Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2010 Jan;159(1):1–10. doi: 10.1111/j.1365-2249.2009.04031.x

Laser microdissection-based analysis of cytokine balance in the kidneys of patients with lupus nephritis

Y Wang *, S Ito *, Y Chino *, D Goto *, I Matsumoto *, H Murata *, A Tsutsumi *, T Hayashi *, K Uchida , J Usui , K Yamagata , T Sumida *
PMCID: PMC2802690  PMID: 19807734

Abstract

To determine the cytokine balance in patients with lupus nephritis (LN), we analysed kidney-infiltrating T cells. Renal biopsy samples from 15 systemic lupus erythematosus (SLE) patients were used. In accordance with the classification of International Society of Nephrology/Renal Pathology Society, they were categorized into Class III, Class III+V (Class III-predominant group, n = 4), Class IV, Class IV+V (Class IV-predominant group, n = 7) and Class V (n = 4) groups. The single-cell samples of both the glomelular and interstitial infiltrating cells were captured by laser-microdissection. The glomerular and interstitial infiltrating T cells produced interleukin (IL)-2, IL-4, IL-10, IL-13 and IL-17 cytokines in the Class III-predominant, Class IV-predominant and Class V groups. Interferon-gamma was detected only in the glomeruli of the Class III-predominant and Class V group samples. The expression level of IL-17 was correlated closely with clinical parameters such as haematuria, blood urea nitrogen level, SLE Disease Activity Index scores in both glomeruli and interstitium, urine protein level in glomeruli and serum creatinine and creatinine clearance levels in interstitium. This suggests that the glomerular infiltrating T cells might act as T helper type 1 (Th1), Th2 and Th17 cells while the interstitial infiltrating T cells, act as Th2 and Th17 cells in the Class III-predominant and Class V groups. In contrast, both the glomerular and interstitial infiltrating T cells might act as Th2 and Th17 cells in the Class IV-predominant group. The cytokine balances may be dependent upon the classification of renal pathology, and IL-17 might play a critical role in SLE development.

Keywords: laser-microdissection, lupus nephritis, SLEDAI, Th17

Introduction

Systemic lupus erythematosus (SLE) is a multi-system autoimmune disease characterized by various clinical manifestations. T cell-derived cytokine production plays a determinant role in SLE development. Previous studies have reported that an imbalance in cytokine production between T helper type 1 (Th1) and Th2 T cells (predominance of Th2 cytokine) in the peripheral blood of SLE patients is associated with the pathogenesis of the disease [13]. In contrast, Akahoshi et al.[4] demonstrated that a substantial predominance of Th1-type response took place in the peripheral blood samples of lupus nephritis (LN) patients categorized in WHO Class IV. Not only T cells in the peripheral blood, but also the balance in cytokine production between Th1 and Th2 cells in the kidney has drawn a great deal of attention. Masutani et al.[5] analysed the expression levels of interferon (IFN)-γ and interleukin (IL)-4 on intrarenal T cells as well as those in the peripheral blood samples from SLE patients with diffuse proliferative LN by immunohistochemistry, demonstrating the predominance of Th1 type response. They suggested that the Th1 : Th2 ratio in the peripheral blood might directly reflect the local histopathological findings. However, Murata et al.[6] indicated that the kidney-infiltrating T cells could produce Th2 type cytokines such as IL-4 and IL-10 through reverse transcription–polymerase chain reaction (RT–PCR), and made an assumption that this discrepancy might arise from a difference in sensitivity between the methods used in detection of cytokines. The expression level of IL-13, one of the Th2 type cytokines, was reported to be higher in the serum from the rheumatoid arthritis (RA), SLE, Sjögren's syndrome and systemic sclerosis patient groups than that in the normal healthy control group [7]. Morimoto et al.[8] also showed elevated expression level of IL-13 in SLE patients. Recently, it has been reported that naive murine CD4+ T helper cells can be induced to differentiate into Th1, Th2, Th17 and regulatory phenotypes [9]. IL-17 is a proinflammatory cytokine, as possibly known from the pathological conditions of various inflammatory diseases in both humans and mice [9]. We have reported previously that both IL-13 and IL-17 were produced in the murine LN (MRL/lpr mice) cells; however, we did not analyse them at a single-cell level [10]. The laser microdissection (LMD) technique has been adopted recently to obtain tissue samples exclusively from specific regions of interest. This new technique has been used successfully in various fields, including oncology [11], endocrinology [12], gastroenterology [13], rheumatology [1416] and nephrology [10,1719]. With this technique, attempts to analyse single-cell gene expression were made [13,16,20]. In our study, we analysed the single-cell expression levels of cytokines, including IL-13 and IL-17, by infiltrating T cells in the kidneys of LN patients.

Patients and methods

Renal biopsy samples were obtained from 15 SLE patients, two minor glomerular abnormalities (MGA) patients (female, 16 years old; male, 14 years old) and one minimal change nephrotic syndrome (MCNS) patient (male, 14 years old), and used in our experiments. In accordance with the classification criteria defined by International Society of Nephrology/Renal Pathology Society (ISN/RPS) [21,22], renal pathologies were diagnosed as: Class III, three cases; Class III+V, one case; Class IV, two cases; Class IV+V, five cases; and Class V, four cases. To ensure consistency with the World Health Organization (WHO) classification criteria, a further membranous lesion (Class V) may be added to Class III or Class IV in ISN/RPS. They were categorized as Class III-predominant group (Class III-predominant group included patients with both Class III and Class III+V, n = 4) and Class IV-predominant group (including patients with both Class IV and Class IV+V, n = 7). The patients, who had underwent renal biopsy before 2004, had already been classified in accordance with the WHO classification criteria [23] at the time of biopsy, but in this study were re-evaluated by nephrologists in accordance with the ISN/RPS classification criteria. The SLE Disease Activity Index (SLEDAI) scores [24], histological activity index (AI) and chronicity index (CI) scores [25] at renal biopsy are shown as Table 1. This study was approved by the ethical committee of Tsukuba University Hospital (no. 392). Prior written consent was given by the patients.

Table 1.

Clinical characteristics of patient and positivity of dissected T cells.

No. Age Sex Classification Pre-s UP (g/day) Haematuria (RBC/HPF) Urinary cast Pyuria BUN (mg/dl) Cr (mg/dl) Ccr (ml/min) ADNA (U/ml) CH50 (U/ml) SLEDAI TCR-cβ/β-actin (%) AI CI
1 45 F III (A) No 5·0 10–19 + 10·1 0·54 92·1 > 300 4·8 17 18/28 (64·3%) 5 2
2 52 F III (C) Yes 0·46 1–4 20·7 1·01 38·9 < 2 40·2 0 15/34 (44·1%) 1 8
3 52 F III (A) + V No 0·3 1–4 10·0 0·57 84·0 64·7 18·2 9 18/26 (69·2%) 0 3
4 29 F IV-G (A/C) No 8·0 56 + + 31·1 1·10 48·1 100·0 12·0 21 28/36 (77·8%) 16 3
5 25 F IV-G (A/C) Yes 5·0 5–9 + 15·0 0·60 93·0 > 300 2·1 19 18/25 (72·0%) 11 3
6 58 F IV-S(A/C)+V No 6·1 1–4 + 10·0 0·56 159·0 45 24·5 16 53/67 (79·1%) 12 4
7 59 F IV-G(A/C)+V No 2·3 1–4 + 26·1 0·95 51·5 64·7 18·2 9 19/28 (67·9%) 5 2
8 55 F IV-G (A) + V No 0·8 1–4 13·1 0·49 100·0 94·6 7·4 13 14/27 (51·9%) 10 0
9 18 F IV-S (A) + V Yes 0·46 1–4 12·3 0·48 108·5 58·1 9·5 18 22/31 (70·1%) 6 3
10 28 F V No 7·7 0–1 13·8 0·70 96·7 16·7 41·6 5 18/26 (69·2%) 1 2
11 39 F V Yes 5·3 0–1 12·4 0·51 138·1 5·4 50·7 4 22/32 (68·8%) 0 2
12 26 F V Yes 2·1 5–9 13·5 0·60 95·4 23·1 42·9 19 46/62 (74·2%) 0 0
13 22 M IV-G(A/C)+V Yes 4·15 30–50 + 16·0 0·90 110·8 < 5·0 20·5 10 7/20 (35·0%) 8 6
14 38 F III (A/C) No 0·85 1–4 + 18·7 0·62 141·7 > 300 23·2 13 18/31 (58·1%) 6 4
15 60 F V No 0·49 20–99 16·6 0·73 99·6 20·3 54·0 22 27/40 (67·5%) 0 3

S: segmental; G: global; A: active; C: chronic; Pre-s: pretreatment with steroid; UP: urine protein; RBC/HPF: red blood cell/high power field; BUN: blood urea nitrogen; Cr: serum creatinine; Ccr: creatinine clearance; Anti-ds: anti-double-stranded DNA; CH50: 50% haemolytic unit of complement serum; SLEDAI: systemic lupus erythematosus Disease Activity Index; AI: activity index score; CI: chronicity index score.

Immunohistological examinations

Five-µm-thick sections were obtained from the renal biopsy specimens of the SLE patients. Immunohistochemical staining was performed by the avidin–biotin complex technique. Primary antibodies used included murine anti-human IFN-γ (Santa Cruz Biotechnology, Santa Cruz, CA, USA); anti-IL-4, 10 (Research & Diagnostics Systems, Minneapolis, MN, USA); and polyclonal rabbit anti-human IL-17 and IL-13 (Santa Cruz Biotechnology). Staining was performed on the sections using normal murine IgG or rabbit immunoglobulin (Ig)G, a primary antibody, as a negative control. We also performed staining on sections of the renal biopsy samples of MGA and MCNS patients using anti-human IL-17 as the control.

Tissue sampling by laser microdissection

Frozen sections (10 µm thick) from the renal biopsy specimens of the SLE patients were stained with 0·05% toluidine blue solution (pH 7·0) (Wako Pure Chemical Industries, Osaka, Japan) and the individual single cells infiltrating into glomeruli and interstitiums were selected and dissected with laser-microdissection system (AS-LMD; Leica Microsystems Japan, Tokyo, Japan) (Fig. 2A).

Fig. 2.

Fig. 2

(A) Targeted infiltrating cells selected and cut by laser microdissection (LMD). The glomeruli and interstitium areas of a single infiltrating cell (black arrows) were selected and dissected with a laser microbeam one by one. (B) Analysis of cytokine gene expression in lesions. (a) Detection of cytokines in the lesions of the renal biopsy specimens from the patients by nested polymerase chain reaction (PCR). Specific expression of interferon (IFN)-γ, interleukin (IL)-2, IL-4, IL-10, IL-13 and IL-17 were identified in the lesions of the glomeruli and interstitium areas from the renal biopsy specimens of the patients in the Class III-predominant groups (n = 4), Class IV-predominant groups (n = 7) and Class V groups (n = 4). M: molecular size marker; NC: negative control; PC: positive control cDNA clone. (b) Expression of IFN-γ, IL-2, IL-4, IL-10, IL-13 and IL-17 mRNAs in the glomeruli areas of the Class III-predominant (white bars), Class IV-predominant (hatched bars) and Class V (black bars) groups was analysed by nested reverse transcription–polymerase chain reaction (RT–PCR). (c) Expression of IFN-γ, IL-2, IL-4, IL-10, IL-13 and IL-17 mRNAs in the interstitium areas of the Class III-predominant (white bars), Class IV-predominant (hatched bars) and Class V (black bars) groups was analysed by nested RT–PCR (n.d. = not determined). The number of positive samples is shown as a percentage. Error bars represent ± standard error. P < 0·05, by Mann–Whitney U-test.

RNA extraction and nested RT–PCR

Total RNA was extracted from the LMD samples by the Isogen method (Nippon Gene, Tokyo, Japan) according to the manufacturer's instructions. First-strand cDNA was prepared from total RNA using the ThermoScript RT–PCR System (Invitrogen Life Technologies, Carlsbad, CA, USA) and amplified with primers specific to β-actin, T cell receptor β chain (TCR-Cβ), IL-2, IL-4, IL-10, IL-13, IL-17 and IFN-γ for nested RT–PCR (Table 2).

Table 2.

Oligonucleotide primer sequences.

PCR products Oligonucleotide sequence Product size (bp) RT–PCR cycles
β-actin
First PCR 5′ sense GGCATCCTCACCCTGAAGTA 496 25
3′ anti-sense CCATCTCTTGCTCGAAGTCC
Nested PCR 5′ sense AAATCTGGCACCACACCTTC 262 25
3′ anti-sense AGGGCATACCCCTCGTAGAT
TCR-Cβ
First PCR 5′ sense ACATAAGGAAGGCTGCATGG 249 30
3′ anti-sense CGTTTTGATCATGGTGTGTGG
Nested PCR 5′ sense ATCAGGTGTGTGGGACTTTG 217 30
3′ anti-sense GACTCAGGACAGTGACATCA
IFN-γ
First PCR 5′ sense TCTGCATCGTTTTGGGTTCTC 346 25
3′ anti-sense TCAGCTTTTCGAAGTCATCTC
Nested PCR 5′ sense TGTTACTGCCAGGACCCATAT 242 30
3′ anti-sense ACTCTTTTGGATGCTCTGGTC
IL-2
First PCR 5′ sense ACTACCAGGATGCTCACATT 267 25
3′ anti-sense AAGGTAATCCATCTGTTCAGA
Nested PCR 5′ sense GCCACAGAACTGAAACATCTT 201 30
3′ anti-sense TTCTACAATGGTTGCTGTCTC
IL-4
First PCR 5′ sense CTTCCCCCTCTGTTCTTCCT 318 25
3′ anti-sense TTCCTGTCGAGCCGTTTCAG
Nested PCR 5′ sense CTAGCATGTGCCGGCAACTTT 273 25
3′ anti-sense TCGGATCAGCTGCTTGTGCCT
IL-10
First PCR 5′ sense ACAGCTCAGCACTGCTCTGT 327 30
3′ anti-sense AGTTCACATGCGCCTTGATG
Nested PCR 5′ sense CCCAGTCTGAGAACAGCTGCAA 210 30
3′ anti-sense CTGGGTCTTGGTTCTCAGCTT
IL-13
First PCR 5′ sense CTATGCATCCGCTCCTCAAT 391 30
3′ anti-sense TTTACAAACTGGGCCACCTC
Nested PCR 5′ sense ATTGCTCTCACTTGCCTTGG 229 25
3′ anti-sense TCCTGTGGGTCTTCTCGATC
IL-17
First PCR 5′ sense CTTCACCCTGTGGAACGAAT 262 30
3′ anti-sense CGGAATTGGTTCTGGAGTGT
Nested PCR 5′ sense GAGCACATGCACCACATACC 170 25
3′ anti-sense AGGAAACAGTCGCGGAGTGT

RT–PCR: reverse transcription polymerase chain reaction; TCR-Cβ: T cell receptor β chain; IL: interleukin; IFN-γ: interferon-gamma; bp: base pairs.

Statistical analysis

All data were expressed as mean ± standard error of the mean. Statistically significant differences between groups were determined using the Mann–Whitney U-test. A simple linear regression analysis was used to evaluate the correlation between the two parameters. The statistical significance was defined as P < 0·05.

Results

Detection of T cells in glomeruli and interstitium

Stained IL-4, IL-10 and IL-13 were observed in the glomerular and interstitial areas of the specimens from the SLE patients of the Class III-predominant, IV-predominant and Class V groups, especially in the latter area of the Class IV-predominant group (Fig. 1A) (the immunohistochemical data for the Class III-predominant and Class V groups are not shown). Many IL-4 cells were observed predominantly, mainly in the glomerular and interstitial cells, especially in intraglomerular infiltrating cells, in the Class IV-predominant group, while there were only a few IL-4-positive cells in the tubular epithelial cells (TEC) (Fig. 1Aa, b). IL-10- and IL-13-positive cells were observed prominently in the glomerular and interstitial infiltrating cells (Fig. 1Ac–f). Some stained IL-10-positive cells were observed in TEC (Fig. 1Ac, d). IL-17-positive cells were observed mainly in the glomerular and interstitial infiltrating cells and TECs, especially in intraglomerular cells of the Class IV-predominant group (Fig. 1Ag, h). Almost no IL-17-positive cells were observed in the glomeruli of the Class III-predominant (Fig. 1Ba) and Class V group (not shown) samples. However, IFN-γ cells were not observed in all the specimens (Fig. 1Bb) (the immunohistochemical data for the Class III-predominant groups are shown). Normal rabbit IgG was used as a negative control (Fig. 1Bc). IL-17-positive cells were not observed in all the specimens from the MGA and MCNS patients (Fig. 1C). This demonstrates that IL-17 may be produced preferentially in SLE patients.

Fig. 1.

Fig. 1

Detection of T cells in glomeruli and interstitium. (A) Stained interleukin (IL)-4, IL-10, IL-13 and IL-17 were observed in glomeruli and interstitium areas of the Class IV-predominant groups. Many IL-4 cells are observed prominently, mainly in the cells infiltrating into the glomeruli and interstitium areas, especially in intraglomerular infiltrating cells. There are only a few IL-4 cells in the tubular epithelial cells (TEC) (a, b). IL-10 and IL-13 cells are observed prominently in some of the cells infiltrating into the glomeruli and interstitium areas (c–f). Some stained IL-10 cells were observed in TEC (d). Many IL-17 cells are observed prominently, mainly in the cells infiltrating into the glomeruli, interstitium areas and TEC (g, h), especially in intraglomerular cells and TEC (g) (original magnification × 100 in a–h). (B) In the Class III-predominant group, some stained IL-17 cells were observed in TEC but almost no IL-17-positive cells were observed in glomeruli (a). Interferon (IFN)-γ cells were not observed in all the specimens (b). Normal rabbit immunoglobulin (Ig)G was stained as negative control (c) (original magnification × 100). (C) IL-17-positive cells were not observed in all the specimens of minor glomerular abnormalities (MGA) and minimal change nephrotic syndrome (MCNS) (a, b) (original magnification × 100).

Analysis of gene expression by laser microdissection and nested RT–PCR

Of 622 glomerular and interstitial infiltrating cells, 513 (82·5%) were β-actin-positive, among which 343 (66·7%) were TCR-Cβ-positive; these 343 cells were deemed to be T cells and used for cytokine analysis (Table 1). The number of positive samples for each cytokine/ TCR-Cβ+ cells was expressed as a percentage.

The glomerular and interstitial infiltrating T cells produced IL-2, IL-4, IL-10, IL-13 and IL-17 cytokines in the Class III-predominant, Class IV-predominant and Class V groups. The positivity of cytokines is shown in Table 3 and Fig. 2B. The percentages of positive IL-4, IL-10 and IL-13 samples were more than 70%, 67% and 41%, respectively, in all the groups. The expression levels of IL-2 were low in each of the predominant groups. IFN-γ was detected only in the glomeruli of the Class III-predominant and Class V groups (32·3 ± 12·9% and 24·0 ± 10·0%, P < 0·05) (Table 3 and Fig. 2B). In the glomerular lesions, the percentage of positive IL-17 samples was 64·7 ± 10·1% and 70·7 ± 6·0% in the Class IV-predominant and V groups, while it was significantly greater than in the Class III-predominant group (44·7 ± 5·9%, P < 0·05) (Fig. 2Bb). In the interstitial lesions, the positivity of IL-17 (48·0 ± 4·2%) was also significantly lower in the Class III-predominant groups than that in the Class IV-predominant group (69·1 ± 8·9%, P < 0·05) (Fig. 2Bc).

Table 3.

Positivity of cytokines in glomeruli and interstitiums (%).

Glomeruli
Interstitiums
Class III predominant Class IV predominant Class V Class III predominant Class IV predominant Class V
IL-2 19·7 ± 10·3 23·7 ± 20·3 44·6 ± 12·8 25·6 ± 10·5 2·8 ± 21·7 27·9 ± 12·3
IFN-γ 32·3 ± 12·9 n.d. 24·0 ± 10·0 3·1 ± 3·8 n.d. 1·3 ± 1·6
IL-4 88·6 ± 9·1 80·4 ± 13·5 85·7 ± 7·1 90·6 ± 7·5 84·6 ± 13·5 70·9 ± 16·7
IL-10 67·2 ± 5·1 67·7 ± 14·3 70·0 ± 10·3 70·5 ± 6·4 84·3 ± 6·5 79·8 ± 8·1
IL-13 60·6 ± 15·7 47·6 ± 20·5 62·3 ± 9·3 52·0 ± 9·2 41·5 ± 13·4 62·3 ± 7·6
IL-17 44·7 ± 5·9 64·7 ± 10·1* 70·7 ± 6·0* 48·0 ± 4·2 69·1 ± 8·9* 62·6 ± 12·3
*

P < 0·05 versus Class III-predominant groups. Results are expressed as mean ± standard error of the mean. Statistical significance was determined using the Mann–Whitney U-test. IL; interleukin; IFN-γ: interferon-gamma; n.d.: not determined.

Correlation between the expression levels of cytokines and clinical parameters in SLE patients

We analysed the correlation between the expression levels of Th1 (IL-2), Th2 (IL-4, IL-10, and IL-13) and Th17 (IL-17) cytokines and clinical parameters in SLE patients, such as the urine protein (UP) level, haematuria, blood urea nitrogen (BUN) level, serum creatinine (Cr) level, creatinine clearance (Ccr), 50% haemolytic unit of complement serum (CH50), anti-double-strand DNA (anti-ds DNA) antibodies, SLEDAI scores, histological AI and CI (Table 4). Good and significant correlation data are shown in Fig. 3.

Table 4.

Correlation between the levels of cytokines and clinical parameters.

Glomeruli
SLEDAI CH50 ADNA haematuria Cr BUN AI CI UP Ccr
IL-2 −0.214* 0.795*** −0.53** 0.363* 0.114 −0.27* −0.279* 0.387* 0.045 0.31*
0.049 0.002 0.018 0.046 0.242 0.047 0.047 0.045 0.435 0.047
IL-4 −0.361* −0.065 0.016 −0.437** −0.405* −0.441** −0.262* −0.591** −0.115 −0.095
0.046 0.592 0.47 0.042 0.041 0.044 −0.048 0.01 0.34 0.367
IL-10 −0.156 0.308* 0.194 −0.231* 0.019 −0.391* −0.091 0.282* 0.187 0.265*
0.268 0.047 0.143 0.048 0.472 0.045 0.626 0.046 0.049 0.047
IL-13 0.001 0.342* −0.192 0.162 0.023 −0.213* −0.319* 0.022 0.038 0.127
0.499 0.047 0.045 0.146 0.467 0.049 0.047 0.531 0.445 0.325
IL-17 0.541** 0.123 −0.157 0.543** 0.029 0.264* 0.227* −0.341* 0.333* 0.007
0.017 0.33 0.278 0.018 0.458 0.049 0.049 0.046 0.047 0.488
Interstitium
SLEDAI CH50 ADNA haematuria Cr BUN AI CI UP Ccr
IL-2 −0.125 0.37* −0.175 −0.362* −0.348* −0.24* 0.173 0.404** 0.154 0.63**
0.327 0.045 0.265 0.046 0.046 0.048 0.268 0.037 0.29 0.016
IL-4 0.178 −0.34* 0.279* −0.24* −0.168 0.07 0.221* −0.333* −0.062 −0.084
0.262 0.046 0.047 0.044 0.273 0.401 0.048 0.046 0.413 0.381
IL-10 −0.26* −0.116 −0.02 −0.094 0.207 0.037 0.195 0.061 0.586** −0.058
0.047 0.339 0.471 0.369 0.059 0.447 0.091 0.414 0.012 0.418
IL-13 0.058 0.483** −0.436** 0.31* −0.486** −0.675** −0.541** −0.117 −0.35* 0.371*
0.418 0.033 0.025 0.047 0.039 0.002 0.018 0.338 0.047 0.046
IL-17 0.544** −0.134 0.476* 0.471* 0.379* 0.374* 0.294* −0.273* −0.028 −0.364*
0.018 0.316 0.036 0.038 0.045 0.042 0.047 0.048 0.459 0.047

Correlation between clinical parameters and cytokines was assessed by using the Pearson correlation coefficient test (r-value showed in up

*

r = 0·2–0·4, weak correlation;

**

r = 0·4–0·7, good correlation;

***

r = 0·7–0·9, significant correlation. P-value showed in down). UP: urine protein; RBC/HPF: red blood cell/high power field; BUN: blood urea nitrogen; Cr: serum creatinine; Ccr: creatinine clearance; ADNA: anti-double-stranded DNA; CH50: 50% haemolytic unit of complement serum; SLEDAI: systemic lupus erythematosus Disease Activity Index; AI: activity index score; CI: chronicity index; IL: interleukin.

Fig. 3.

Fig. 3

Correlation between T helper type 1 (Th1), Th2 and Th17 cytokines and clinical and laboratory parameters in systemic lupus erythematosus (SLE). (A) Correlation between the levels of Th1 cytokine interleukin (IL)-2 and anti-double-strand (ds) DNA antibodies (a), 50% haemolytic unit of complement serum (CH50) (b), creatinine clearance (c) and chronicity index score (d) in glomeruli (black full line and points) and interstitium (black dashed line and grey points). (B) Correlation between the levels of Th2 cytokines–IL-4 and haematuria (a), blood urea nitrogen (b), serum creatinine (c) and chronicity index score (d) in glomeruli (black full line and points). Correlation between the levels of IL-10 and urine protein in interstitium (black dashed line and grey points). (C) Correlation between the levels of IL-13 and blood urea nitrogen (a), serum creatinine (b), 50% haemolytic unit of complement serum (CH50) (c), anti-ds DNA antibodies (d) and Activity Index scores (e) in interstitium. (D) Correlation between the levels of Th17 cytokine (IL-17), haematuria (a) and SLE Disease Activity Index (SLEDAI) scores (b) in glomeruli (black full line and points) and interstitium (black dashed line and grey points). Correlation between the level of IL-17 and SLEDAI scores (> 10) in glomeruli and interstitium (c). A simple linear regression analysis was used to evaluate the correlation between the two parameters, P < 0·05.

Correlation between Th1 cytokine and clinical parameters

In glomeruli, as known from the tendency of the point distribution on the charts, the parameters, BUN (r = 0·27), Ccr (r = 0·31), AI (r = −0·28), CI (r = 0·39) and SLEDAI (r = −0·21) (P < 0·05) showed a weak correlation with the expression level of IL-2 (Table 4). The expression level of IL-2 showed a good correlation with anti-ds DNA antibodies (r = −0·53, Fig. 3Aa) and a significant correlation with CH50 (r = 0·80, P < 0·001, Fig. 3Ab). In the interstitium, haematuria (r = −0·36), BUN (r = −0·24), Cr (r = −0·35) and CH50 (r = 0·37) showed a weak correlation with the expression level of IL-2 (Table 4); Ccr (r = 0·63) and CI (r = 0·404) showed a good correlation with the expression level of IL-2 (Fig. 3Ac, d).

Correlation between Th2 and clinical parameters

In the glomeruli, haematuria (r = 0·44), BUN (r = −0·44), Cr (r = −0·41) and CI (r = −0·59) showed a good correlation with the expression level of IL-4 (Fig. 3Ba–d); SLEDAI (r = −0·36) and AI (r = −26) showed a weak correlation with IL-4 (Table 4). The expression level of IL-10 showed a weak correlation with haematuria (r = −0·23), BUN (r = −0·39), Ccr (r = 0·27), CI (r = 0·28) and CH50 (r = 0·31). However, there was almost no finding that showed any correlation with the expression level of IL-13 except for BUN (r = −0·21), AI (r = −0·32) and CH50 (Table 4).

In the interstitiums, there was a weak correlation in the expression level of IL-4 with haematuria (r = 0·24), CH50 (r = −0·34), AI (r = 0·22), CI (r = −0·33) and anti-ds DNA antibodies (r = 0·28) (Table 4). IL-10 showed a good correlation with UP (r = 0·59) (Fig. 3Be) and a weak correlation with SLEDAI (r = −0·26) (Table 4). The percentage of IL-13 samples showed a weak correlation with UP (r = −0·35), haematuria (r = −0·31) and Ccr (r = 0·37) (Table 4), and a good correlation with BUN (r = −0·68), Cr (r = −0·49), CH50 (r = 0·48), AI (r = −0·54) and anti-ds DNA antibodies (r = −0·43) (Fig. 3C).

Correlation between Th17 and clinical parameters

In the glomeruli, UP (r = 0·33), AI (r = 0·26), CI (r = −0·34) and BUN (r = 0·26) showed a weak correlation with the expression level of IL-17 (Table 4). Haematuria (r = 0·54) and SLEDAI (r = 0·54) showed a significantly positive correlation with the expression level of IL-17 (Fig. 3Da, b). In the interstitiums, the positive IL-17 samples showed a weak correlation with BUN (r = 0·37), Cr (r = 0·38), AI (r = 0·29), CI (r = −0·27) and Ccr (r = −0·36) (Table 4), and a good correlation with haematuria (r = 0·47) and SLEDAI (r = 0·54) (Fig. 3Da, b). In particular, focusing upon patients whose SLEDAI scores are more than 10, there is a highly significant correlation between SLEDAI scores and the expression levels of IL-17 both in the glomeruli (r = 0·81, P < 0·05) and the interstitiums (r = 0·87, P < 0·001) (Fig. 3Dc).

Discussion

A cytokine balance of T helper cells in the kidneys of LN patients has drawn a great deal of attention [5,6]. We analysed the single-cell cytokine profile of the samples from the LN patients, including IL-13 and IL-17, by LMD. We observed the predominance of the Th2 cytokine both in the glomeruli and the interstitiums; this corresponds to the results of the study using whole kidneys by Murata et al.[6]. However, IFN-γ was observed only in the glomeruli of the ISN/RPS Class III-predominant and Class V groups. Chan et al.[19] reported that up-regulation of IFN-γ, IL-2 and T-bet (the Th1 transcription factor) was observed and no difference was observed in glomerular expression level of any target genes between the WHO Classes. However, as they reported, they did not analyse at a single-cell level; therefore, they could not identify the cellular origin of the detected mRNA, which is likely to be the reason for the discrepancy between their results and our results. Morimoto et al.[8] reported that Th2 predominance in the peripheral blood might induce renal lesions, and the co-existence of Th1 and Th2 might cause haemolytic anaemia or pulmonary lesions in SLE patients. Our result demonstrates that Th1 has a role in protecting the kidneys of LN patients; this corresponds to the results of the experiments on the peripheral blood of the SLE patients reported by Morimoto et al. Although, conventionally, it was believed that enhanced Th1 cell activation and IFN-γ production might contribute to the development of autoimmune diseases [26,27], certain findings have exploded this general hypothesis. For example, experimental autoimmune nephritis and collagen-induced arthritis (CIA) was exacerbated in mice treated with anti-IFN-γ-neutralizing antibodies and in IFN-γ-deficient or IFN-γ receptor-deficient mice [28]. Haas et al.[29] reported that IFN-γ might play a key role in suppressing the development of nephritis in MRL/lpr mice (SLE models).

In addition to the helper T cells classified into Th1 and Th2 types, another helper T cell subset, Th17, has been discovered recently [9]. It has been observed that IL-17 has a proinflammatory role in many inflammatory conditions [9], contributing to the pathogenesis of autoimmune and inflammatory diseases, including SLE [30].

Elevated concentrations of proinflammatory cytokines (IL-18, IL-17, IL-12) and Th2 cytokine (IL-4) in the SLE patients were reported [31]. Dong et al.[32] reported that the cultured peripheral blood mononuclear cells (PBMC) of LN patients stimulated by IL-17 produced significantly high levels of IL-6, IgG and anti-ds DNA antibodies. However, IL-17 did not increase them in cultured PBMC of normal controls [32]. Crispin et al.[33] have demonstrated that CD3+ CD4-CD8- double-negative (DN) T cells from SLE patients produce significant amounts of IL-17 and IFN-γ. Furthermore, IL-17+ and DN T cells are found in renal biopsy specimens from LN patients. In our study, we have confirmed successfully the production of IL-17 in infiltrating T cells in the kidneys (glomeruli and interstitiums) of the LN patients at a single-cell level. This suggests that IL-17 may play an important role in the LN patients. It was reported that cyclosporine A might inhibit the production of IL-17 in the healthy control and RA patient groups [34]. Cyclosporine A also inhibits IL-15-induced IL-17 production in the CD4+ T cells through down-regulation of PI3K/Akt and nuclear factor-kappa B (NF-κB) [35]. Inhibition of IL-15-induced IL-17 production by tacrolimus was also observed in CD4+ T cells [35]. It may be considered that the inhibition of IL-17 is an important mechanism of the efficacy of these two kinds of calcineurin inhibitors in the steroid-resistant LN patients.

To confirm cytokine production in the kidney by RT–PCR, we conducted immunohistochemical experiments. The production of IL-13 and IL-17 were also observed by immunohistochemistry. Stained IL-17-positive cells were observed not only in the glomeruli or interstitiums, but also in the tubular epitheliums of LN patients (Fig. 1). Crispin et al.[33] reported that IL-17-positive cells were found by immunofluorescence mainly in the tubule-interstitial zone, the area where cellular infiltration is mainly found. We made stains for IL-17-positive cells with anti-human IL-17 in the specimens from MGA and MCNS patients; no IL-17-positive cells were observed (Fig. 1Ca, b). This has demonstrated that IL-17 may be produced preferentially in SLE patients. Matsumura et al. also found stained IL-17 in the tubular epitheliums of LN patients by immunohistochemistry (personal communication). Thus, production of IL-17 in the tubules was confirmed by the RT–PCR and LMD methods. We believe that the RT–PCR technique is more sensitive than immunohistochemistry and can be used for quantification of the production of each cytokine.

We analysed the correlation between the expression levels of Th1, Th2 and Th17 cytokines and clinical parameters. We found that the levels of IL-2, IL-4, IL-10, IL-13 and IL-17 have a correlation with some clinical and laboratory parameters (Fig. 3). A negative correlation was found between the level of IL-2 and haematuria, BUN, Cr, anti-ds DNA antibody and SLEDAI, except for Ccr, CH50 and CI. However, the IL-17 level was correlated positively with UP, haematuria, BUN, Cr, AI and SLEDAI, while correlating negatively with CI and Ccr (Fig. 3). These findings indicate that IL-2 and IL-17 play opposite roles in SLE development. It is suggested that IL-2 may play a role in protecting against SLE development, while IL-17 might have a reverse effect. Wong et al.[36] showed significant and positive correlations of plasma IL-17 concentrations with SLEDAI scores in the patients without renal disease. Yang et al.[37] showed that patients with active SLE (SLEDAI > 6) exhibit an increased proportion of Th17 cells in CD3-CD8- T cells from PBMC compared with healthy individuals by flow cytometric analysis, and a significant positive correlation between the percentage of Th17 cells and the SLEDAI score. Doreau et al.[38] also found that the serum of patients with SLE had higher concentrations of IL-17 than did the serum of healthy people, and that IL-17 abundance correlated with the disease severity of SLE. In our study, the level of IL-17 correlated positively and significantly with SLEDAI scores both in the glomeruli and the interstitiums. A highly significant correlation was observed between SLEDAI scores and the level of IL-17 in both the glomeruli and the interstitiums of active SLE patients (SLEDAI > 10) (Fig. 3D). We also found that the level of IL-17 has positive correlations with AI and negative correlations with CI in both glomerulus and interstitium, although correlations were weak (Table 4). This suggests that IL-17 may play an important role in the inflammatory process of a renal disease during the acute phase of SLE patients. With few IFN-γ-positive samples, we did not analyse the correlation between IFN-γ and the clinical and laboratory parameters. IFN-γ was observed only in the glomeruli of ISN/RPS Class III-predominant and Class V groups; accordingly, IFN-γ might play a role in protecting against the inflammatory process in LN patients, as with IL-2. The IL-2 level correlatates good positively with CI, suggesting that IL-2 might act during the chronic stage of glomerulonephritis (Fig. 3A and Table 4). Nakae et al.[39] found that IL-17 can suppress Th1 cell differentiation in the presence of exogenous IL-12 in vitro, and IFN-γ can down-regulate Th17 cell differentiation. Not only IFN-γ but also IL-4 can suppress IL-17 production in vitro[40,41]. Chu et al.[42] demonstrated further that IFN-γ might regulate susceptibility to CIA through suppression of IL-17, and IFN-γ and IL-4 together had a synergistic effect on suppression of type II collagen (CII)-specific IL-17 production during CII restimulation in vitro. This might be the reason why the expression levels of IFN-γ and IL-4 were higher in the ISN/RPS Class III-predominant group than those of other classes, whereas that of IL-17 was lower. Th2 cytokine showed inconsistent results, but it seems likely that IL-13 plays a protective role in lupus nephritis (Fig. 3C, Table 4).

In conclusion, we have shown that the glomerular infiltrating T cells might act as Th1, Th2 and Th17 cells, while the interstitial infiltrating T cells, as Th2 and Th17 cells in the Class III-predominant and Class V groups. In contrast, both the glomerular and interstitial infiltrating T cells might act as Th2 and Th17 cells in the Class IV-predominant group. The cytokine balances may be dependent on the classification of renal pathology and IL-17 might play a critical role in SLE development.

Acknowledgments

This study was supported by the Health and Labour Sciences Research Grants for Research on Intractable Diseases from the Ministry of Health, Labour and Welfare of Japan. We thank medical scientists of Chiba-East National Hospital (Department of Rheumatology, Allergy and Clinical Immunology National Hospital Organization Chiba-East National Hospital) for their helpful suggestions for this study.

Disclosure

None of the authors have any conflict of interest with the subject matter or materials discussed in the manuscript.

References

  • 1.Funauchi M, Ikoma S, Enomoto H, Horiuchi A. Decreased Th-1 like and increased Th-2 like cells in systemic lupus erythematosus. Scand J Rheumatol. 1998;27:219–24. doi: 10.1080/030097498440859. [DOI] [PubMed] [Google Scholar]
  • 2.Viallard JF, Pellegrin JL, Ranchin V, et al. Th1 [IL-2, interferon-gammma (IFN-γ)] and Th2 (IL-10, IL-4) cytokine production by peripheral blood mononuclear cells (PBMC) from patients with systemic lupus erythematosus (SLE) Clin Exp Immunol. 1999;115:189–95. doi: 10.1046/j.1365-2249.1999.00766.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Richaud-Patin Y, Alcocer-Verela J, Llorente L. High levels of TH2 cytokine gene expression in systemic lupus erythematosus. Rev Invest Clin. 1995;47:267–72. [PubMed] [Google Scholar]
  • 4.Akahoshi M, Nakashima H, Tanaka Y, et al. Th1/Th2 balance of peripheral T helper cells in systemic lupus erytematosus. Arthritis Rheum. 1999;42:1644–8. doi: 10.1002/1529-0131(199908)42:8<1644::AID-ANR12>3.0.CO;2-L. [DOI] [PubMed] [Google Scholar]
  • 5.Masutani K, Akahoshi M, Tsuruya K, et al. Predominance of Th1 immune response in diffuse proliferative lupus nephritis. Arthritis Rheum. 2001;44:2097–106. doi: 10.1002/1529-0131(200109)44:9<2097::AID-ART360>3.0.CO;2-6. [DOI] [PubMed] [Google Scholar]
  • 6.Murata H, Matsumura R, Koyama A, et al. T cell receptor repertoire of T cells in the kidneys of patients with lupus nephritis. Arthritis Rheum. 2002;46:2141–7. doi: 10.1002/art.10432. [DOI] [PubMed] [Google Scholar]
  • 7.Spadaro A, Rinaldi T, Riccieri V, Taccari E, Valesini G. Interleukin-13 in autoimmune rheumatic diseases: relationship with the autoantibody profile. Clin Exp Rheumatol. 2002;20:213–6. [PubMed] [Google Scholar]
  • 8.Morimoto S, Tokano Y, Kaneko H, Nozawa K, Amano H, Hashimoto H. The increased interleukin-13 in patients with systemic lupus erythematosus: relations to other Th1-, Th2-related cytokines and clinical findings. Autoimmunity. 2001;34:19–25. doi: 10.3109/08916930108994122. [DOI] [PubMed] [Google Scholar]
  • 9.Afzari B, Lombardi G, Lechler R, Lord GM. The role of T helper (Th17) and regulatory T cells (Treg) in human organ transplantation and autoimmune disease. Clin Exp Immunol. 2007;148:32–46. doi: 10.1111/j.1365-2249.2007.03356.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wang Y, Ito S, Sumida T, et al. Use of laser microdissection in the analysis of renal-infiltrating T cells in MRL/lpr mice. Mod Rheumatol. 2008;18:385–93. doi: 10.1007/s10165-008-0074-8. [DOI] [PubMed] [Google Scholar]
  • 11.Lechner S, Muller-Landner U, Renke B, Scholmerich J, Ruschoff J, Kullmann F. Gene expression pattern of laser microdissected colonic crypts of adenomas with low grade dysplasia. Gut. 2003;52:1148–53. doi: 10.1136/gut.52.8.1148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hong SH, Nah HY, Lee JY, Gye MC, Kim CH, Kim MK. Analysis of estrogen-regulated genes in mouse uterus using cDNA microarray and laser capture microdissection. J Endocrinol. 2004;181:157–67. doi: 10.1677/joe.0.1810157. [DOI] [PubMed] [Google Scholar]
  • 13.Shi X, Kleeff J, Zhu ZW, et al. Gene-expression analysis of single cells-nested polymerase chain reaction after laser microdissection. World J Gastroenterol. 2003;9:1337–41. doi: 10.3748/wjg.v9.i6.1337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Judex M, Neuman E, Gay S, Muller-Lander U. Laser-mediated microdissection as a tool for molecular analysis in arthritis. Methods Mol Med. 2004;101:93–105. doi: 10.1385/1-59259-821-8:093. [DOI] [PubMed] [Google Scholar]
  • 15.Hashimoto A, Tarner IH, Bohle RM, et al. Analysis of vascular gene expression in arthritis synovium by laser-mediated microdissection. Arthritis Rheum. 2007;56:1094–105. doi: 10.1002/art.22450. [DOI] [PubMed] [Google Scholar]
  • 16.Hofbauer M, Wiesener S, Babbe H, et al. Clonal tracking of autoaggressive T cells in polymyositis by combining laser microdissection, single-cell PCR, and CDR3-spectratype analysis. Proc Natl Acad Sci USA. 2003;100:4090–5. doi: 10.1073/pnas.0236183100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Peterson KS, Huang JF, Zhu J, et al. Characterization of heterogeneity in the molecular pathogenesis of lupus nephritis from transcriptional profiles of laser-captured glomeruli. J Clin Invest. 2004;113:1722–33. doi: 10.1172/JCI19139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fries JW, Roth T, Dienes HP, Weber M, Odenthal M. A novel evaluation method for paraffinized human renal biopsies using quantitative analysis of microdissected glomeruli and VCAM-1 as marker of inflammatory mesangial cell activation. Nephrol Dial Transplant. 2003;18:710–6. doi: 10.1093/ndt/gfg045. [DOI] [PubMed] [Google Scholar]
  • 19.Chan RW, Lai FM, Li EK, et al. Intrarenal cytokine gene expression in lupus nephritis. Ann Rheum Dis. 2007;66:886–92. doi: 10.1136/ard.2006.063123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Todd R, Margolin DH. Challenge of single-cell diagnostics: analysis of gene expression. Trends Mol Med. 2002;8:254–7. doi: 10.1016/s1471-4914(02)02350-x. [DOI] [PubMed] [Google Scholar]
  • 21.Weening JJ, D'Agati VD, Schwartz MM, et al. The classification of glomerulonephritis in systemic lupus erythematosus revised. J Am Soc Nephrol. 2004;15:241–50. doi: 10.1097/01.asn.0000108969.21691.5d. [DOI] [PubMed] [Google Scholar]
  • 22.Weening JJ, D'Agati VD, Schwartz MM, et al. The classification of glomerulonephritis in systemic lupus erythematosus revised. Kidney Int. 2004;65:521–30. doi: 10.1111/j.1523-1755.2004.00443.x. [DOI] [PubMed] [Google Scholar]
  • 23.Churg J, Bernstein J, Glassock RJ. Renal disease: classification and atlas of glomerular disease. 2nd edn. Tokyo: Igaku-Shoin; 1995. [Google Scholar]
  • 24.Bombardier C, Gladman DD, Urowitz MB, Caron D, Chang CH. Derivation of the SLEDAI. Arthritis Rheum. 1992;35:630–40. doi: 10.1002/art.1780350606. [DOI] [PubMed] [Google Scholar]
  • 25.Austin HA, 3rd, Muenz LR, Joyce KM, Antonovych TT, Balow JE. Diffuse proliferative lupus nephritis: identification of specific pathologic features affecting renal outcome. Kidney Int. 1984;25:689–95. doi: 10.1038/ki.1984.75. [DOI] [PubMed] [Google Scholar]
  • 26.Wang B, Esche C, Mamelak A, Freed I, Watanabe H, Sauder DH. Cytokine knockouts in contact hypersensitivity research. Cytokine Growth Factor Rev. 2003;14:381–9. doi: 10.1016/s1359-6101(03)00050-9. [DOI] [PubMed] [Google Scholar]
  • 27.Crane IJ, Forrester JV. Th1 and Th2 lymphocytes in autoimmune disease. Crit Rev Immunol. 2005;25:75–102. doi: 10.1615/critrevimmunol.v25.i2.10. [DOI] [PubMed] [Google Scholar]
  • 28.Matthys P, Vermeire K, Heremans H, Billiau A. The protective effect of IFN-gamma in experimental autoimmune diseases: a central role of mycobacterial adjuvant-induced myelopoiesis. J Leukoc Biol. 2000;68:447–54. [PubMed] [Google Scholar]
  • 29.Haas C, Ryffel B, Le Hir M. IFN-gamma is essential for the development of autoimmune glomerulonephritis in MRL/Ipr mice. J Immunol. 1997;158:5484–91. [PubMed] [Google Scholar]
  • 30.Bi Y, Liu G, Yang R. Th17 cell induction and immune regulatory effects. J Cell Physiol. 2007;211:273–8. doi: 10.1002/jcp.20973. [DOI] [PubMed] [Google Scholar]
  • 31.Wong CK, Ho CY, Li EK, Lam CW. Elevation of proinflammatory cytokine (IL-18, IL-17, IL12) and Th2 cytokine (IL-4) concentrations in patients with systemic lupus erythematosus. Lupus. 2000;9:589–93. doi: 10.1191/096120300678828703. [DOI] [PubMed] [Google Scholar]
  • 32.Dong GF, Ye R, Shi W, et al. IL-17 induces autoantibody overproduction and peripheral blood mononuclear cell overexpression of IL-6 in lupus nephritis patients. Chin Med J. 2003;116:543–8. [PubMed] [Google Scholar]
  • 33.Crispín JC, Oukka M, Bayliss G, et al. Expanded double negative T cells in patients with systemic lupus erythematosus produce IL-17 and infiltrate the kidneys. J Immunol. 2008;181:8761–6. doi: 10.4049/jimmunol.181.12.8761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhang C, Zhang J, Yang B, Wu C. Cyclosporine A inhibits the production of IL-17 by healthy individuals and patients with rheumatoid arthritis. Cytokine. 2008;42:345–52. doi: 10.1016/j.cyto.2008.03.006. [DOI] [PubMed] [Google Scholar]
  • 35.Cho ML, Ju JH, Kim KW, et al. Cyclosporine A inhibits IL-15-induced IL-17 production in CD4+ T cells via down-regulation of PI3K/Akt and NF-κB. Immunol Lett. 2007;108:88–96. doi: 10.1016/j.imlet.2006.11.001. [DOI] [PubMed] [Google Scholar]
  • 36.Wong CK, Lit LC, Tam LS, Li EK, Wong PT, Lam CW. Hyperproduction of IL-23 and IL-17 in patients with systemic lupus erythematosus: implications for Th17-mediated inflammation in auto-immunity. Clin Immunol. 2008;127:385–93. doi: 10.1016/j.clim.2008.01.019. [DOI] [PubMed] [Google Scholar]
  • 37.Yang J, Chu Y, Yang X, et al. Th17 and natural Treg cell population dynamics in systemic lupus erythematosus. Arthritis Rheum. 2009;60:1472–83. doi: 10.1002/art.24499. [DOI] [PubMed] [Google Scholar]
  • 38.Doreau A, Belot A, Bastid J, et al. Interleukin 17 acts in synergy with B cell-activating factor to influence B cell biology and the pathophysiology of systemic lupus erythematosus. Nat Immunol. 2009;10:778–85. doi: 10.1038/ni.1741. [DOI] [PubMed] [Google Scholar]
  • 39.Nakae S, Iwakura Y, Suto H, Galli SJ. Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17. J Leukoc Biol. 2007;81:1258–68. doi: 10.1189/jlb.1006610. [DOI] [PubMed] [Google Scholar]
  • 40.Harrington LE, Hatton RD, Mangan PR, et al. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. 2005;6:1123–32. doi: 10.1038/ni1254. [DOI] [PubMed] [Google Scholar]
  • 41.Park H, Li Z, Yang XO, et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. 2005;6:1133–41. doi: 10.1038/ni1261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Chu CQ, Swart D, Alcorn D, Tocker J, Elkon KB. Interferon-gamma regulates susceptibility to collagen-induced arthritis through suppression of interleukin-17. Arthritis Rheum. 2007;56:1145–51. doi: 10.1002/art.22453. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES