME, Makris A, Reed M, Lewis CE. Hemostatic regulators of tumor angiogenesis: a source of antiangiogenic agents for cancer treatment? J Natl Cancer Inst. 2003;95:1660–1673. doi: 10.1093/jnci/djg101. [DOI] [PubMed] [Google Scholar]
  • 25.Vu TK, Wheaton VI, Hung DT, et al. Domains specifying thrombin-receptor interaction. Nature. 1991;353:674–677. doi: 10.1038/353674a0. [DOI] [PubMed] [Google Scholar]
  • 26.Ma L, Elliott SN, Cirino G, et al. Platelets modulate gastric ulcer healing: role of endostatin and vascular endothelial growth factor release. Proc Natl Acad Sci U S A. 2001;98:6470–6475. doi: 10.1073/pnas.111150798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ward EG, Grosios K, Markham AF, Jones PF. Genomic structures of the human angiopoietins show polymorphism in angiopoietin-2. Cytogenet Cell Genet. 2001;94:147–154. doi: 10.1159/000048807. [DOI] [PubMed] [Google Scholar]
  • 28.Darmoul D, Gratio V, Devaud H, et al. Aberrant expression and activation of the thrombin receptor protease-activated receptor-1 induces cell proliferation and motility in human colon cancer cells. Am J Pathol. 2003;162:1503–1513. doi: 10.1016/S0002-9440(10)64283-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kamura T, Handa H, Hamasaki N, Kitajima S. Characterization of the human thrombopoietin gene promoter. A possible role of an Ets transcription factor, E4TF1/GABP. J Biol Chem. 1997;272:11361–11368. doi: 10.1074/jbc.272.17.11361. [DOI] [PubMed] [Google Scholar]
  • 30.Perletti G, Concari P, Giardini R, et al. Antitumor activity of endostatin against carcinogen-induced rat primary mammary tumors. Cancer Res. 2000;60:1793–1796. [PubMed] [Google Scholar]
  • 31.Hasle H, Clemmensen IH, Mikkelsen M. Risks of leukaemia and solid tumours in individuals with Down's syndrome. Lancet. 2000;355:165–169. doi: 10.1016/S0140-6736(99)05264-2. [DOI] [PubMed] [Google Scholar]
  • 32.Li A, Dubey S, Varney ML, et al. IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis. J Immunol. 2003;170:3369–3376. doi: 10.4049/jimmunol.170.6.3369. [DOI] [PubMed] [Google Scholar]
  • 33.Venkatakrishnan G, Salgia R, Groopman JE. Chemokine receptors CXCR-1/2 activate mitogen-activated protein kinase via the epidermal growth factor receptor in ovarian cancer cells. J Biol Chem. 2000;275:6868–6875. doi: 10.1074/jbc.275.10.6868. [DOI] [PubMed] [Google Scholar]
  • 34.Hull J, Thomson A, Kwiatkowski D. Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax. 2000;55:1023–1027. doi: 10.1136/thorax.55.12.1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lee WP, Tai DI, Lan KH, et al. The −251T allele of the interleukin-8 promoter is associated with increased risk of gastric carcinoma featuring diffuse-type histopathology in Chinese population. Clin Cancer Res. 2005;11:6431–6441. doi: 10.1158/1078-0432.CCR-05-0942. [DOI] [PubMed] [Google Scholar]
  • 36.Taguchi A, Ohmiya N, Shirai K, et al. Interleukin-8 promoter polymorphism increases the risk of atrophic gastritis and gastric cancer in Japan. Cancer Epidemiol Biomarkers Prev. 2005;14:2487–2493. doi: 10.1158/1055-9965.EPI-05-0326. [DOI] [PubMed] [Google Scholar]
  • 37.Gordon MA, Gil J, Lu B, et al. Genomic profiling associated with recurrence in patients with rectal cancer treated with chemoradiation. Pharmacogenomics. 2006;7:67–88. doi: 10.2217/14622416.7.1.67. [DOI] [PubMed] [Google Scholar]

Articles from Annals of Oncology are provided here courtesy of Oxford University Press

RESOURCES