Skip to main content
Molecular Endocrinology logoLink to Molecular Endocrinology
. 2009 Oct 21;23(12):2038–2047. doi: 10.1210/me.2009-0092

Upstream Stimulatory Factor 2, a Novel FoxA1-Interacting Protein, Is Involved in Prostate-Specific Gene Expression

Qian Sun 1, Xiuping Yu 1, David J Degraff 1, Robert J Matusik 1
PMCID: PMC2796152  PMID: 19846536

Abstract

The forkhead protein A1 (FoxA1) is critical for the androgenic regulation of prostate-specific promoters. Prostate tissue rescued from FoxA1 knockout mice exhibits abnormal prostate development, typified by the absence of expression of differentiation markers and inability to engage in secretion. Chromatin immunoprecipitation and coimmunoprecipitation studies revealed that FoxA1 is one of the earliest transcription factors that binds to prostate-specific promoters, and that a direct protein-protein interaction occurs between FoxA1 and androgen receptor. Interestingly, evidence of the interaction of FoxA1 with other transcription factors is lacking. The upstream stimulatory factor 2 (USF2), an E-box-binding transcription factor of the basic-helix-loop-helix-leucine-zipper family, binds to a consensus DNA sequence similar to FoxA1. Our in vitro and in vivo studies demonstrate the binding of USF2 to prostate-specific gene promoters including the probasin promoter, spermine-binding protein promoter, and prostate-specific antigen core enhancer. Furthermore, we show a direct physical interaction between FoxA1 and USF2 through the use of immunoprecipitation and glutathione-S-transferase pull-down assays. This interaction is mediated via the forkhead DNA-binding domain of FoxA1 and the DNA-binding domain of USF2. In summary, these data indicate that USF2 is one of the components of the FoxA1/androgen receptor transcriptional protein complex that contributes to the expression of androgen-regulated and prostate-specific genes.


Upstream Stimulatory Factor 2 (USF2) is bound with Forkhead protein A1 (FoxA1) and Androgen Receptor (AR) to control androgen and prostate specific gene expression.


The prostate is a male accessory reproductive gland in mammals. Human prostatic secretions are rich in prostate-specific antigen (PSA), acid phosphatase, and citric acid components found in semen. Androgen plays a key role in the normal development and physiology of the prostate. However, little is known about the basic molecular events that are required for organ determination and cell differentiation of the prostate. Our previous studies show that a member of the forkhead family, FoxA1, interacts with the androgen receptor (AR), and that this interaction is required for the expression of prostate-specific proteins such as the rodent probasin (PB), spermine-binding protein (SBP), and human PSA (1). Prostate tissue rescued from FoxA1 knockout mice exhibits abnormal prostate development, typified by the absence of differentiation markers and the inability to engage in secretion (2). Recent studies have confirmed that FoxA1- and AR-binding sites are frequently found adjacent to each other on multiple genes (3,4,5,6). Taken together, these studies indicate that FoxA1 plays an essential role in expression of androgen-regulated and prostate-specific genes, as well as the normal differentiation of the prostate gland.

Originally the FoxA proteins were termed hepatocyte nuclear factor 3 (HNF3) and were discovered as liver-enriched factors because of their ability to bind the transthyretin gene promoter (7). There are three FoxA proteins, FoxA1 (HNF3α), FoxA2 (HNF3β), and FoxA3 (HNF3γ) that are encoded by different genes on different chromosomes (8). The FoxA proteins are involved in endoderm differentiation and also regulate gene transcription in various other endoderm-derived organs, including the lungs, pancreas, intestines, and thyroid (9). Developmental studies have shown that FoxA proteins are expressed at a very early stage of mouse embryo development (10,11) For these reasons, FoxA proteins have been referred to as “genetic potentiators,” which act to enhance the activation of gene expression by facilitating the binding of other transcription factors during developmental and differentiation-associated events (10). Thus, the temporal and spatial expression patterns of FoxA proteins and the ability of FoxA proteins to access and modify compacted chromatin indicate that FoxA proteins are important positive acting transcription factors that regulate organ differentiation and cell-specific gene expression.

PB is a prostate-specific protein that was first identified in rat dorsolateral prostate epithelial cells (12,13). Although the function of PB is unknown, the prostate specificity of this promoter (14) has resulted in the further development of a potent androgen- and prostate-specific promoter (15) that has been extensively characterized and used as a tool to target gene expression to the prostate (16,17,18). In our previous study, two FoxA1-binding sites were identified, which are immediately adjacent to functional AR-binding sites in the PB promoter (1). A similar organization of the androgen response element adjacent to functional FoxA1-binding sites in SBP, prostatic acid phosphatase, C3, and PSA gene core enhancer also were observed (1,19), and the close association between FoxA1- and AR-binding sites has been subsequently verified at a larger scale (4). However, limited information still exists regarding corresponding coregulators that mediate the cross talk of the FoxA1/steroid receptor complex with the general transcription machinery. This is noteworthy because although signal-dependent steroid receptors can regulate genes in a tissue-specific manner, specificity is not regulated by the steroid receptor alone. Rather, a unique complex of transcription factors must act with the receptor to restrict expression to a specific cell type (20).

Southwestern analysis, using the androgen receptor binding site 2 of the PB promoter, identified the AR and FoxA1 as well as a third unknown 44-kDa protein binding to this DNA sequence (1). We have identified this 44-kDa protein as the upstream stimulatory factor 2 (USF2), an E-box binding transcription factor of the basic-helix-loop-helix-leucine-zipper family (21). USF2 has a weak interaction with AR, as well as with other proteins that bind to the same site to enhance the transactivation function of AR on the PB promoter (22). The present study reveals 1) that USF2 binds not only to the PB promoter, but also other prostate-specific promoters including the SBP promoter and PSA core enhancer; 2) that a physical interaction between USF2 and FoxA1 is mediated via the DNA-binding domain of USF2 and the forkhead DNA-binding domain of FoxA1; 3) that the consensus DNA sequence for the binding sites of FoxA1 and USF2 overlaps critical base pairs that permit binding to the DNA, suggesting a direct interaction between these proteins at the same site; and 4) that FoxA1 and USF2 are bound to the promoters before androgenic activation of AR. These data show that USF2 interacts with FoxA1 in a complex with AR to control androgen regulation of prostate-specific gene expression.

Results

USF2 binds to PB and SBP promoters and the PSA core enhancer

EMSA has shown that USF2 is associated with the GAAAATATGATA element in prostate (22). This region is also a FoxA1-binding site of the PB promoter (1,19). Previous studies have identified multiple FoxA1-binding sites in prostate-specific gene promoters and enhancers including the PSA core enhancer and SBP promoter (1,19). Because FoxA1 and USF2 DNA-binding sites have similar sequences, it is very likely that USF2 binding sites exist in other prostate-specific gene enhancers and promoters. The probe PSA1 (Fig. 1A) used in our EMSA experiments encompasses sequence located at −4163/−4105 bp (accession no. NM_001030047) of the PSA gene core enhancer, which contains an AR-binding site and a FoxA1-binding site (1). Figure 1B shows an EMSA using LNCaP human prostate cancer cells nuclear extract, which expresses USF2. When the USF2 antibody was incubated with PSA1 probe and LNCaP cell nuclear extract, a band was supershifted when compared with the PSA1 probe and LNCaP cell nuclear extract alone. No visible effect was observed when the USF1 antibody or GATA3 antibody was used. The experiment has been repeated three times with the same band shift due to the USF2 antibody. These results indicate that USF2 binds the PSA core enhancer in vitro, whereas USF1 does not bind the PSA1 sequence.

Figure 1.

Figure 1

Identification of USF2-binding site in PSA core enhancer. A, PSA1 EMSA probe. The probe PSA1 used in our EMSA experiments encompasses sequence located at −4122/−4109 bp of the PSA gene core enhancer, inclusive of AREIII and a FoxA1-binding site, which also contains the USF2-binding site. B, EMSA. LNCaP nuclear extracts were incubated with radiolabeled PSA1 probe. Strong complexes formed in lanes 2–5. The very top complex was shifted by USF2 antibody (lane 4), but not USF1 or GATA3 antibodies (lanes 3 and 5). N.E., Nuclear extract.

To investigate the association of USF2 with a prostate-specific gene promoter in cultured cells, chromatin immunoprecipitation (ChIP) assays were performed. Because the NeoTag1 mouse cell line express the endogenous mouse PB and SBP genes, and LNCaP cells express endogenous human PSA gene, and both of them express USF2, NeoTag1 (23) and LNCaP cells were used for ChIP assays. Figure 2A is a schematic diagram of the PB, SBP, and PSA-regulatory regions. Because USF2 binds to the same region as FoxA1, the regions that cover the USF2/FoxA1 binding sequences were tested in the experiments. A distal region of each promoter/enhancer (negative controls) was also tested (supplemental Fig. 1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://mend.endojournals.org). NeoTag1 and LNCaP cells were either treated with 10−8 M dihydrotestosterone (DHT) for 12 h or maintained in androgen-depleted medium to determine the occupancy of USF2 on transcriptionally active vs. inactive PB/SBP/PSA chromatin via ChIP. As expected, DHT results in the recruitment of AR to responsive regions (Fig. 2, B–D). USF2, in contrast, was constantly bound to the promoter/enhancer as was FoxA1 (see supplemental Fig. 1 for a gel of the PCR products). The in vivo evidence for the binding of USF2 with PB and the SBP promoter shows that the binding of both USF2 and FoxA1 are largely independent of DHT treatment and AR binding, but the PSA promoter contains relatively low levels of USF2 as measured by real-time PCR (Fig. 2D) and the binding can be seen in the supplemental data (supplemental Fig. 1B) where a USF2 band shows up after 31 PCR cycles in the absence of androgens. In addition, USF2 knockdown failed to alter promoter activity after transient transfection (supplemental Fig. 2).

Figure 2.

Figure 2

USF2 occupies PB promoter, SBP promoter, and PSA enhancer in vivo. A, Schematic diagram of the 5′-upstream regions of PB, SBP, and PSA genes. The diagram shows the amplified regions including distal regions (negative controls) and the USF2-binding regions. B, C, and D, ChIP. After an overnight IP with indicated antibodies, formaldehyde cross-linking was reversed, and DNA fragments were extracted, followed by real-time PCR amplification (see Materials and Methods).

USF2 physically interacts with FoxA1

The observation that overlapping binding sites for FoxA1 and USF2 exist at the androgen response regions of the PB-, SBP-, and PSA-regulatory elements prompted us to determine whether FoxA1 and USF2 physically interact. Because LNCaP cells express both FoxA1 and USF2, we used this cell line to perform coimmunoprecipitations. Cell lysates immunoprecipitated with anti-FoxA1-conjugated protein G-sepharose beads followed by Western blotting for USF2 (Fig. 3A) indicate that FoxA1 and USF2 interact. Reciprocal immunoprecipitations (IPs) using anti-USF2-conjugated protein G-Sepharose beads in the presence of ethidium bromide (EB) followed by Western blotting for FoxA1 confirm the FoxA1 and USF2 interaction and also indicate this interaction does not require the presence of DNA (Fig. 3B). Although we previously reported a physical interaction between FoxA1 and AR (1), we did not detect an interaction between USF2 and AR (data not shown). Taken together, these results demonstrate that FoxA1 and USF2 interact.

Figure 3.

Figure 3

IP. A, LNCaP cell lysates were immunoprecipitated with FoxA1 antibody (lane 3). Water (lane 1) and goat serum (lane 2) were used as negative controls. LNCaP cell lysate (Input) served as a positive control. Western blotting was performed using USF2 antibody. B, LNCaP cell lysates were immunoprecipitated with USF2 antibody (lanes 3, 4, and 5), water (lane 1), and rabbit IgG (lane 2, negative control). LNCaP cell lysate (Input) served as a positive control. EB was added to remove the influence of DNA presence on observed protein-protein interactions (0 μg/ml EB in lane 3, 50 μg/ml EB in lane 4, 100 μg/ml EB in lane 5). Western blot was performed using FoxA1 antibody. IB, Immunoblotting.

Responsible domains for USF2/FoxA1 interaction

To further confirm the interaction between FoxA1 and USF2, as well as to determine the responsible domains for the USF2/FoxA1 interaction, in vitro glutathione-S-transferase (GST) pull-down assays were performed. A full-length FoxA1 protein labeled with a C-terminal V5 epitope was synthesized in vitro (Fig. 4A), and four GST-USF2 fusion proteins with deletion of different subdomains were synthesized and purified (Fig. 4B). In vitro synthesized FoxA1 fragments with a C-terminal V5 epitope (Fig. 4C) were used to map the USF2-binding regions of FoxA1. In Fig. 4D, the FH domain of FoxA1 alone was sufficient to mediate binding to USF2. Furthermore, the N-terminal and C-terminal domains of FoxA1 alone did not bind to USF2. Figure 4E shows that the USF2 DNA-binding domain, but not the transcription activation domain, is involved in the FoxA1/USF2 interaction. These results indicate that the C-terminal DNA-binding region of USF2 and the FH domain of FoxA1 are the respective responsible regions for the interaction between USF2 and FoxA1 and also rule out the DNA contamination.

Figure 4.

Figure 4

A and B, Schematic diagrams showing a series of FoxA1 and USF2 subdomains used in vitro GST pull-down assays. The FoxA1 FH domain and USF2 transcription activation domain are highlighted in black. Two conserved FoxA1 C-terminal domains designated as region 2 and 3 are in gray boxes (see Materials and Methods). C, Western blot using anti-V5 antibody shows eight in vitro synthesized V5-labled FoxA1 subdomains and a V5-labeled LacZ protein. D, Eight V5-labeled FoxA1 subdomains as well as a LacZ protein were synthesized in vitro and incubated with the GST-bound USF2 to identify the USF2-interacting region in FoxA1. E, Four purified truncated GST-USF2 fusion proteins were bound to glutathione agarose beads, followed by incubation with V5-labeled FoxA1 protein synthesized in vitro. Western blot was performed to identify the FoxA1-interacting domain in USF2. CT, C-terminal; FH, forkhead; IB, immunoblotting; NT, N-terminal.

USF2 knockdown increases PSA expression in LNCaP human prostate cancer cells

To further examine USF2 function, USF2 was knocked down in LNCaP cells. PSA expression was evaluated at the RNA level both for USF2 knockdown LNCaP cells and control LNCaP cells. USF2 levels were decreased by 90% in LNCaP cells after 72 h small interfering RNA (siRNA) treatment (Fig. 5A). Real-time PCR results (Fig. 5B) indicate the PSA mRNA levels slightly increased in USF2-knocked down LNCaP cells compared with control LNCaP cells when the LNCaP cells were treated with DHT (10−8), but the change was not statistically significant. The PSA level change was very minor when the LNCaP cells were under DHT depletion condition.

Figure 5.

Figure 5

A, USF2 knockdown in LNCaP cells. Western blotting shows an approximately 50% decrease in USF2 expression after 48 h knockdown, and an approximately 95% decrease after 72 h knockdown. B, Steady-state levels of PSA mRNA were determined after USF2 knockdown in LNCaP cells by quantitative real-time PCR. Total RNA was extracted from USF2 knockdown LNCaP cells and control LNCaP cells treated in the presence and absence of DHT.

Discussion

The promoter of the rat PB gene has been extensively characterized, and a small fragment of the PB promoter (−426 to +28 bp) has been shown to specifically target transgenes to mouse prostate (14). The testing of deletion constructs of the promoter fragment showed that an androgen response region (ARR: −244 to −96 bp) resided in this promoter (15). The ARR contains two strong AR-binding sites termed ARBS1 (−236 to −223 bp) and ARBS2 (−140 to −117 bp) that function together in a cooperative manner (24). Using the −244 to −96 bp fragment placed adjacent to −286 to +28 bp PB promoter, a new construct (ARR2PB) was shown to target high levels of androgen-regulated gene expression specifically to the prostate (15). These studies indicated that the −286/+28 sequences contain the information necessary to regulate prostate-specific gene expression (15). FoxA1 and AR have been previously identified to bind adjacent to each other at both ARBS1 and ARBS2 (1). FoxA1 is important not only in prostate-specific gene regulation but also in prostate development (1,2). The prostates rescued from FoxA1-deficient mice display basal-like cell hyperplasia (2). FoxA proteins activate transcription by displacing linker histones from nucleosomes and opening chromatin, making the local DNA region more accessible for other transcription factors (25). However, the molecular mechanisms by which FoxA proteins control transcription has only been partially characterized, and little information exists on corresponding coregulators that mediate the cross talk of FoxA1 with components of the general transcription machinery. FoxA1-binding sites are associated with glucocorticoid receptor-binding sites (26) and are now recognized to be a common coregulator with AR- and estrogen receptor-regulated genes (1,3,4,5,6,19,27,28). Chromosome wide-mapping analysis has shown that GATA2- and Oct-1 binding sites are also commonly associated with binding sites for AR and FoxA1 (3), and more recent data have identified that nuclear factor I-binding sites are also commonly associated in this complex (4). The fact that FoxA-binding sites are found adjacent to these other transcription factor-binding sites suggests that FoxA proteins are capable of interacting with these proteins to control the activity of cis-regulatory elements. Therefore, it is important to identify additional transcription factors that interact with FoxA1 to mediate the regulation of gene expression. The present study has identified USF2 as a novel FoxA1-interacting partner.

USF2 is an E-box site-binding protein that belongs to the basic-helix-loop-helix-leucine-zipper family of transcription factors (21). Studies suggest that USF2 functions as a tumor suppressor and can down-regulate c-myc expression (29,30,31). USF2 knockout mice demonstrate prostate hyperplasia, indicating that USF2 plays an important role in prostate differentiation (29).

Using the PB GAAAATATGATA (−250 to −239 bp) sequence that overlaps with ARBS1, affinity purification of transcription factors was performed and USF2 was shown to bind within this sequence (22). We confirm that USF2 does indeed bind to the PB promoter and that the DNA-binding domains of USF2 and FoxA1 directly interact. FoxA1-binding sites exist on the PSA and SBP promoters, and we also show that USF2 binds to the PSA and SBP promoters. This indicates that functional binding sites for FoxA1 and USF2 are colocalized on these prostate-specific promoters. Whole-genomic mapping studies for USF1- and USF2-binding sites show that these two transcription factors have distinct determinants for binding to DNA (32). Further, the analysis showed that a subset of 240 regions bound only USF2 (32). Consensus FoxA-binding sites were the most abundant sites associated with these USF2 unique sites, and FoxA-binding sites were not significantly associated with USF1-binding sites (32). Furthermore, seven of eight regions that were perfect matches for FoxA sites were confirmed to bind both FoxA and USF2 (32). In addition, a recent study using a oligonucleotide-based assay to identify novel factors that bind to the androgen response element (ARE)1 oligonucleotide from the PSA gene promoter indicate that FoxA1 and USF2 are bound to the region (33). In the present study, EMSA experiments confirmed the binding site of USF2 in the PSA core enhancer and show that USF1 fails to bind this region, despite the fact that USF2 and USF1 share a highly conserved C-terminal DNA-binding domain (34). These results indicate that the binding of USF2 in the PSA core enhancer is specific. Furthermore, UFS2-binding sites were confirmed by ChIP assay on PB-, SBP-, and PSA-regulatory regions, suggesting USF2 plays an important role in prostate-specific promoters.

Whereas the AR requires the presence of hormone to bind to functional cis-regulatory sequence, FoxA1 and USF2 bind to the PB and SBP promoter both in the presence and absence of androgen. The PSA promoter contains low levels of USF2 as measured by real-time PCR, and the binding can be seen in the supplemental data (supplemental Fig. 1B) where a USF2 band shows up after 31 PCR cycles in the absence of androgens. The USF2 consensus DNA sequence at the USF2 binding site is CANNTG and the matches found in PB is CAATTT, SBP is CAAAGT, and PSA is CAAATC. These differences between the three promoters may cause the differences in binding affinity of USF2 to different promoters. FoxA1 plays an essential role in the pioneering of gene-regulatory elements, allowing for the recruitment of additional factors required for gene regulation (25), and our data suggest that USF2 cooperates with FoxA1 to regulate promoter activity. Changes in USF2 binding with or without AR activation were minimal. Thus, our results could not determine whether USF2 association is changed or unchanged by the binding of AR. USF2 knockout mice develop prostate hyperplasia (29), and our data indicates that USF2 cooperates with FoxA1 to regulate gene expression. These events suggest that USF2/FoxA1 are associated with normal differentiation in the prostate.

As previously reported, down-regulation of FoxA1 had a limited effect on promoter activity after transient transfection (28). This appears to be true for USF2 as well, because down-regulation USF2 expression in LNCaP cells failed to cause a dramatic change in ARR2PB or PSA promoter activity after transient transfection (supplemental Fig. 2). This may be explained by the fact that in transient transfected DNA studies, the DNA remains naked and normal nucleosome structures do not form (25). Therefore, even though FoxA1 and USF2 knockout mice exhibit significant prostate phenotypes, it is reasonable to expect a limited impact of FoxA1 and USF2 knockdown on promoter activity after transient transfection. However, the endogenous PSA mRNA levels slightly increased in LNCaP cells when USF2 levels were decreased. Even the change of the PSA level was not statistically significant; it may suggest that USF2 is affecting chromatin structure of the PSA promoter that is absent on transient transfected DNA.

Our previous studies have shown that androgen- induced AR binding is adjacent to bound FoxA1 and that the DNA-binding domain of the AR interacts with the DNA-binding domain of FoxA1 (1). We show that USF2 is bound in a complex on DNA; whether FoxA1 and USF2 are bound to the same promoter at the same time or independent of each other are not determined. Because FoxA1 has been reported as a common coregulator of AR and estrogen receptor (1,3,4,5,6,19,27,28) and USF2 can bind to the same/similar DNA sequence as FoxA1 (22,32,35,36), it is highly likely that our observation that USF2 is a coregulator for these three androgen-regulated and prostate-specific genes will also extend to a larger list of AR/FoxA1 (19) as well as ER/FoxA1-regulated genes. We show that USF2 interacts with FoxA1, and although a weak interaction of USF2 with AR has been reported (26), we could not detect the interaction of USF2 with AR (data not shown). Thus, USF2 may exist in a complex with the AR and other steroid receptors, but it is likely that the main interaction of USF2 is with FoxA1, suggesting that FoxA1 acts as a bridge between USF2 and the AR, as well as other steroid hormone receptors. By ChIP assays, it is possible that we are detecting promoter sequences either bound with FoxA1 or USF2 but not both FoxA1 and USF2 at the same time. Also, it seems contrary that two transcription factors can bind to the DNA at the same site at the same time, but it is possible to envision that the DNA is sandwiched between the these two factors. Because FoxA1 and USF2 directly interact at the protein level via their DNA-binding domains, we would expect protein to protein contact as well as protein to DNA contact would occur with both factors bound to the DNA at the same time. Although the knock down of USF2 results in an slightly increased level of PSA mRNA, suggesting an inhibitory role for USF2 in the AR/FoxA1 complex on this promoter, the change seen is not significant and should not be overinterpreted.

In summary, we report a novel FoxA1-interacting partner USF2, which shares the same binding sites as FoxA1 in multiple prostate-specific promoters. Because FoxA1 plays a major role in modifying chromatin structure and USF2 interacts with FoxA1 at the same DNA-binding site, we would predict the USF2 is involved in FoxA1 regulation of chromatin structure. Whole-genomic mapping studies for USF1- and USF2-binding sites show that USF2-binding sites, but not USF1, are frequently associated with consensus FoxA-binding sites (32). This supports the conclusion that the functional interaction between USF2 and FoxA1 is not limited to AR-regulated genes and that this interaction plays a fundamental part in the role of FoxA1 as a pioneer factor.

Materials and Methods

Cell culture and vectors

The human prostate carcinoma cell line LNCaP was obtained from American Type Culture Collection. LNCaP cells were cultured in complete RPMI 1640 medium (Invitrogen, Carlsbad, CA) supplemented with 5% fetal bovine serum. Neotag1 cells were obtained and cultured as described previously (23). FoxA1 subdomain expression vectors were developed as described previously (1). pSG5-mUSF2 (containing wild-type mouse USF2), pSG5-U2d(7-178) [containing USF2 with 7-178 amino acid (a.a.). deletion], and pSG5-U2dE5 (containing USF2 with exon 5 deletion) vectors were kindly provided by Dr. N Chen (Department of Molecular Genetics, University of Texas, M.D. Anderson Cancer Center). USF2 (a.a.1-235) was cloned by PCR using pSG5-mUSF2 as a template. All four USF2 sequences were cloned into pGEX-4T-1 to express GST-USF2 fusion proteins: GST-USF2, GST-USF2-ΔE5, GST-USF2-ΔN (a.a. 7-178 deletion), and GST-USF2-ΔC (a.a. 1-235).

EMSA

Nuclear extract for LNCaP cells was prepared as described previously (1). All nuclear extracts and purified proteins were stored in buffers containing 1× concentration of Complete Protease Inhibitor Cocktail (Roche Molecular Biochemicals, Indianapolis, IN). All oligonucleotides for EMSAs were purchased from Integrated DNA Technologies (Coralville, IA). Probes were end labeled with [γ-32P]ATP (Amersham Pharmacia Biotech, Piscataway, NJ) using T4 polynucleotide kinase (New England Biolabs, Ipswich, MA), and purified by 15% PAGE. A typical binding reaction involved a 10-min preincubation with 10 μg of nuclear extract, 1 μg of the nonspecific competitor polydeoxyinosinic deoxycytidylic acid, and buffer D (20 mm HEPES-NaOH, pH 7.9; 100 mm KCl; 0.2 mm EDTA; 1.5 mm MgCl2; 1 mm dithiothreitol; 20% glycerol; and 1 mm phenylmethylsulfonyl fluoride), followed by a 15 min incubation with 200,000 cpm of radiolabeled probe in a total volume of 20 μl. For supershift analysis, antibodies were added after the binding reaction and incubated for an additional 20 min on ice before electrophoresis. All supershift antibodies [USF2 ((N-18) × sc-861X), USF1 ((H-86) × sc-8983X), GATA-3 ((H-48) × sc-9009)] were purchased from Santa Cruz Biotechnology, Inc (Santa Cruz, CA). The concentration of antibody in each EMSA reaction was 0.2 μg/μl. Complexes were resolved by electrophoresis for 2.5 h at 160 V on a 5% native polyacrylamide gel, which was later dried and processed for autoradiography.

Western blotting

For Western blotting analysis, cell pellets were collected and sonicated in cold lysis buffer [0.01 m Tris-HCl (pH 7.4), 0.01 m NaCl, 1 mm EDTA, in 1× concentration of Complete Protease Inhibitor Cocktail], followed by centrifugation at 14,000 rpm.

Samples were loaded onto a 4%–12% SDS-PAGE gel and separated at 120 V for 2.5 h and transferred to polyvinylidine difluoride membrane (Invitrogen). Membranes were blocked in Tris-buffered saline containing 0.1% Tween 20 and 5% nonfat dry milk, and incubated with primary antibodies [1:1000 dilution: anti-FoxA1 (sc-6553), 1:10000 anti-USF2 (Santa Cruz Biotechnology, Santa Cruz, CA)] for 1 h at room temperature. Membranes were incubated with secondary antibody (antirabbit IgG; GE Healthcare, Piscataway, NJ), or antigoat IgG, Santa Cruz Biotechnology) for 1 h at room temperature. In cases where anti-V5-horseradish peroxidase antibody (Invitrogen) was used to detect the recombinant V5-tagged FoxA1 proteins, a dilution of 1:5000 was used. The signal was visualized by enhanced chemiluminescence assay (Amersham Pharmacia Biotech).

ChIP

The procedure and PCR primers (Table 1) used in this study were described previously (1). ChIP assays were performed according to manufacturer’s protocol (Millipore Corp., Billerica, MA). Briefly, LNCaP cells were serum starved for 24 h in RPMI 1640 with 5% charcoal/dextran-treated fetal bovine serum (HyClone Laboratories, Logan, UT), and cells were subsequently treated in the presence or absence of 10−8 m DHT for 12 h and then washed with PBS and cross-linked with 1% formaldehyde at 37 C for 10 min. Cells were scraped into conical tube, centrifuged for 4 min at 2000 rpm at 4 C, and resuspended in sodium dodecyl sulfate (SDS) lysis buffer [1% SDS, 10 mm EDTA, 50 mm Tris-HCl (pH 8.1), 1× proteinase inhibitor cocktail] at a concentration of 500,000 cells/100 μl, after which cells were sonicated 10 times for 10-sec pulses at an output level 2–3 (Fisher Sonic Dismembrator, model 50; Fisher Scientific, Pittsburgh, PA). Cells were centrifuged, and supernatants were collected and diluted in ChIP dilution buffer [0.01% SDS, 1.1% Triton X-100, 1.2 mm EDTA, 16.7 mm Tris-HCl (pH 8.1), 167 mm NaCl], followed by preclearing for 30 min with 3 μg of sonicated salmon sperm DNA with protein A agarose (80 μl of 50% slurry in 10 mm Tris-HCl, 1 mm EDTA). IP was performed overnight at 4 C with specific antibodies (anti-AR, anti-FoxA1, anti-USF2, anti-FoxA3 antibodies were used for IP; water was used as negative control). Protein A agarose with salmon sperm DNA was then added and incubated for 1 h to collect immune complexes. Beads were then sequentially washed in low-salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-HCl, 150 mm NaCl), high-salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-HCl, 500 mm NaCl), LiCl wash buffer (0.25 m LiCl, 1% Nonidet P-40, 1% deoxycholate, 1 mm EDTA, 10 mm Tris-HCl) and twice with TE buffer (10 mm Tris-HCl, 1 mm EDTA). The complex was eluted twice with 250 μl of elution buffer (1% SDS, 0.1 m NaHCO3) and eluates were pooled. Formaldehyde cross-linking was then reversed by adding 20 μl 5 m NaCl and incubating for 8 h at 65 C. Eluates were incubated for an additional 1 h at 45 C with Proteinase K. DNA was extracted using QIAquick Spin Column (QIAGEN, Inc., Valencia, CA) and used for PCR amplification. The amplified region of PB promoter (−359 bp/−106 bp) includes ARBS-1, ARBS-2, and two FoxA1-binding sites (1). The amplified region of SBP promoter (−538 bp/−285 bp) includes two ARE- and two FoxA1-binding sites (2). The amplified region of PSA core enhancer (−4131 bp/−3938 bp) includes AREIII, and two FoxA1-binding sites (1). For each PCR, a distal region was amplified as a negative control. Thirty one cycles were run for all the PCRs.

Table 1.

Primers used in ChIP

Name Sequence
PB-F TCCCAGTTGGCAGTTGTA
PB-R CACCAACATCTATCTGATTGGAG
PBdis-F TTCTATTGGTGCCCAACGAGGCTA
PBdis-R AGGTCAATGCTAGCAGCAAACCAC
SBP-F GCCCCTACTGACCCAGTATAGA
SBP-R GAACTTTGTTTTCTGCTTATCCCTCAG
SBPdis-F TGCCTGTTTCAATAGGACGAGGGT
SBPdis-R GATGGCTCAGAAGATGGGAATTGCTG
PSA-F ACAGACCTACTCTGGAGGAA
PSA-R AAGACAGCAACACCTTTTTTTTTC
PSAdis-F GATGGTGTTTCACCGTGTTG
PSAdis-R AGAGTGCAGTGAGCCGAGAT
PSA-RT-PCR-F CTGCCCACTGCATCAGGAACAAA
PSA-RT-PCR-R AGCTGTGGCTGACCTGAAATACCT
hGAPDHf TGCACCACCAACTGCTTAGC
hGAPDHr GGCATGGACTGTGGTCATGAG

hGAPDH, Human glyceraldehyde-3-phosphate dehydrogenase. 

SYBR green real-time PCR

Real-time PCR and data analysis were performed in a total volume of 25 μl using 96-well microwell plates and MyiQ Single Color Real-time PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA). Purified DNA sample (5 μl) from ChIP assay, 12.5 μl SYBR green I PCR Master Mix (Applied BioSystems, Foster City, CA), and 500 nm of each primer pair (Table 1) were added to each microwell. To reach a total volume of 25 μl per well, deoxyribonuclease-ribonuclease-free distilled water (Sigma-Aldrich, St. Louis, MO) was added. After a preincubation of reaction mix at 95 C for 10 min, the following parameters were used for 40 cycles: 95 C for 45 sec, 56 C (PB)/56 C (SBP)/52 C (PSA) for 1 min, 72 C for 30 sec, and an extension phase of one cycle at 72 C for 7 min. All reactions were performed in triplicate. The amount of DNA in each sample was calculated based on a standard curve, after which each DNA sample amount was divided by input DNA amount and graphical data are depicted as the average of the normalized data from three individual reactions. cDNA from USF2 knockdown and control LNCaP cells was used for real time PCR following the same procedure as above. The amount of DNA in each sample was normalized relative to glyceraldehyde-3-phosphate dehydrogenase. The DNA amount from control LNCaP cells was set as 1, and that of the USF2 knockdown samples was compared with the control.

Coimmunoprecipitation

LNCaP cells were washed three times with cold 1× PBS and lysed with 1 ml of nondenaturing lysis buffer (50 mm Tris, 150 mm NaCl, 10 mm EDTA, 0.02% NaN3, 50 mm NaF, 1 mm Na3VO4, 1% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, 0.5 mm dithiothreitol, and 1× concentration of protease inhibitor cocktail). After sonication and centrifugation, 1 mg of total cell lysate for each reaction was incubated at 4 C for 3 h with 20 μl (dry volume) protein G-Sepharose beads (Amersham Pharmacia Biotech), which were preconjugated with 1 μg of experimental antibody [anti-HNF-3α/β (C-20)X, Santa Cruz Biotechnology) or goat serum negative control]. Beads were washed four times with lysis buffer and once with PBS for 5 min, followed by Western blotting analysis for USF2 (Santa Cruz Biotechnology). Reciprocal IP was also performed. For Coimmunoprecipitation experiments using EB to disrupt DNA-protein interactions, 25 μg/ml and 100 μg/ml were used.

GST-USF2 fusion proteins expression, in vitro translation of FoxA1 proteins, and GST pull-down assay

GST-USF2 fusion proteins were produced by expressing USF2 fusion protein-encoding vectors in the BL21-CodonPlus(DE3)-RIL strain, which allows the inducible expression of transformed vectors by isopropyl β-d-1-thiogalactopyranoside addition. After isopropyl β-d-1-thiogalactopyranoside treatment, bacterial cells were harvested and resuspend in lysis buffer (1× PBS, 1% Triton X-100, 1× protease inhibitor), cells were sonicated three times for 1–3 min at an output level of 3–4. Samples were then centrifuged, and the supernatant was transferred to preequilibrated glutathione agarose beads, followed by washing (1× PBS, 1× concentration of complete protease inhibitor cocktail), and stored at −80 C without elution.

Recombinant FoxA1s and LacZ proteins labeled with a C-terminal V5-epitope were synthesized in vitro using the TNT T7 Quick Coupled Transcription/Translation System (Promega Corp., Madison, WI)

For GST pull-down assays, glutathione agarose beads conjugated GST or GST-USF2 fusion proteins (each contains 20 μg protein) were equilibrated with PBS-T binding buffer [1× PBS (pH 7.4), 1% Tween 20, and protease inhibitors] and incubated for 2 h at 4 C with 10 μl products from the TNT reactions. Complexes were washed four times with 1.5 ml of cold binding buffer, heated for 10 min at 70 C in 1× LDS loading buffer, and separated by SDS-PAGE. Western blotting analysis with V5-horseradish peroxidase antibody or USF2 was used to detect the domain that involved interaction.

USF2 knockdown

LNCaP cells treated in the presence or absence of DHT overnight were transiently transfected with either ON-TARGET Plus SMART pool human USF2 siRNA or ON-TARGET Plus Non-targeting siRNA no. 2 (DHARMACON RNAi Technologies, Chicago, IL) at a working concentration of 100 nm. Western blotting was performed 48 h and 72 h after transfection to detect verify USF2 knockdown.

RNA extraction and RT-PCR

RNA extracted from LNCaP cells (USF2 knockdown LNCaP cells and control LNCaP cells) using RNeasy Mini Kit (QIAGEN, Inc., Valencia, CA). RNA (2 μg) of each sample was reverse transcribed into cDNA using Superscript Reverse Transcriptase (Invitrogen). cDNA was used for real-time PCR analysis.

Supplementary Material

[Supplemental Data]

Acknowledgments

We thank Dr. Chen (M.D. Anderson) for the USF2 expression vectors and Dr. Orgebin-Crist (Vanderbilt University Medical Center, Nashville, TN) for critical reading of the manuscript.

Footnotes

This work was supported by National Institutes of Diabetes and Digestive and Kidney Diseases Grant R01-DK55748 (to R.J.M.) and Department of Defense studentship W81XWH-07-1-0042 (to Q.S.) and the Frances Williams Preston Laboratories of the T.J. Martell Foundation.

The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Disclosure Summary: The authors have nothing to disclose.

First Published Online October 21, 2009

Abbreviations: a.a., Amino acid; AR, androgen receptor; ARE, androgen response element; ARR, androgen response region; ChIP, chromatin immunoprecipitation; DHT, dihydrotestosterone; EB, ethidium bromide; GST, glutathione-S-transferase; HNF3, hepatocyte nuclear factor 3; IP, immunoprecipitation; PB, probasin; PSA, prostate-specific antigen; SBP, spermine binding protein; SDS, sodium dodecyl sulfate; siRNA, small interfering RNA; USF2, upstream stimulatory factor 2.

References

  1. Gao N, Zhang J, Rao MA, Case TC, Mirosevich J, Wang Y, Jin R, Gupta A, Rennie PS, Matusik RJ 2003 The role of hepatocyte nuclear factor-3α (Forkhead Box A1) and androgen receptor in transcriptional regulation of prostatic genes. Mol Endocrinol 17:1484–1507 [DOI] [PubMed] [Google Scholar]
  2. Gao N, Ishii K, Mirosevich J, Kuwajima S, Oppenheimer SR, Roberts RL, Jiang M, Yu X, Shappell SB, Caprioli RM, Stoffel M, Hayward SW, Matusik RJ 2005 Forkhead box A1 regulates prostate ductal morphogenesis and promotes epithelial cell maturation. Development 132:3431–3443 [DOI] [PubMed] [Google Scholar]
  3. Wang Q, Li W, Liu XS, Carroll JS, Jänne OA, Keeton EK, Chinnaiyan AM, Pienta KJ, Brown M 2007 A hierarchical network of transcription factors governs androgen receptor-dependent prostate cancer growth. Mol Cell 27:380–392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Jia L, Berman BP, Jariwala U, Yan X, Cogan JP, Walters A, Chen T, Buchanan G, Frenkel B, Coetzee GA 2008 Genomic androgen receptor-occupied regions with different functions, defined by histone acetylation, coregulators and transcriptional capacity. PLoS ONE 3:e3645 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Yu X, Gupta A, Wang Y, Suzuki K, Mirosevich J, Orgebin-Crist MC, Matusik RJ 2005 Foxa1 and Foxa2 interact with the androgen receptor to regulate prostate and epididymal genes differentially. Ann NY Acad Sci 1061:77–93 [DOI] [PubMed] [Google Scholar]
  6. Yu X, Suzuki K, Wang Y, Gupta A, Jin R, Orgebin-Crist MC, Matusik R 2006 The role of forkhead box A2 to restrict androgen-regulated gene expression of lipocalin 5 in the mouse epididymis. Mol Endocrinol 20:2418–2431 [DOI] [PubMed] [Google Scholar]
  7. Lai E, Prezioso VR, Smith E, Litvin O, Costa RH, Darnell Jr JE,1990 HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally. Genes Dev 4:1427–1436 [DOI] [PubMed] [Google Scholar]
  8. Kaestner KH, Hiemisch H, Luckow B, Schütz G 1994 The HNF-3 gene family of transcription factors in mice: gene structure, cDNA sequence, and mRNA distribution. Genomics 20:377–385 [DOI] [PubMed] [Google Scholar]
  9. Kaufmann E, Knöchel W 1996 Five years on the wings of fork head. Mech Dev 57:3–20 [DOI] [PubMed] [Google Scholar]
  10. Zaret K 1999 Developmental competence of the gut endoderm: genetic potentiation by GATA and HNF3/fork head proteins. Dev Biol 209:1–10 [DOI] [PubMed] [Google Scholar]
  11. Sasaki H, Hogan BL 1993 Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo. Development 118:47–59 [DOI] [PubMed] [Google Scholar]
  12. Matuo Y, Nishi N, Negi T, Tanaka Y, Wada F 1982 Isolation and characterization of androgen-dependent non-histone chromosomal protein from dorsolateral prostate of rats. Biochem Biophys Res Commun 109:334–340 [DOI] [PubMed] [Google Scholar]
  13. Yamamoto M, Gao F, Furuichi M, Ichiyoshi Y, Endo H 1989 A LINE 1 sequence interrupts the rat α2u globulin gene. Biochim Biophys Acta 1008:322–328 [DOI] [PubMed] [Google Scholar]
  14. Greenberg NM, DeMayo FJ, Sheppard PC, Barrios R, Lebovitz R, Finegold M, Angelopoulou R, Dodd JG, Duckworth ML, Rosen JM 1994 The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol Endocrinol 8:230–239 [DOI] [PubMed] [Google Scholar]
  15. Zhang J, Thomas TZ, Kasper S, Matusik RJ 2000 A small composite probasin promoter confers high levels of prostate-specific gene expression through regulation by androgens and glucocorticoid in vitro and in vivo. Endocrinology 141:4698–4710 [DOI] [PubMed] [Google Scholar]
  16. Wen Y, Giri D, Yan DH, Spohn B, Zinner RG, Xia W, Thompson TC, Matusik RJ, Hung MC 2003 Prostate-specific antitumor activity by probasin promoter-directed p202 expression. Mol Carcinog 37:130–137 [DOI] [PubMed] [Google Scholar]
  17. Ellwood-Yen K, Graeber TG, Wongvipat J, Iruela-Arispe ML, Zhang J, Matusik R, Thomas GV, Sawyers CL 2003 Myc-driven murine prostate cancer shares molecular features with human prostate tumors. Cancer Cell 4:223–238 [DOI] [PubMed] [Google Scholar]
  18. Klezovitch O, Chevillet J, Mirosevich J, Roberts RL, Matusik RJ, Vasioukhin V 2004 Hepsin promotes prostate cancer progression and metastasis. Cancer Cell 6:185–195 [DOI] [PubMed] [Google Scholar]
  19. DeGraff DJ, Yu X, Sun Q, Mirosevich J, Jin RJ, Wang Y-Q, Gupta A, Nandana S, Case TC, Paul M, Huang H-Y, Shapiro E, Logan SK, Suzuki K, Orgebin-Crist MC, Matusik RJ 2009 The role of Foxa proteins in the regulation of the androgen receptor activity. In: Tindall DJ, Mohler JL, eds. Androgen action in prostate cancer. New York: Springer Science 587–615 [Google Scholar]
  20. Matusik RJ, Jin RJ, Sun Q, Wang Y, Yu X, Gupta A, Nandana S, Case TC, Paul M, Mirosevich J, Oottamasathien S, Thomas J 2008 Prostate epithelial cell fate. Differentiation 76:682–698 [DOI] [PubMed] [Google Scholar]
  21. Sirito M, Walker S, Lin Q, Kozlowski MT, Klein WH, Sawadogo M 1992 Members of the USF family of helix-loop-helix proteins bind DNA as homo- as well as heterodimers. Gene Expr 2:231–240 [PMC free article] [PubMed] [Google Scholar]
  22. Kivinen A, Patrikainen L, Kurkela R, Porvari K, Vihko P 2004 USF2 is connected to GAAAATATGATA element and associates with androgen receptor-dependent transcriptional regulation in prostate. Prostate 59:190–202 [DOI] [PubMed] [Google Scholar]
  23. Wang Y, Kasper S, Yuan J, Jin RJ, Zhang J, Ishii K, Wills ML, Hayward SW, Matusik RJ 2006 Androgen dependent prostatic epithelial cell selection by targeting ARR2PBNeo to the LPB-Tag transgenic model of prostate cancer. Lab Invest 86:1074–1088 [DOI] [PubMed] [Google Scholar]
  24. Kasper S, Rennie PS, Bruchovsky N, Sheppard PC, Cheng H, Lin L, Shiu RP, Snoek R, Matusik RJ 1994 Cooperative binding of androgen receptors to two DNA sequences is required for androgen induction of the probasin gene. J Biol Chem 269:31763–31769 [PubMed] [Google Scholar]
  25. Cirillo LA, McPherson CE, Bossard P, Stevens K, Cherian S, Shim EY, Clark KL, Burley SK, Zaret KS 1998 Binding of the winged-helix transcription factor HNF3 to a linker histone site on the nucleosome. EMBO J 17:244–254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. O'Brien RM, Noisin EL, Suwanichkul A, Yamasaki T, Lucas PC, Wang JC, Powell DR, Granner DK 1995 Hepatic nuclear factor 3- and hormone-regulated expression of the phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein 1 genes. Mol Cell Biol 15:1747–1758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Laganière J, Deblois G, Lefebvre C, Bataille AR, Robert F, Giguère V 2005 From the cover: location analysis of estrogen receptor α target promoters reveals that FOXA1 defines a domain of the estrogen response. Proc Natl Acad Sci USA 102:11651–11656 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Carroll JS, Liu XS, Brodsky AS, Li W, Meyer CA, Szary AJ, Eeckhoute J, Shao W, Hestermann EV, Geistlinger TR, Fox EA, Silver PA, Brown M 2005 Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1. Cell 122:33–43 [DOI] [PubMed] [Google Scholar]
  29. Chen N, Szentirmay MN, Pawar SA, Sirito M, Wang J, Wang Z, Zhai Q, Yang HX, Peehl DM, Ware JL, Sawadogo M 2006 Tumor-suppression function of transcription factor USF2 in prostate carcinogenesis. Oncogene 25:579–587 [DOI] [PubMed] [Google Scholar]
  30. Moriuchi M, Moriuchi H, Margolis DM, Fauci AS 1999 USF/c-Myc enhances, while Yin-Yang 1 suppresses, the promoter activity of CXCR4, a coreceptor for HIV-1 entry. J Immunol 162:5986–5992 [PubMed] [Google Scholar]
  31. Luo X, Sawadogo M 1996 Antiproliferative properties of the USF family of helix-loop-helix transcription factors. Proc Natl Acad Sci USA 93:1308–1313 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rada-Iglesias A, Ameur A, Kapranov P, Enroth S, Komorowski J, Gingeras TR, Wadelius C 2008 Whole-genome maps of USF1 and USF2 binding and histone H3 acetylation reveal new aspects of promoter structure and candidate genes for common human disorders. Genome Res 18:380–392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wong HY, Demmers JA, Bezstarosti K, Grootegoed JA, Brinkmann AO 2009 DNA dependent recruitment of DDX17 and other interacting proteins by the human androgen receptor. Biochim Biophys Acta 1794:193–198 [DOI] [PubMed] [Google Scholar]
  34. Sirito M, Lin Q, Maity T, Sawadogo M 1994 Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells. Nucleic Acids Res 22:427–433 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhao HH, Herrera RE, Coronado-Heinsohn E, Yang MC, Ludes-Meyers JH, Seybold-Tilson KJ, Nawaz Z, Yee D, Barr FG, Diab SG, Brown PH, Fuqua SA, Osborne CK 2001 Forkhead homologue in rhabdomyosarcoma functions as a bifunctional nuclear receptor-interacting protein with both coactivator and corepressor functions. J Biol Chem 276:27907–27912 [DOI] [PubMed] [Google Scholar]
  36. Schuur ER, Loktev AV, Sharma M, Sun Z, Roth RA, Weigel RJ 2001 Ligand-dependent interaction of estrogen receptor-α with members of the forkhead transcription factor family. J Biol Chem 276:33554–33560 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental Data]
me.2009-0092_1.pdf (234.7KB, pdf)

Articles from Molecular Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES