Φm46.1, the Main Streptococcus pyogenes Element Carrying mef(A) and tet(O) Genes

Abstract

Φm46.1, the recognized representative of the most common variant of mobile, prophage-associated genetic elements carrying resistance genes mef(A) (which confers efflux-mediated erythromycin resistance) and tet(O) (which confers tetracycline resistance) in Streptococcus pyogenes, was fully characterized. Sequencing of the Φm46.1 genome (55,172 bp) demonstrated a modular organization typical of tailed bacteriophages. Electron microscopic analysis of mitomycin-induced Φm46.1 revealed phage particles with the distinctive icosahedral head and tail morphology of the Siphoviridae family. The chromosome integration site was within a 23S rRNA uracil methyltransferase gene. BLASTP analysis revealed that the proteins of Φm46.1 had high levels of amino acid sequence similarity to the amino acid sequences of proteins from other prophages, especially Φ10394.4 of S. pyogenes and λSa04 of S. agalactiae. Phage DNA was present in the host cell both as a prophage and as free circular DNA. The lysogeny module appears to have been split due to the insertion of a segment containing tet(O) (from integrated conjugative element 2096-RD.2) and mef(A) (from a Tn1207.1-like transposon) into the unintegrated phage DNA. The phage attachment sequence lies in the region between tet(O) and mef(A) in the unintegrated form. Thus, whereas in this form tet(O) is ∼5.5 kb upstream of mef(A), in the integrated form, tet(O), which lies close to the right end of the prophage, is ∼46.3 kb downstream of mef(A), which lies close to the left end of the prophage.

The worldwide increase in the rates of erythromycin resistance in streptococci since the 1990s has prompted extensive epidemiological as well as molecular investigations that in the last few years have led to substantial progress in the knowledge of the mechanisms, determinants, and genetic elements involved (35). The increase in the rate of resistance is partly due to the further spread among streptococci of conventional erm-class gene-encoded methylases, the presence of which usually leads to coresistance to macrolide, lincosamide, and streptogramin B (MLS_B) antibiotics (the MLS_B phenotype) (36). To an even greater extent, however, it has been due to the emergence of an active efflux-mediated mechanism, encoded by mef-class genes and associated with a pattern of low-level resistance affecting, among the MLS_B antibiotics, only 14- and 15-membered macrolides (the M phenotype) (32). As a rule, a second efflux gene—an msr-class determinant usually designated msr(D)—is located immediately downstream of the mef gene.

mef(A) was discovered in Streptococcus pyogenes (16) and is by far the most common mef-class variant responsible for efflux-mediated erythromycin resistance in this species. However, the first mef(A)-carrying element, designated Tn1207.1, was detected in Streptococcus pneumoniae (30). Tn1207.1 (7,244 bp) contains eight open reading frames (ORFs), of which mef(A) and msr(D) are the fourth and the fifth; it is integrated at a specific site of the pneumococcal chromosome into celB, a late competence gene; and it has been reported to be transferable by transformation but not by conjugation. Whereas in S. pneumoniae Tn1207.1 is the sole recognized element carrying mef(A), in S. pyogenes it is not detected as such but is detected as part of larger and mobile composite elements. These elements differ depending on the tetracycline susceptibility or resistance of M-phenotype isolates of S. pyogenes (11, 22); and they are all chimeric in nature; i.e., they result from a transposon (identical or related to Tn1207.1) inserted into a prophage (6, 22). One of two closely related elements, Tn1207.3 (52,491 bp) (29) or Φ10394.4 (58,761 bp) (5, 6), is found in tetracycline-susceptible isolates integrated into the same chromosomal gene (comEC) and inserted into the same prophage (11), with the only difference being that in Tn1207.3, Tn1207.1 represents the left end of the element, whereas in Φ10394.4 there is an additional left-hand region of ∼6 kb. Since this region has been reported to be quite variable in size (6), Tn1207.3 could represent the end of the variability range in which it is completely lacking (22). In tetracycline-resistant isolates, tetracycline resistance is consistently mediated by the tet(O) determinant and mef(A) is linked to tet(O) in a mobile, phage-like element (21, 22). In fact, there are a variety of related tet(O)-mef(A) phage-like elements, in which mef(A) is contained in a range of changeable and defective variants of Tn1207.1 (11, 22). The most common such element, of which Φm46.1 is the typical representative, is not integrated within the comEC gene and has been transferred to an S. pyogenes recipient in mating experiments (21). An ∼12-kb region of Φm46.1 encompassing the tet(O) gene and the Tn1207.1-related transposon has been sequenced (11).

In the study described here, we determined the site of integration into the chromosome, the complete genome sequence and organization, and the ultrastructure of Φm46.1. The genome displayed the distinctive modular arrangement of tailed bacteriophages, and electron microscopic analysis confirmed that it has the distinctive morphology of Siphoviridae family bacteriophages. Phage DNA (55,172 bp) was present in the host cell both as a prophage and as free circular DNA. The sequences of the ORFs of Φm46.1 were compared with those from protein databases.

MATERIALS AND METHODS

Bacterial strain.

S. pyogenes m46 was used in this study. The strain, originally collected as a throat clinical isolate belonging to M type 4 (34), is resistant to both erythromycin [MIC, 16 μg ml⁻¹; M phenotype; mef(A) genotype] and tetracycline [MIC, 64 μg ml⁻¹; tet(O) genotype] and was used in all previous experiments that led to the identification of the genetic linkage between the tet(O) and the mef(A) genes in a mobile, prophage-associated element eventually designated Φm46.1 (3, 11, 21, 22).

Gene detection and amplification experiments.

The principal primer pairs used in the PCR experiments are listed in Table 1. DNA preparation and amplification and electrophoresis of the PCR products were carried out by established procedures and according to the conditions recommended for the use of the individual primer pairs. The Ex Taq system (TaKaRa Bio, Shiga, Japan) was used when the expected sizes of the PCR products exceeded 3 kb.

TABLE 1.

Principal oligonucleotide primer pairs used

Procedure and gene	Primer designation	Sequence (5′-3′)	Source or reference	Product size (bp)
Inverse PCR
tet(O)	TETO-INV1	CTGGTTCTGCAATTGCACCA	This study
tet(O)	TETO-INV2	TTATTAGTTTCTGCAAAGGATG	This study
orf57	INV3	TCTAGGCTGTCAATATTCTC	This study
orf57	INV4	CATATACGAGAAATTCTTAG	This study
orf54	INV5	TAATGCTGACGCAACCACAC	This study
orf55	INV6	GTTTGGTCTATGGGCATATT	This study
Φm46.1 chromosome integration site
spy1198	LYT-for	GTAAAGATGACGAAGGAGATT	This study	4,425
mef(A)	MEFA2	TTCTTCTGGTACTAAAAGTGG	31
tet(O)	TETO1	AACTTAGGCATTCTGGCTCAC	27	6,573
spy1195	THIO-rev	GTAAAGATGACGAAGGAGATT	This study
Phage sequencing
mef(A)	MEFA1	AGTATCATTAATCACTAGTGC	31	16,518
orf22	HELY-R	CCCATGTCTAGGATGACTGCT	This study
orf19	PRI-for	AAGCAGAGAAGAAGTACAAGG	This study	17,679
orf46	HP-rev	GTGAAGATTTCTTCACTCGCT	This study
orf45	MJT-for	ATGTTCCGTTTTGAAGGGGATAA	This study	10,503
orf54	LYS-rev	GGTTGAACTGGGTGTCGAGGG	This study
orf53	HOL-for	TTGGTCATCTGATTGATACAGC	This study	5,893
tet(O)	TETO2	TCCCACTGTTCCATATCGTCA	27

Phage DNA sequencing and sequence analysis.

Long PCR experiments, inverse PCR, and primer-walking techniques were used to obtain overlapping fragments of the Φm46.1 prophage with primers designed from Φ10394.4 (EMBL accession no. NC_006086). Inverse PCR was carried out as described by Sambrook and Russell (28); HindIII-, MboI-, or SexAI-digested genomic DNA (all endonucleases were from Roche Applied Science, Basel, Switzerland) was ligated and used as the template in the PCR assays (Table 1). All PCR products used for sequence analysis were purified by using Montage PCR filter units (Millipore Corporation, Bedford, MA). Amplicons were sequenced (bidirectionally or by primer walking) with an ABI Prism sequencer (Perkin-Elmer Applied Biosystems, Foster City, CA) and dye-labeled terminators. The sequences were analyzed by using the Sequence Navigator software package (Perkin-Elmer Applied Biosystems). ORF analysis was performed by using the software ORF Finder available online (http://www.ncbi.nlm.nih.gov/projects/gorf/). The criteria used to designate a potential ORF were the existence of a start codon and a minimum coding size of 50 amino acids. Sequence similarity and conserved domain searches were carried out by using the tools (BLAST and CDART) available online at the National Center for Biotechnology Information of the National Library of Medicine (Bethesda, MD) (http://www.ncbi.nlm.nih.gov/).

Electron microscopy.

For phage induction, S. pyogenes strain m46 was treated with 0.2 μg ml⁻¹ mitomycin C (Sigma Chemical Co., St. Louis, MO) for 4 h at 37°C. The bacteria were then centrifuged at 8,000 × g for 15 min, the supernatant was filtered through a 0.45-μm-pore-size nylon membrane (Millipore) and centrifuged at 141,000 × g for 2 h at 10°C, and the pellet was suspended in 1 ml of phage suspension buffer (0.15 M NaCl, 10 mM Tris HCl [pH 7.5], 5 mM MgCl₂, 1 mM CaCl₂). A drop of sample was allowed to absorb to carbon-coated 300 mesh grids for 1 min, and 1 drop of water was used to wash the grids. The sample was stained with 4 drops of 3% aqueous uranyl acetate (Sigma) for 30 s. The excess liquid was wicked off and the grids were air dried. The samples were viewed under a CM10 transmission electron microscope (Philips, Eindhoven, The Netherlands) operating at 80 kV with a magnification of ×53,000.

Nucleotide sequence accession number.

The complete genome sequence of Φm46.1, with its chromosome integration site, has been submitted to the EMBL database under accession no. FM864213.

RESULTS AND DISCUSSION

Bacteriophage Φm46.1 integration site.

Use of the portion of Φm46.1 that included the tet(O) and mef(A) genes (11) as a query in a BLASTN analysis of the ∼12-kb sequence—previously determined in our laboratory (EMBL accession no. AJ715499)—yielded a 308-bp region common to the Streptococcus agalactiae A909 genome sequence (EMBL accession no. CP000114) (33). In our sequence, this region is upstream of the Tn1207.1-like transposon. In the S. agalactiae A909 genome, the region (bases 652,826 to 653,124) carries the 3′ end (36 bp) of the rumA gene, which encodes a 23S rRNA uracil methyltransferase, and part of the intergenic region (272 bp) between rumA (SAK_0718 locus) and the adjacent gene (SAK_0719 locus). It is worth noting that the S. agalactiae rumA gene is homologous to a 23S rRNA uracil methyltransferase gene detectable in all S. pyogenes genomes sequenced so far; the highest degree of homology (73%) was with the gene from S. pyogenes MGAS10750 (EMBL accession no. CP000262), a strain that also shares M type 4 with S. pyogenes m46 (9). PCR experiments were carried out with two primer pairs, one for the left junction and one for the right junction, to explore the possibility that this region was the Φm46.1 chromosome integration site (Fig. 1). The two primers for the left junction were LYT-for, internal to Spy1198, an ORF of the MGAS10750 genome just upstream of the 23S rRNA uracil methyltransferase gene (Spy1197), and MEFA2, internal to the mef(A) gene (Fig. 1A). The two primers for the right junction were TETO1, internal to the tet(O) gene, and THIO-rev, internal to Spy1195 of the MGAS10750 genome, located downstream of Spy1197 (Fig. 1B). By pairing primers LYT-for and MEFA2, a 4,425-bp segment at the attL region was amplified from the lysogenic bacterial DNA template. This amplicon sequence was aligned with the Φm46.1 genome (see the next paragraph) and with the MGAS10750 genome. Positions 1,727 to 1,764 of the amplicon were found to be the same as positions 55,156 to 20 of the Φm46.1 genome, and positions 1,701 to 1,744 were found to be the same as positions 1,142,452 to 1,142,409 of the S. pyogenes MGAS10750 genome (Fig. 1A). An almost completely overlapping 18-bp sequence was found in the Φm46.1 and MGAS10750 genomes. By pairing primers TETO1 and THIO-rev, a 6,573-bp segment at the attR region was amplified from the lysogenic bacterial DNA template. Similar alignment assays revealed that positions 5,298 to 5,357 of the amplicon were the same as positions 55,125 to 55,172 of the Φm46.1 genome and that positions 5,341 to 5,361 were the same as positions 1,142,426 to 1,142,393 of the MGAS10750 genome (Fig. 1B). The same 18-bp overlapping sequence found in the Φm46.1 and MGAS10750 genomes was also detected when the left junction was analyzed. This 18-bp sequence, shared by both the phage [between tet(O) and mef(A)] and the host bacterium (near the 3′ end of the 23S rRNA uracil methyltransferase gene), should be the core site, i.e., the critical sequence where the site-specific recombination process presumably takes place. Definition of the core site enabled the integrative reaction and structure relationship between the phage genome and the host chromosome to be deduced according to the integration mechanism elucidated in bacteriophage lambda (12, 13). Interestingly, the 23S rRNA uracil methyltransferase gene identified as the chromosome integration site of Φm46.1 in S. pyogenes m46 is the same as two integrated conjugative elements (ICEs), 2096-RD.2 and 6180-RD.1, in S. pyogenes strains MGAS2096 and MGAS6180, respectively (8).

FIG. 1.

Bacteriophage Φm46.1 integration site. Φm46.1 was integrated into the chromosome of S. pyogenes m46 within a 23S rRNA uracil methyltransferase gene. This gene, detected in all S. pyogenes genomes sequenced to date, encodes a protein having the highest degree of amino acid similarity to the amino acid sequence of a protein encoded by the corresponding gene from S. pyogenes MGAS10750 (EMBL accession no. CP000262), which, like S. pyogenes m46, belongs to M type 4. Chromosomal ORF designations and aligned host genome sequences are thus from S. pyogenes MGAS10750. (A) Left junction. (Above) ORF map; chromosomal ORFs are indicated as black arrows, and Φm46.1 ORFs are indicated as white arrows, with mef(A) being indicated by a checkered arrow. (Below) Alignment of the amplified sequence (64 bp) at the attL region with the Φm46.1 and S. pyogenes MGAS10750 genomes. Numbers above and below the attL sequence refer to base positions in the amplicon obtained with primers LYT-for and MEFA2 (4,425 bp). (B) Right junction. (Above) ORF map; chromosomal ORFs are indicated as black arrows and Φm46.1 ORFs are indicated as white arrows, with tet(O) being indicated by a striped arrow. (Below) Alignment of the amplified sequence (64 bp) at the attR region with the Φm46.1 and S. pyogenes MGAS10750 genomes. Numbers above and below the attR sequence refer to base positions in the amplicon obtained with primers TETO1 and THIO-rev (6,573 bp). In the almost completely overlapping 18-bp sequence shared by the bacteriophage and the host bacterium genomes and representing the core site, nucleotides are indicated with capital letters.

Crucially, identification of the core site provided the knowledge that the phage attachment sequence (attP) falls right in the region between tet(O) and mef(A) in the previously sequenced ∼12-kb DNA fragment of Φm46.1. Therefore, both that sequence and the previously disclosed tet(O)-mef(A) linkage (21), with tet(O) being found ∼5.5 kb upstream of mef(A), were from an unintegrated, circular form of Φm46.1, whereas in the integrated form, tet(O) is downstream of and far more distant from mef(A), with the former gene being close to the right end and the latter gene being close to the left end of the prophage.

Organization of the Φm46.1 genome.

The complete genome sequence of Φm46.1 was determined. Its size was 55,172 bp. The G+C content was 40.0%. Genome sequence analysis revealed the presence of 63 ORFs, 51 of which were transcribed in the same direction and 12 of which were transcribed in the opposite direction. The Φm46.1 ORF map is shown in Fig. 2, and the major characteristics of the ORFs are detailed in Table 2. The ORF sequences were compared with sequences from protein databases by using the BLASTP program. On the basis of these comparisons, most of the ORFs could be assigned to different modules, according to a modular organization typical of tailed phages (14). Interestingly, both ends of the Φm46.1 genome were represented by nonphage DNA.

FIG. 2.

ORF map and genome organization of the Φm46.1 prophage and its alignment with the genome maps of Φ10394.4 from S. pyogenes MGAS10394 and λSa04 from S. agalactiae A909. The ORFs, depicted as arrows pointing in the direction of transcription, are numbered consecutively (orf1 to orf63 in Φm46.1, with some predicted functions being reported in Table 2; orf1 to orf61 in Φ10394.4; and orf1 to orf41 in λSa04). White arrows indicate ORFs likely of phage origin. Black arrows indicate ORFs likely of chromosomal origin, except for mef(A) (checkered arrow) in transposons Tn1207.1 and Tn1207.1-like and tet(O) (striped arrow) in the fragment from ICE 2096-RD.2. In Φm46.1, phage functional modules are identified by bars.

TABLE 2.

Genome organization of Φm46.1

ORFa	Start position (bp)	Stop position (bp)	Size (no. of amino acids)	Predicted function	BLASTP analysisb
					Most significant database match	EMBL accession no.	% Amino acid identity (% amino acid similarity)
orf1	558	1082	174	Acetyltransferase	Ribosomal protein serine acetyltransferase (Bacillus thuringiensis ATCC 35646)	ZP_00740204.1	58 (77)
orf2	1113	1466	117		Hypothetical protein (Streptococcus dysgalactiae subsp. equisimilis)	CAJ45366.1	100 (100)
mef(A)	2280	3497	405	Macrolide efflux protein	Macrolide efflux protein (prophage Φ10394.4 from Streptococcus pyogenes MGAS10394)	YP_060484.1	99 (99)
orf4	3617	5080	487	ABC transporter	Macrolide ABC transporter ATPase (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060483.1	99 (99)
orf5	5500	5198	100		Hypothetical protein (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060482.1	86 (88)
orf6	5855	5487	122		Hypothetical protein (Streptococcus salivarius)	CAC87435.2	97 (97)
orf7	7267	5852	471	ImpB/MucB/SamB family protein	ImpB/MucB/SamB family protein (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060480.1	96 (98)
orf8	7617	7390	75		Hypothetical protein (S. pyogenes)	AAR83194.1	92 (96)
orf9	8309	7620	229	Transcriptional repressor	Phage transcriptional repressor (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060479.1	85 (94)
orf10	8568	8413	51		No significant homology found
orf11	8597	9250	217		No significant homology found
orf12	9333	10421	362		No significant homology found
orf13	10756	11325	189		Hypothetical protein (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060474.1	95 (97)
orf14	13318	11363	651	DNA polymerase	Phage-related DNA polymerase (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060473.1	94 (96)
orf15	13534	13367	55		Hypothetical protein (S. pyogenes)	AAR83202.1	90 (96)
orf16	14125	13553	190		Hypothetical protein (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060472.1	99 (99)
orf17	15308	14106	400		Hypothetical protein (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060471.1	93 (96)
orf18	15543	15220	107		Hypothetical protein (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060470.1	87 (91)
orf19	15930	17762	610	Phage-associated DNA primase	Phage DNA polymerase (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060469.1	95 (97)
orf20	17857	18186	109		No significant homology found
orf21	18506	18787	93		Hypothetical protein (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060468.1	96 (96)
orf22	18768	20144	458	DNA helicase	Phage-related DNA helicase (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060467.1	95 (97)
orf23	20137	20613	158		Hypothetical protein (prophage λSa04 from Streptococcus agalactiae A909)	YP_329362.1	75 (90)
orf24	20775	20990	71		Hypothetical protein (S. pyogenes)	AAR83212.1	84 (94)
orf25	21038	22075	345	S-Adenosylmethionine synthetase	S-Adenosylmethionine synthetase (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060465.1	94 (98)
orf26	22108	22452	114	HNH endonuclease	No significant homology found
orf27*	22539	22877	112	HNH endonuclease	Phage endonuclease (prophage Φ10394.4 from S. pyogenes MGAS10394)	YP_060464.1	95 (98)
orf28	23176	23637	153		Hypothetical protein (Clostridium thermocellum ATCC 27405)	YP_001038144.1	45 (61)
orf29	23537	24865	442	DNA modification methylase	DNA methylase (prophage λSa04 from S. agalactiae A909)	YP_329365.1	90 (95)
orf30	24862	26115	417	Cytosine C-5-specific DNA methylase	Methyltransferase C-5 (prophage λSa04 from S. agalactiae A909)	YP_329366.1	93 (98)
orf31	26183	26464	93		No significant homology found
orf32	26902	26501	133		No significant homology found
orf33	26993	27430	145	Phage terminase, small subunit	Phage terminase, small subunit (S. agalactiae CJB111)	ZP_00788389.1	97 (100)
orf34	27427	29019	530	Phage terminase, large subunit	Terminase, large subunit (prophage λSa04 from S. agalactiae A909)	YP_329369.1	94 (96)
orf35	29090	29347	85		Hypothetical protein (S. agalactiae CJB111)	ZP_00787618.1	94 (96)
orf36	29344	29715	123	Prophage maintenance system killer protein	Doc protein (S. agalactiae CJB111)	ZP_00787605.1	90 (98)
orf37	29856	31139	427	Phage portal protein	HK97 family portal protein (prophage λSa04 from S. agalactiae A909)	YP_329373.1	91 (97)
orf38	31132	31551	139	Clp protease	ClpP protease family protein (S. agalactiae CJB111)	ZP_00787614.1	78 (87)
orf39	31643	31843	66		No significant homology found
orf40	31848	33053	401	Phage capsid	HK97 family major capsid protein (prophage λSa04 from S. agalactiae A909)	YP_329375.1	90 (95)
orf41	33056	33313	85		Hypothetical protein (prophage λSa04 from S. agalactiae A909)	YP_329376.1	78 (91)
orf42	33313	33651	112	Phage head-tail adaptor	Putative head-tail adaptor (prophage λSa04 from S. agalactiae A909)	YP_329377.1	68 (78)
orf43	33644	34012	122		Protein 37 (prophage pi2 from S. agalactiae CJB111)	ZP_00787632.1	66 (82)
orf44*	34029	34346	105		Putative protein 38 (prophage pi2 from S. agalactiae CJB111)	ZP_00787610.1	68 (81)
orf45	34336	34917	193	Phage major tail protein	φ13 family major tail protein (prophage λSa04 from S. agalactiae A909)	YP_329380.1	95 (97)
orf46	34929	35348	139		Conserved hypothetical protein (S. agalactiae CJB111)	ZP_00787594.1	75 (92)
orf47	35531	38389	952	Phage-related minor tail protein	TP901 family tail tape measure protein (prophage λSa04 from S. agalactiae A909)	YP_329383.1	46 (60)
orf48	38386	39108	240	Siphovirus tail component protein	Hypothetical protein (Streptococcus pneumoniae SP3-BS71)	ZP_01819144.1	60 (75)
orf49	39387	42521	1044	PblB phage-related protein	Putative PblB (prophage λSa2 from S. agalactiae 2603V/R)	NP_688832.1	45 (61)
orf50	42505	43656	383		Putative PblB (prophage λSa2 from S. agalactiae 2603V/R)	NP_688832.1	39 (60)
orf51	43669	43875	68		Conserved domain protein (Streptococcus suis 89/1591)	ZP_00874991.1	53 (73)
orf52	43881	44249	122		Conserved hypothetical protein (S. suis 89/1591)	ZP_00875394.1	57 (79)
orf53	44227	44622	131	Phage holin 4	Holin (S. dysgalactiae subsp. equisimilis)	ABV55415.1	88 (89)
orf54	44629	45705	358	LysM, lysin domain protein	Amidase/phage cell wall hydrolase (S. dysgalactiae subsp. equisimilis)	ABV55414.1	94 (96)
orf55	45734	46099	121	Amidase	Amidase/phage cell wall hydrolase (S. dysgalactiae subsp. equisimilis)	ABV55414.1	86 (91)
orf56	46322	47095	257	Site-specific recombinase	Site-specific recombinase resolvase family protein (prophage λSa04 from S. agalactiae A909)	YP_329390.1	70 (86)
orf57	47419	48807	462	Site-specific recombinase	Site-specific recombinase resolvase family protein (prophage λSa04 from S. agalactiae A909)	YP_329391.1	76 (86)
orf58	49075	49449	124	Transposase-like protein	TnpV (S. pyogenes MGAS2096)	YP_600746.1	95 (95)
tet(O)	49816	51735	639	Tetracycline resistance protein	Tet(O) (S. pneumoniae)	CAA69103.1	99 (99)
orf60	51787	51960	57		Cpp2 (Campylobacter jejuni subsp. jejuni)	YP_063447.1	100 (100)
orf61	52351	53172	273		Hypothetical protein (C. jejuni subsp. jejuni)	YP_247563.1	98 (100)
orf62	53334	54251	305	AraC, bacterial transcription activator	AraC family transcription regulator (Clostridiun difficile)	ZP_03125555.1	82 (90)
orf63	54723	55079	118		No significant homology found

^aAsterisks indicate ORFs with unusual start codons, i.e., start codons other than ATG (ATC in orf27 and GTG in orf44).

^bFor each ORF, only the most significant homology detected is listed.

(i) Initial portion (1 to 248 bp).

The Φm46.1 prophage started with a short sequence (248 bp) that preceded the Tn1207.1-like transposon. The first 22 bp of this sequence restored the gene encoding the 23S rRNA uracil methyltransferase, whereas its first 222 bp displayed 88% homology with a sequence close to the left end of the pneumococcal mega element (EMBL accession no. AF274302).

(ii) Tn1207.1-like transposon (249 to 7,267 bp).

As previously described in the same S. pyogenes isolate (11), the first two ORFs of the reference Tn1207.1 transposon (EMBL accession no. AF227520) are not found in the Tn1207.1-like transposon of Φm46.1. Thus, the acetyltransferase-encoding ORF originally designated orfD (11) was the first ORF (orf1) of the Φm46.1 genome. The following six ORFs, here renamed orf2 to orf7, include macrolide efflux genes mef(A) (orf3) and msr(D) (orf4).

(iii) Phage modules (7,390 to 48,807 bp).

orf8 and orf9, which represent the beginning of the actual prophage-like region, probably corresponded to the left part (7,390 to 8,309 bp) of the lysogeny control module, which in Φm46.1 appears to be divided into two portions due to the insertion of a segment including a tet(O)-containing fragment from ICE 2096-RD.2 (8) and the mef(A)-containing Tn1207.1-like transposon. The DNA replication module (11,363 to 20,144 bp), spanning from orf14 to orf22, was highly conserved in the three mef(A)-carrying phage-like elements Φm46.1, Tn1207.3, and Φ10394.4. The DNA modification module (22,539 to 26,115 bp) spanned from orf27 to orf30. The DNA packaging and head morphogenesis module (26,993 to 33,651 bp) spanned from orf33 to orf42. Inside but apparently alien to the module, orf35 and orf36 seemed to be related to a toxin-antitoxin (TA) system (26) and might contribute to the stable maintenance of Φm46.1 in the bacterial population. It is noteworthy that the two putative TA-related genes partially overlapped. The tail morphogenesis module (34,336 to 39,108 bp) was formed by four ORFs (orf45 to orf48). Just downstream of this module, orf49 and orf50 (39,387 to 43,656 bp) encoded proteins exhibiting low levels of amino acid identity to distinct portions (for the presence of a stop codon) of a PblB protein. Proteins PblA and PblB act as phage-borne virulence factors by promoting bacterial binding to human platelets (7). The host cell lysis module (44,227 to 46,099 bp) was formed by three ORFs (orf53 to orf55), all of which were shared by ICE Sde3396, a newly described genetic element from Streptococcus dysgalactiae subsp. equisimilis (17). Downstream of the host cell lysis module, orf56 and orf57 (46,322 to 48,807 bp) encoded two site-specific recombinases (serine recombinases belonging to the resolvase family), i.e., enzymes that are usually found in the lysogeny control module (25). In Φm46.1, the two recombinase ORFs might have been separated from the rest of the lysogeny module by the insertion into the unintegrated phage DNA of a segment including the ICE 2096-RD.2 fragment and the Tn1207.1-like transposon.

(iv) ICE 2096-RD.2 fragment (49,017 to 52,098 bp).

A ∼3-kb fragment highly homologous (98%) to a region of 2096-RD.2, a 63-kb ICE-like element of S. pyogenes MGAS2096 harboring several antibiotic resistance genes (8), was found immediately downstream of the two site-specific recombinase-encoding ORFs. This region, which in the MGAS2096 genome spans from bases 1,101,217 to 1,103,555 (EMBL accession no. CP000261), in Φm46.1 includes three ORFs, orf58, orf59, and orf60, corresponding to Spy1150, Spy1149, and Spy1148, respectively, in the MGAS2096 genome. orf59 was the tetracycline resistance gene tet(O), whose presence in S. pyogenes we first demonstrated (21) and further investigated (11) in strain m46. It is worth noting that inverse PCR assays were needed to sequence the unknown DNA region upstream of the tet(O) gene (from approximately orf53 to orf58).

(v) The last three ORFs (52,351 to 55,079 bp).

The final region of the Φm46.1 prophage included the last three ORFs (orf61, orf62, and orf63), previously designated orfA, orfB, and orfC, respectively (11). Immediately downstream of orf63, a 76-bp sequence displayed 91% homology with a sequence at the right end of the pneumococcal mega element. Consideration of this short area of homology and the one (222 bp) described above highlights an intriguing correspondence between the ends of the Φm46.1 prophage and those of the mega element.

Comparative phage genomics.

BLASTP analysis revealed that the proteins of Φm46.1 had very high levels of amino acid sequence similarity to the amino acid sequences of proteins from other prophages, namely, Φ10394.4 of S. pyogenes and λSa04 of S. agalactiae. The two phages have quite a different prominence in the literature. Φ10394.4, detected in the genome of S. pyogenes MGAS10394 (EMBL accession no. CP000003), has been the subject of extensive specific investigations (5, 6, 11, 19, 20, 22) and is also found in GenBank under a separate accession number (GenBank accession no. AY445042). In contrast, λSa04, detected in the genome of S. agalactiae A909, is mentioned only in the deposited sequence of the entire bacterial genome (GenBank accession no. CP000114), but it has never been the subject of specific investigations and even went unmentioned in the paper in which the genome analysis of S. agalactiae A909 was described (33). The relationship of Φm46.1 with Φ10394.4 and λSa04, documented as database matches in Table 2, is illustrated in Fig. 2 by the alignment of the ORF map of Φm46.1 with the maps of the two other prophages (only amino acid identities ≥70% are reported).

(i) Φm46.1 and Φ10394.4 prophage comparison.

Φm46.1 and Φ10394.4 shared three major areas of homology, namely (from left to right), two clusters of closely related genes and a third cluster of moderately related genes. The first two clusters were separated by an area of nonhomology represented in Φ10394.4 by four ORFs, i.e., a restriction-modification cassette (orf16 to orf18) and orf19 (19), and in Φm46.1 by three unrelated ORFs (orf10 to orf12) (3). It is worth noting that while the DNA of tetracycline-resistant M-phenotype isolates, which typically carry Φm46.1 or a related tet(O)-mef(A) element, is usually digested by SmaI, tetracycline-susceptible M-phenotype isolates, which typically carry Φ10394.4 or Tn1207.3, are SmaI nontypeable because a DNA-modifying methyltransferase encoded by the spyIM gene (orf16 in Φ10394.4) acts on the SmaI recognition sequence and makes the DNA refractory to cleavage by SmaI (3, 19, 20).

In Φm46.1, the first cluster included part of the Tn1207.1-like transposon (orf2 to orf7) and the left portion of the lysogeny module (orf8 and orf9). In Φ10394.4, these ORFs corresponded to orf8 to orf15; the levels of amino acid identity were very high (mostly >90%). In Φm46.1 the second cluster spanned from orf13 to orf27, including the DNA replication module and the beginning of the DNA modification module. In Φ10394.4, these ORFs corresponded to orf20 to orf33; the levels of amino acid identity were >90% for most correlated ORFs. The third cluster of Φm46.1 spanned from orf29 to orf46, including part of the DNA modification module, the DNA packaging and head morphogenesis module, and the beginning of the tail morphogenesis module. In Φ10394.4, these ORFs corresponded to orf35 to orf51; the levels of amino acid identity were lower (<90%) than those for the first two clusters.

(ii) Φm46.1 and λSa04 prophage comparison.

Φm46.1 and λSa04 shared three major areas of homology, namely (from left to right), a first cluster of moderately related genes, a second cluster of closely related genes, and a third cluster (in fact, a couple of ORFs) of moderately related genes.

In Φm46.1 the first cluster spanned from orf13 to orf27, corresponding in λSa04 to orf1 to orf14; the levels of amino acid identity were <90% for most correlated ORFs. The second cluster of Φm46.1 spanned from orf29 to orf46, corresponding in λSa04 to orf15 to orf31; the levels of amino acid identity were >90% for most correlated ORFs. Interestingly, in both Φm46.1 (orf35 and orf36) and λSa04 (orf20 and orf21), this second cluster of genes included two putative TA-related genes that were lacking in Φ10394.4. It is remarkable that in the two bacteriophages the two couples of TA-related genes, even though they encoded proteins with no significant amino acid sequence identities, were found in the same position, i.e., immediately downstream of an ORF (orf34 in Φm46.1, orf19 in λSa04) encoding a large terminase subunit. In Φm46.1, the third area of homology was represented by orf56 and orf57 (encoding the two site-specific recombinases). In λSa04, these two ORFs corresponded to orf40 and orf41, with the levels of amino acid identity being 70% and 76%, respectively.

Phage ultrastructure.

After induction with mitomycin C, electron microscopic analysis revealed phage particles with the typical icosahedral head and tail morphology of the Siphoviridae (Fig. 3), the most common phage family in streptococci (1). That the phage particles were indeed Φm46.1 is consistent with the findings of pulsed-field gel electrophoresis experiments, which demonstrated that it is the only prophage carried by S. pyogenes m46 that is inducible by mitomycin C (data not shown). On the other hand, the modular organization of the Φm46.1 genome was that typical of tailed phages (14), and a similar ultrastructure has been reported for Φ10394.4 (6).

FIG. 3.

Electron microscopic analysis of phage particles purified from S. pyogenes m46.

Concluding remarks.

Φm46.1, whose complete sequence analysis and final characterization were the aim of this study, is the recognized representative of the most common variant of the so-called tet(O)-mef(A) elements, responsible for efflux-mediated erythromycin resistance in tetracycline-resistant S. pyogenes isolates (35). In an early study (21), genes mef(A) and tet(O) were detected in S. pyogenes m46, were cotransferred to a susceptible recipient of the same species, and were found to be linked, with mef(A) being detected ∼5.5 kb downstream of tet(O); a single new DNA insertion into the transconjugants with the mef(A) tet(O) genotype was consistent with a chromosomal location of the two genes. Subsequent investigations (11) demonstrated a variety of closely related tet(O)-mef(A) elements harboring a range of changeable and defective variants of Tn1207.1, of which the element detected and originally investigated in strain m46 was the most common. Mitomycin C induction experiments showed that the tet(O)-mef(A) elements were in fact prophages (22). The present study has conclusively clarified that the chromosome integration site is within the 23S rRNA uracil methyltransferase gene (near its 3′ end). In the host cell, Φm46.1 exists not only as a prophage but also as free circular DNA. While in the latter form tet(O) is found ∼5.5 kb upstream of mef(A), in the integrated form it is close to the right end of the prophage (orf59 of 63 ORFs), ∼46.3 kb downstream of mef(A), which is close to the left end of the prophage (the third ORF). Accordingly, the designation “mef(A)-tet(O) elements” would be more appropriate than the one “tet(O)-mef(A) elements” (11, 22, 35), which has so far been used to indicate these genetic elements.

It is well established that each prophage is a unique entity that not only shares blocks of sequences with different prophages but that also possesses unique sequences with no known homologies in current databases. This genetic mosaicism is a hallmark of tailed phages and reflects an unusually high degree of horizontal genetic exchange in phage evolution (23, 24). Genome mosaicism is characterized by the presence of novel sequence joints, in which the similarity between two phages abruptly ceases; other phages and bacterial hosts may be the sources for such new sequences (14). Φm46.1 and Φ10394.4, whose genomes are highly mosaic, appear to fit well into the general model. One explanation proposed for the origin of Φ10394.4 was that an erythromycin-susceptible S. pyogenes precursor strain containing a prophage might have acquired the mef(A)-containing Tn1207.1 transposon, possibly from other Streptococcus species present in the upper respiratory tract (6). The latter surmise is supported by the short homologous sequences shared by the Φm46.1 prophage and the pneumococcal mega element at both their left and right ends. Starting from this mef(A)-carrying ancestor, the Φm46.1 and Φ10394.4 genomes may have diversified by independently exchanging genetic information and shuffling genetic modules. Major examples of such diversification (in Φm46.1 compared to Φ10394.4) are the lack of the initial ∼6-kb left-hand region, also lacking in Tn1207.3; orf1, in place of the initial portion of Tn1207.1; three new ORFs (orf10 to orf12) in place of the restriction-modification cassette; a putative TA system (orf35-orf36); the host cell lysis module (orf53 to orf55), shared by and possibly acquired from ICE Sde3396; the tet(O)-containing fragment (orf58 to orf60), shared by and possibly acquired from ICE 2096-RD.2; and the last three ORFs (orf61 to orf63), likely of chromosomal origin. In particular, as far as the two antibiotic resistance genes carried by Φm46.1 are concerned, the present findings support the hypothesis of the stepwise acquisition of mef(A) and tet(O) (11).

These data are consistent with the current belief in the key role of bacteriophages in the evolution of important bacterial pathogens: on the one hand, by carrying a versatile range of new genetic information within and between bacterial species and on the other hand, by rearranging existing genetic information in unique combinations (10). This is particularly true of S. pyogenes, a species distinguished by a unique propensity to acquire and reshuffle phage-encoded virulence and resistance determinants (4). The highly mosaic genome of Φm46.1, in which different segments are related to distinct streptococcal phages, entails that phages of S. pyogenes continue to exchange genetic material, contributing to the extraordinary horizontal transfer of mobile genetic elements in this species. Such a formerly underestimated role of prophages in clonal diversification has even led some investigators to question the validity of the conventional associations of certain M serotypes with specific clinical manifestations of S. pyogenes infections and to suggest the need for a new classification scheme that better represents the genetic bases of S. pyogenes virulence (2).