Identification of the Geobacter metallireducens BamVW Two-Component System, Involved in Transcriptional Regulation of Aromatic Degradation

Abstract

Regulation of aromatic degradation in obligate anaerobes was studied in the Fe(III)-respiring model organism Geobacter metallireducens GS-15. A two-component system and a σ⁵⁴-dependent promoter were identified that are both involved in the regulation of the gene coding for benzoate-coenzyme A ligase, catalyzing the initial step of benzoate degradation.

Geobacter metallireducens GS-15 is an obligately anaerobic Fe(III)-respiring deltaproteobacterium with the potential to remediate environments contaminated with aromatic compounds (8, 9). A chromosomal 300-kb catabolic island has been shown to encode pathways for degradation of different aromatic compounds, such as benzoate, p-hydroxybenzoate, p-cresol, or phenol, which are all converted to the central intermediate benzoyl coenzyme A (CoA) (3, 14, 15, 16). The benzoate-induced gene cluster II contains the bamY gene encoding the benzoate-CoA ligase that generates benzoyl-CoA as the initial activating step in the anaerobic catabolism of benzoate. In the vicinity of the bamY gene, the bamV and bamW genes were suggested to control the expression of other bam genes (Fig. 1A) (15). The expression of the bamW gene was specifically increased by aromatic compounds, such as p-cresol, p-hydroxybenzoate, and benzoate (13, 15), suggesting that it plays a role in the catabolism of aromatics in G. metallireducens GS-15. In this work, we study the regulatory system that controls the expression of a catabolic gene involved in the degradation of aromatics in a strict anaerobic bacterium.

FIG. 1.

Transcriptional control of bamY in G. metallireducens GS-15. (A) Proposed model for the regulation of bamY. The bamY gene (Gmet_2143) is shown in black; bamV (Gmet_2146) and bamW (Gmet_2145) genes are represented with gray arrows; other bam genes are represented with white arrows. The aromatic inducers interact with BamV, triggering its autophosphorylation. Phosphate (P) is transferred to the BamW regulator that is then able to activate the transcription (+) at the Py promoter in collaboration with σ⁵⁴ RNA polymerase holoenzyme (triangle). (B) View of the Py promoter from positions −146 to +45 is shown. The major transcription start site (+1) and the inferred −12 and −24 boxes are indicated. The ribosome-binding site (RBS) is boxed, and the ATG start codon of the bamY gene is indicated in italics. (C) Identification of the putative transcription start site(s) in the Py promoter. Total mRNA was isolated from G. metallireducens GS-15 cells grown anaerobically in 3 mM p-hydroxybenzoate (lane 1) or 20 mM acetate (lane 2) by using 50 mM Fe(III) citrate as the terminal electron acceptor (15). The sizes of the larger extension product (thick arrow) and those of the shorter extension products (thin arrows) were determined by comparison with the DNA sequencing ladder (lanes A, T, C, and G) of the Py promoter. Primer extension and sequencing reactions were performed with oligonucleotide GeobamY 3′.2 (GCTTGTCGCCTCTCCCCTCGC) that hybridizes in the coding strand, as previously described (1).

BamVW are the specific transcriptional activators of bamY.

To study the expression of the bamY gene, its 5′ region, the Py promoter, was cloned as a translational fusion with the lacZ reporter gene. The Py promoter was PCR amplified from the G. metallireducens GS-15 genome by using oligonucleotides 5′BCoAGeo (5′-CGGTACCGGTTTGTTCATCCTCTCCCCG-3′) and 3′BCoAGeo (5′-GCTCTAGACCCATTGTGGACCTCCGGCAGC-3′) and was cloned into the pSJ3 promoter probe vector (1), generating plasmid pSJ3Py. The Py::lacZ fusion was also subcloned into the pUTminiTn5Km2 vector (1), which was then used to deliver by transposition the corresponding translational fusion into the chromosome of the host strain Escherichia coli AFMC as described previously (1). We then monitored β-galactosidase activity in E. coli AFMCPy (Py::lacZ) cells harboring plasmid pCK01BamVW that contains the bamVW genes cloned under the control of the Plac promoter in the pCK01 vector (1). To control the expression of the bamVW genes, we used plasmid pIZ1016, which produces the LacI repressor (12). The induction of the bamVW genes into E. coli AFMCPy(pCK01BamVW, pIZ1016) cells was achieved by the addition of 0.5 mM IPTG (isopropyl-β-d-thiogalactopyranoside) into the culture medium. As shown in Fig. 2A, a minor induction of the Py::lacZ expression is observed in permeabilized cells grown anaerobically in IPTG-containing minimal medium. However, only in the presence of the aromatic substrate benzoate, p-cresol, or p-hydroxybenzoate (which are all funneled to the common benzoyl-CoA intermediate in G. metallireducens GS-15 [13, 15]) was the expression of Py::lacZ significantly induced (Fig. 2A).

FIG. 2.

Expression of the Py::lacZ fusion. (A) β-Galactosidase activity of E. coli AFMCPy cells, which contain a chromosomal insertion of the mini-Tn5 transposon expressing the Py::lacZ translational fusion, harboring plasmid pIZ1016 and plasmid pCK01BamVW (VW), pCK01BamV (V) or pBBR5BamW (W). Km^r, kanamycin resistance; T7, T7 phage transcriptional terminator. Cells were grown anaerobically until stationary phase in 30 mM glycerol-containing M63 minimal medium in the absence (white bar) or presence (black bars) of 0.5 mM IPTG. Benzoate (Bz; 1 mM), 1 mM p-hydroxybenzoate (pBz), 0.5 mM p-cresol (pCr), or 0.5 mM either toluene, m-xylene, phenylacetate, benzylalcohol, phenol, benzaldehyde, p-toluate, or p-xylene (indicated as Ar) was added to the culture medium from the start of the growth. (B) β-Galactosidase activity of E. coli YMC10 (YMC10) and its isogenic E. coli TH1 rpoN (TH1) strains harboring plasmids pSJ3Py (Py::lacZ) and pCK01BamVW. Ap^r, ampicillin resistance; ori, ColE1 replication origin. Cells were grown anaerobically as indicated above in the absence (white bars) or presence (black bars) of 1 mM 4-hydroxybenzoate. β-Galactosidase assays with permeabilized cells were performed as reported previously (1).

To check whether both bamV and bamW were necessary for the activation of Py, these genes were cloned and expressed independently in two compatible plasmids—i.e., pCK01BamV, a pCK01 derivative harboring the bamV gene, and pBBR5BamW, a pBBR1MCS5 derivative harboring the bamW gene. Neither E. coli AFMCPy(pCK01BamV, pIZ1016) nor E. coli AFMCPy(pBBR5BamW, pIZ1016) cells anaerobically grown in the presence of IPTG and p-hydroxybenzoate gave a significant β-galactosidase activity (Fig. 2A), suggesting that both BamW and BamV have to act together to activate the Py promoter.

The N-terminal region (residues 1 to 340) of BamV shows two putative transmembrane helices flanking a periplasmic sensory domain (residues 29 to 318) similar to that of the C₄-dicarboxylate DctB membrane sensor (4). The C-terminal region (residues 377 to 603) shows significant similarity to the cytoplasmic kinase core of NtrB histidine kinases (5, 10). BamW shows a clear similarity to response regulators of the NtrC/DctD subfamily, including the three functional domains: (i) the N-terminal receiver domain (residues 1 to 114) containing the putative Asp-52 phosphoacceptor residue; (ii) the central AAA+ ATPase domain (residues 143 to 312) for transcriptional activation of σ⁵⁴-dependent promoters that includes the consensus GAFTGA motif (6), and (iii) the C-terminal domain (residues 403 to 446) with a DNA-binding motif typical of the Fis family of transcriptional regulators (5). Therefore, BamVW could function similarly to the DctBD two-component regulatory system, with BamV acting as a periplasm-sensing histidine kinase that recognizes the aromatic inducer, and BamW representing the transcriptional regulator that receives the signal from BamV and activates Py through the σ⁵⁴ subunit of the RNA polymerase (Fig. 1A).

Py is a σ⁵⁴-dependent promoter.

Primer extension analysis revealed that the transcription initiation site of the larger extension product, which was specifically induced in G. metallireducens GS-15 grown in the presence of p-hydroxybenzoate, was mapped 42 nucleotides upstream of the ATG translation initiation codon of the bamY gene (Fig. 1C). Interestingly, the Py promoter showed the −12/−24 consensus sequence that characterizes a σ⁵⁴-dependent promoter (2) (Fig. 1B). Two additional extension products (Fig. 1C) might account for alternative start sites or processing of the large mRNA transcript. As shown in Fig. 2B, while the wild-type E. coli YMC10 strain showed a p-hydroxybenzoate-inducible expression of the Py::lacZ fusion, almost no β-galactosidase was detected in its isogenic rpoN mutant strain, TH1 (7), suggesting that Py is a σ⁵⁴-dependent promoter.

Orthologous bamVW genes are found in the genomes of other Geobacter strains, e.g., Geobacter sp. strain FRC-32, Geobacter bemidjiensis, and Geobacter sp. strain M21, and putative bamW homologs, ACP50612 and YP_463092, have been detected in the vicinity of the bcl and Syn_1638 genes encoding benzoate-CoA ligases in other strict anaerobes that degrade aromatic compounds (11, 16). Whether two-component regulatory systems controlling the expression of aromatic catabolic clusters in strict anaerobes might have recruited a periplasm-sensing histidine kinase and a σ⁵⁴-dependent transcriptional activator is a tempting speculation that requires further studies.