Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Nov 1.
Published in final edited form as: Clin Infect Dis. 2009 Nov 1;49(9):1295–1301. doi: 10.1086/606053

Clinical Correlates of Herpes Simplex Virus Viremia Among Hospitalized Adults

William R Berrington *, Keith R Jerome †,‡, Linda Cook ‡, Anna Wald *,†,#, Lawrence Corey *,†,‡, Corey Casper *,†
PMCID: PMC2803101  NIHMSID: NIHMS138494  PMID: 19807272

Abstract

Background

The quantification of herpes simplex virus (HSV) DNA from the peripheral blood is often used to evaluate patients suspected of having disseminated HSV infection. Few studies have examined the clinical correlates of HSV viremia among adults.

Methods

We conducted a retrospective analysis of blood samples sent to a reference molecular virology diagnostic facility at a university hospital for quantification of HSV DNA between October 2001 and June 2006. Medical records of patients with detectable HSV DNA were reviewed to abstract relevant clinical characteristics.

Results

HSV DNA was detected in 37 (4.0%) of 951 samples from 29 individual patients. 19 (65.5%) were >16 years of age, and detailed medical records were available for review from 13 (68.4%) of 19 adults patients. Of the 10 patients whose HSV infection was typed, 6 (60%) had HSV-2, 3 (30%) had HSV-1, and one had evidence of both HSV-1 and HSV-2 infection. All viremic patients were treated with antiviral medications. The most common clinical findings were hepatitis (62%), fever (54%), CNS alterations (46%), skin lesions (38%), abdominal pain (31%), and sepsis (31%). Respiratory failure (23%) was uncommon. Patients with HSV viremia were observed to have a high mortality rate (6 of 10 immunocompromised and 1 of 3 immunocompetent individuals).

Conclusions

HSV viremia may be associated with a variety of morbid signs and symptoms in hospitalized immunocompetent and immunocompromised adults, and is associated with high rates of mortality, though causality can only be determined by additional studies.

INTRODUCTION

Herpes Simplex Virus (HSV) is a double-stranded DNA virus which exists in either a lytic or latent phase of infection [1]. Newly acquired or reactivated infections cause either ulcerative gingivostomatitis (typically with HSV-1) or genital ulceration (typically with HSV-2) in children and adults. Other less common manifestations include meningitis, encephalitis [2, 3], pneumonitis [4] and hepatitis [5–7]. Polymerase chain reaction (PCR) has been pioneered as a technology to rapidly and accurately detect and quantify HSV DNA from clinical specimens [8–10]. Despite over a decade of experience with PCR, little is known about the frequency and clinical correlates of HSV viremia.

Viral dissemination to bloodstream and viscera can be seen in neonates [11] and immunocompromised patients, including those with hematologic malignancies [12, 13], transplant recipients [14, 15], or persons immunosuppressed with medications [16]. Immunocompetent individuals, including pregnant patients [17] and those with no other identified immunosuppressive condition [5, 18–20], may also present with disseminated disease. In addition, up to 25% of patients with primary genital HSV have PCR-detectable virus in their peripheral blood [21]. We undertook a retrospective chart review of patients identified with HSV viremia at a molecular virology reference laboratory to analyze the clinical correlates and response to treatment of patients with HSV viremia.

METHODS

Identification of Patient Population

The University of Washington (UW) Molecular Virology Laboratory has offered quantitative HSV PCR for the detection of HSV from clinical samples since 2000. Samples from the UW Molecular Virology Laboratory are received mainly from regional hospitals in the Northwest including Seattle Children’s Hospital, Harborview Medical Center, University of Washington, and the Fred Hutchison Cancer Research Center. A computer-based search was used to identify all patients with peripheral blood samples sent to the virology lab for detection and quantification of HSV DNA by PCR over a 56 month period of time (between October 2001 and June 2006). Patients were included in the study if they were at least 16 years old, had detectable HSV DNA by PCR from the peripheral blood, and were from one of the three institutions from which approval to review medical records was obtained (University Medical Center at the University of Washington, Harborview Medical Center, and Fred Hutchinson Cancer Research Center). These institutions all share a common electronic medical information system.

Herpes Simplex Virus quantitative PCR

Viral DNA was extracted from the serum and plasma samples with a Qiagen Biorobot 2000 and the PCR reaction was performed as previously described [8–10, 22]. Added to the HSV PCR reaction was an internal control consisting of a 126 bp fragment of jellyfish sequence which was co-amplified in the same mix with primers GCCTGGTGCAAAAATTGCTT and TCGTTCATTTGTTCTTTTGTGGAA and a VIC labeled probe CAGCTATTGCAAACGCCATCGCAC. Quantitation of viral DNA was performed by real-time PCR with the Taqman system using the optimized forward primer CCG TCA GCA CCT TCA TCG A, and reverse primer CGC TGG ACC TCC GTG TAG TC, and probe CCA CGA GAT CAA GGA CAG CGG CC to detect DNA from conserved regions of herpes viral glycoprotein B [23]. Quantification was performed using a standard from known amounts of DNA with a reproducible lower limit of detection of 250 copies/ml. A PCR-based HSV-typing assay was also used in some cases as previously described [24].

Data collection

Patient charts meeting the above inclusion criteria were reviewed for presenting symptoms, physical exam, underlying illnesses, pertinent laboratory values, previous HSV serologic tests, peripheral blood HSV viral load, HSV type, treatment and outcome.

Role of the Funding Source

Neither the NIH nor the Doris Duke Foundation played a role in the present study design.

RESULTS

DESCRIPTION OF PATIENT POPULATION

Between October 2001 and June 2006, we identified 951 serum or plasma samples sent to the lab for HSV PCR analysis. Thirty eight (4.0%) samples from 29 patients had detectable peripheral blood levels of HSV (Figure 1). Ten (34%) of these 29 patients were <6 years of age (9 were less than 1 year old), and 18 (62%) were female. Of the 19 identified adult patients (≥16 years old), 13 were at the hospitals where permission was obtained to view medical records. A total of 17 peripheral blood samples had HSV DNA detected, including 15 (88%) serum samples and 2 (12%) plasma specimens. Our group and others have found these two types of specimens to be comparable for the detection of HSV DNA (data not shown), and therefore all 17 samples are reported together. A summary of the patients is shown in Table 1. The median age of those represented was 49 years (range 25–66 years). Four (31%) men and 9 (69%) women had HSV detectable in the peripheral blood.

Table 1. Demographic and Clinical Characteristics of Hospitalized Adults with Disseminated HSV Infection.

This table summarizes epidemiologic, demographic and clinical characteristics obtained by medical chart review from 13 individuals with HSV DNA detected in peripheral blood over the span of 4 years and 8 months at three medical institutions in Seattle. Summary of the virologic diagnostic data including quantification of polymerase chain reaction (PCR) copies per milliliter in peripheral blood. HSV type was determined either by type specific PCR assay or by serologic analysis. Alanine aminotransferase (ALT) levels are expressed in units per liter (U/L); blood urea nitrogen (BUN) and creatinine (Cr) are expressed in milligrams per deciliter (mg/dL).

Pt Age Gender Underlying
Condition
Immuno-
suppresive
medications
Presenting
signs and
symptoms
HSV
type
Copies
per ml of
peripheral
blood
Abnormal
Labs
Concurrent
illnesses
explaining
symptoms
Treatment Outcome Cause of
Death
1 59 F Liver Transplant.
Autoimmune
hepatitis
FK506
Immuran
Prednisone
Anorexia,
diarrhea
Unk 81 BUN 50
ALT 106
WBC <4
Yes, (CMV
viremia)
IV GCV Survived

2 42 M Liver Transplant
HCV cirrhosis
FK506
Immuran
Prednisone
Generalized
fatigue,
Abdominal
Pain
HSV-
2
1.5×106 ALT 298
WBC <4
HSV by
culture and
PCR in
ascitic fluid
No IV ACV Survived

3 44 M CVID
Agranulocytosis
Sarcoidosis
None Neutropenic
fever, sepsis
Unk 300 BUN 107
WBC <4
No IV ACV Died MSOF, Sepsis

4 37 F HIV
(CD4 count
14)
None Pneumonia,
sepsis
HSV-
1
and
HSV-
2
4000 ALT 143
Alk P 780
HSV by
culture from
mouth and
anus
Yes (PCP
pneumonia)
IV GCV Died ARDS, PCP
pneumonia,
and Sepsis

5 54 F Perinuclear anti-
neutrophil
cytoplasmic
antibody (+)
Prednisone SOB,
syncope,
weakness,
abdominal
pain, AMS
Unk 2.6×109 ALT 7848
Cr 5.5
WBC <4
No IV ACV Died Liver failure,
Sepsis.

6 25 F Ideopathic
thrombocytopenic
purpura
None within 2
years,
previously
Prednisone
Fever, Chills,
myalgias,
Abdominal
pain, Skin
lesion
HSV-
2
3.5×106 ALT 1910
Cr 3.3
HSV
Cultured
from Post
mortem
lung tissue
No IV ACV,
oral vACV,
then IV
ACV
Died Sepsis, liver
failure

7 58 F None Dexamethasone Fever, AMS,
Pneumococal
meningitis,
Skin lesion
(Labial)
HSV-
2
420 CSF 1290
Nucleated
cells 89%
PMNs
HSV
Cultured
from Labia
Yes (S.
Pneumo
meningitis,
bacteremia)
IV ACV ×
1d then
oral vACV
Died Pneumococcal
meningitis

8 66 F Breast cancer,
Hodgkins
Lymphoma
Prednisone Dyspnea,
Fever,
hypoxia
fatigue,
Sepsis,
ARDS, AMS
HSV-
1
270 ALT 149
WBC <4
HSV
Cultured
from BAL
No IV ACV Died ARDS, Sepsis,
CVA and
Intracranial
hemorrage.

9 61 F None None Abdominal
Pain, Skin
(labial) Lesions
HSV-
2
2.2×106 ALT 600
Cr 3.8
WBC <4
HSV
Cultured
from labia
No IV ACV
then oral
vACV
Survived

10 57 M Renal Transplant
Large B cell
Lymphoma
Prograf,
Cellcept,
Prednisone
Memory
problems,
AMS,
Headache,
L
hemiparesis,
Skin Lesions
Gait abnorm-
alities
HSV-
2
610 WBC<4
HSV
Cultured
from skin on
back
Yes (PTLD,
S. Aureus
bacteremia)
vACV PFA Died CNS
lymphoma

11 37 F Cranio-
pharyngioma
HSV encephalitis
DM
Dexamethasone HSV
encephalitis
s/p Tumor
resection,
AMS
HSV-
2
110 ALT 200
Alkph 929
HSV by
PCR from
the CNS
No IV ACV Survived,
died 4m
after dx

12 40 F CML
Bone marrow
Transplant
FK506
MMF
Prednisone
Worsening
HSV skin
lesions on
acyclovir
HSV-
1
110 ALT 164
HSV initially
Cultured
from mouth,
in 2nd
admission
from
duodenum,
rectum and
BAL
Yes (GVHD) PFA Survived,
died 4m
after dx

13 49 M Intrathecal
Fentanyl pump for
pain
None Headaches
Seizures
AMS
HSV-
1
5800 CSF 520
cells (90%
lymphs)
HSV by
PCR from
CNS
No IV ACV Survived

Abbreviations. ARDS- Acute respiratory distress syndrome, ACV- acyclovir, ALT- Alanine aminotransferase, ALKPH – Alkaline phosphatase, AMS- Altered Mental Status, BUN- Blood urea nitrogen, CSF- Cerebral Spinal Fluid, CML- Chronic myelogenous leukemia, CVID- Chronic variable immunodifficiency, Cr- Creatinine, CVA- Cerebral vascular accident, F – female, PFA- Foscarnet, GCV- gancyclovir, GVHD- Graft versus host disease, HCV- Hepatitis C Virus, HIV- Human immunodeficiency virus, IVIntravenous, lymphs- Lymphocytes, M- Male, MSOF- Multiple system organ failure, pANCA- Perinuclear anti-neutrophil cytoplasmic antibody, PCR- Polymerase Chain Reaction, PMN- Polymorphonuclear leucocyte, PTLD- Post-transplant lymphoproliferative disorder, vACV- Valacyclovir, UNK- Unknown.

CLINICAL PRESENTATION

Three (23%) of 13 patients were immunocompetent with no previous medical history or medications to explain predisposition to disseminated HSV. Of the 10 immunosuppressed patients, 5 (50%) had an underlying illness (HIV, immunodeficiency, or hematologic malignancies), and 4 (40%) underwent solid organ (2 liver, 1 kidney) or bone marrow transplantation. Eight of the 10 immunosuppressed patients (80%) were also receiving immunosuppressants such as steroids or cyclosporine. The remaining immunocompetent patients (patients 6, 9, and 13), had not been given immunosuppressant medications within the last two years.

Disease presentation and clinical course was highly variable amongst those with HSV viremia. Patients typically had multiple presenting complaints. Seven (54%) of the 13 patients presented with fever within 72 hours of detection of HSV in peripheral blood, 6 (46%) had CNS symptoms (altered mental status, obtundation), 5 (38%) had herpetic-like skin lesions, 5 (38%) presented with or developed sepsis syndrome (defined as hypotension requiring pressors and tachycardia), 4 (31%) had abdominal complaints, and 3 (23%) had respiratory failure (requiring mechanical ventilation). Five (38%) of the patients had concurrent illnesses or pathogens that could explain their presenting symptoms and clinical course other than HSV (see Table 1). The remaining 8 had either fevers, sepsis, liver failure, or ARDS in the absence of cultures positive for bacterial organisms (patients 2, 3, 5, 6, 8, 9) or encephalitis thought to be due primarily to HSV (Patients 11 and 13). Patients with no alternative diagnosis to explain their acute illness tended to have increased frequency of hepatitis, fever and abdominal pain, and decreased frequency of skin lesion Table 2. Ten (77%) had another body fluid with HSV detected by PCR or culture (CSF, bronchoalveolar lavage, peritoneal fluid, skin (mouth or labia)).

Table 2. Presenting Clinical Characteristics Based on Whether Patient had Alternative Diagnosis to Explain Symptoms.

Charts were reviewed and patients were determined to have abnormal laboratory values (hepatitis (ALT > 3× upper limit of noraml) or leukopenia (WBC < 4.0 thousand per microliter)). Documentation of initial history and physical was reviewed to determine clinical signs of fever (Tm < 100.5), CNS symptoms (AMS or obtundation), skin lesions, sepsis (hypotension requiring pressors and tachycardia), abdominal complaints, or respiratory failure (mechanical ventilation). Patient who had no alternative diagnosis to explain symptoms had negative bacterial cultures or PCR-confirmed HSV meningitis.

Condition HSV Viremia without
Alternative Explanation for
Acute Illness (n=8)
HSV Viremia with Other
Potential Diagnoses to
Explain Acute Illness
(n=5)
Total
(n=13)
Hepatitis 75 40 62
Fever (72h) 75 20 54
Mortality 50 60 54
Leukopenia 50 40 46
CNS 50 40
symptoms 46
Sepsis 50 20 38
Skin lesions 25 60 38
Abd Pain 50 0 31
Respiratory 25 20
Failure 23

LABORATORY ABNORMALITIES

The most common laboratory abnormality identified was hepatitis (62%), defined as an alanine aminotransferase (ALT) level of >120 units per liter (3 times upper limit of normal). Leukopenia, a white blood cell count (WBC) of < 4.0 thousand per microliter, was seen in 6 (54%) patients concurrent with detectable HSV, and leukocytosis, a WBC of > 10 thousand per microliter, was seen in 2 (15%).

HSV TYPING

HSV type was obtained by direct genotyping or confirmatory cultures in 10 (77%) of patients; 6 had HSV-2 (60%), 3 (30%) had HSV-1 and 1 (10%) had evidence of both HSV-1 and HSV-2. Seven (54%) of 13 patients had HSV serologies sent concurrently with PCR-detectable HSV. Two of 7 patients had no detectable HSV antibody consistent with primary infection (both were identified as HSV-2). Of the remaining 5 patients, 3 had positive serologies drawn within 2 weeks of symptom onset, suggesting reactivation disease (2 with HSV-2 and 1 with HSV-1); 2 of 5 patients had positive IgG antibody results but they were drawn 4 weeks or greater after the onset of symptoms (both HSV-1) and therefore reactivation could not be distinguished from primary infection following seroconversion.

QUANTITY OF HSV DETECTED

The quantity of HSV DNA per milliliter of serum or plasma varied widely between individuals (Median = 2.79 log10 copies per milliliter, Interquartile Range = 2.43–6.18 log10 copies/mL). By Wilcoxon rank-sign test, no significant differences in peripheral blood HSV copy number were seen in immunocompetent versus immunocompromised individuals (Median HSV DNA quantity 6.34 log10 copies/ml in immunocompetent vs 2.55 log10 copies/ml in immunocompromised, p=0.06), or patients who did and did not survive (Median HSV DNA 2.90 log10 copies/ml in survivors vs 2.79 log10 copies/ml in those who died, p=0.39).

OTHER ANATOMIC SITES OF HSV INVOLVEMENT

Of the 8 patients with no explanation for presenting illness apart from the detection of HSV, 5 also had HSV detected from visceral organs or body cavities (Lung, alveolar lavage, liver, CSF or ascitic fluid) confirming dissemination of the virus to either the CNS (patients 11 and 13) or other organs (Patients 2, 6, and 8). The remaining three patients either had no samples sent (patient 3 and 5), or had only vaginal mucosal samples that were positive (patient 9). Interestingly both patients 6 and 12 were thought to have recurrences of aggressive HSV disease. Acyclovir-resistant HSV developed in Patient 6 (7) and was cultured from lung at autopsy. Patient 12 had acyclovir-resistant HSV cultured from the rectum, duodenum, and BAL. Despite altered mental status occurring in 6 (46%) of our patients, only 3 (23%) of the patients had CSF examined for HSV, and only 2 (15%) of these patients had detectable HSV by PCR. In all three cases, CSF samples were collected after peripheral blood collection.

THERAPY AND OUTCOME

All 13 adult patients with HSV detected in their peripheral blood were treated with antiherpetic antivirals; 10 with acyclovir (all but one intravenously), 2 with ganciclovir, and 1 with foscarnet. Ganciclovir was chosen by clinicians in Patients 1 and 4 due to the concurrent detection of both HSV and CMV. Patient 12 was placed on foscarnet due to worsening HSV skin lesions on acyclovir. Two of 13 patients had serial measurements of peripheral blood HSV DNA quantity while receiving acyclovir. These documented symptomatic improvement concomitant with virologic suppression. However, Patient 6 had increases in peripheral blood HSV quantity and hepatic injury (documented by increased AST levels) after transition to oral medications (Figure 2).

Six (46%) of the 13 patients responded to antiviral therapy and were discharged from the hospital. Two of the six patients discharged from the hospital died months later; one from unknown causes, the other from respiratory failure from a viral pneumonia (HSV was confirmed on bronchoscopic alveolar lavage specimens, but HSV pneumonitis was not confirmed on autopsy). Only 4 of the remaining patients discharged from the hospital have survived years later. One of the 4 patients remains on prophylactic valacyclovir up to 2 years afterwards, while the remaining three were treated with defined anti-viral regimens varying between 21 days and 6 months.

Six (60%) of 10 immunosuppressed and 1 (33%) of 3 immunocompetent individuals died during their initial hospitalization (combined mortality rate of 54%). The cause of death for 3 of the 7 patients was sepsis, ARDS, and multisystem organ failure (including liver failure) presumably secondary to HSV infection. Three patient deaths were attributed to factors apart from HSV infection, including Pneumocystis pneumonia leading to ARDS (patient #4), Pneumococcal meningitis (patient #7), and relapsed CNS lymphoma (patient #7). Patient #8 was diagnosed with sepsis in the absence of positive bacterial cultures, developed thrombocytopenia and myelosuppression, and eventually succumbed to bilateral intracranial hemorrhages.

DISCUSSION

Our study details the clinical characteristics of hospitalized adults with HSV DNA detected in the peripheral blood by PCR. Our series, derived from nearly 1000 clinical tests performed over 5 years, was notable for several features. First, the identification of 13 adult patients with HSV DNA in the peripheral blood over the span of 4 years within one group of hospitals in Seattle suggests that hospitalized patients with HSV viremia may be encountered by many practicing health care providers. Second, detection of HSV by PCR in the peripheral blood is associated with both primary HSV infection and reactivation disease. Third, approximately 1/4 of patients with HSV detected in the peripheral blood were immunocompetent. Fourth, we found detection of HSV in the peripheral blood to be accompanied by a myriad of clinical signs and symptoms, but the minority of patients had mucocutaneous lesions identified.

Our series relied on the detection of HSV DNA in the peripheral blood by PCR. None of the study patients had viral cultures of the peripheral blood performed to verify that the detection of HSV DNA represented the presence of HSV virions in the peripheral blood. However, members of our research group have recently shown that 60% of persons with high quantities of HSV DNA by PCR in peripheral blood in the setting of primary genital herpes likely had DNA contained within virions, as the samples were resistant to DNAase digestion [21].

The presence of HSV in the bloodstream of individuals with no previously identified immunodeficiency suggests that there may be unidentified genetic predispositions to more severe HSV disease. Previous studies of neonates with disseminated HSV have hypothesized that variation in Toll-like receptor 2 and human leukocyte antigens may influence severity and frequency of HSV infections [25, 26], and recent work on HSV-2 in adults supports the role of TLR-1 polymorphisms in determining the virologic severity of disease [27]. There is evidence that other immunodeficiencies with Mendelian inheritance (STAT-1, NEMO, UNC-93b, CD40L and CD16a) in the adult can also predispose to severe and recurrent HSV infection [28–32]. Genetic factors related to the innate immune system play a critical role in the protection from HSV-1 infection and may be important in preventing dissemination of the disease beyond initial sites on infection.

The most frequent clinical signs and symptoms were fever and CNS symptoms, and the most frequent laboratory abnormality was hepatitis. Sepsis syndrome was seen in 4 patients. Aseptic meningitis is a common clinical manifestation of primary genital herpes and occurs more frequently in women than men [33]. In our study, only 2 (15%) of these patients had detectable HSV by PCR in spinal fluid after peripheral blood detection, but 6 (46%) presented with altered mental status; the true incidence of detectable HSV in the CSF remains uncertain as only three out of six patients with altered mental status had CSF sent for PCR.

Approximately 60% of immunosuppressed and 33% of immunocompetent individuals died after HSV was detected in the peripheral blood. The most common cause of death was sepsis followed by multi-organ failure. The high mortality seen in this study raises a number of questions. Is HSV the primary cause of sepsis and multi-organ failure, or does detectable HSV in the blood stream represent viral reactivation in an individual whose immune system is impaired by ongoing sepsis syndrome by another causative organism or other underlying disease? Others have shown that another herpes virus, CMV, can be detected in critically ill immunocompetent patients and is associated with prolonged hospital stay and death [34]. In our series, the high mortality rate despite treatment could be due to multiple causes. First, study patients may have been diagnosed too late in the course of illness to have clinical improvement with aggressive therapy. Second, another organism (such as S. pneumonia in Patient #7) may have caused the patients’ sepsis. Third, the patient may have suffered from a significant and terminal co-morbid illness (such as large B cell lymphoma in patient #10). Ultimately, however, our study design precluded making definite conclusions as to whether there was a causal association between HSV viremia and mortality.

While we found the detection of HSV by PCR in the peripheral blood to be present in patients with high mortality, treatment was at least partially effective. The reasons for treatment failure despite administration of an effective antiviral should be investigated further but may include delay in diagnosis, inability to halt a “cytokine storm” or “sepsis syndrome,” or emergence of acyclovir-resistant virus (as was discovered in post-mortem viral cultures in Patient #6) [5]. The length of treatment varied and some responded well to relatively short courses of therapy (as little as 3 weeks), while others were treated with longer courses (from 6 months to life-long suppression). Recurrence of HSV was not uncommon, occurring in 2 of the 13 patients (patients 6 and 12).

Our study was limited by its observational and retrospective design. We are clearly not able to describe the true prevalence of HSV viremia, as only patients in whom the diagnosis was entertained had samples sent to the laboratory for analysis. Accurate estimation of the frequency and clinical consequence of HSV viremia in hospitalized patients would require a larger prospective study. PCR is an extraordinarily sensitive tool for the detection of viral DNA, and observations based on PCR must be careful to avoid laboratory contamination. In our study, we feel this is extremely unlikely given our stringent negative controls and quality assurance. A recent analysis of the performance of our PCR assay for detecting genital HSV shedding found that misclassification (false positive and negative test results) occurred less than 1% of the time when a cutoff for positive test results was set at > 50 copies per mL[9].

In summary, HSV DNA may be detected by PCR in the peripheral blood of some hospitalized inpatients with unexplained sepsis syndrome, evidence of hepatitis, and/or CNS infection with fever. Prospective studies are needed to determine the true prevalence, and clinical significance of HSV DNA detection in the peripheral blood, and to establish whether the HSV viremia is causality related to the concurrent acute illness.

ACKNOWLEDGEMENTS

Dr. Wald has received grant support from National Institutes of Health, GlaxoSmithKline, Antigenics Inc, and Astellas Pharma Inc. She has been a consultant for Immune Design, Medigene, Aicuris, and a speaker for Merck Vaccines. All other authors had no conflict of interest.

Lawrence Corey, MD directs the University of Washington Virology Laboratory which has acted as a reference laboratory for the diagnosis of HSV infections. The laboratory has received grant support from GSK, a pharmaceutical company that makes antivirals for HSV. Dr Corey is a consultant to Immune Design Corporation and Antigenics regarding HSV candidate vaccines.

Grant Support: Doris Duke Charitable Foundation Clinical Scientist Development Award (CC), NIH AI-54162 (CC), NIH AI-07044 (WB), K24 AI-071113 (AW). NIH AI-030731 (LC, AW)

REFERENCES

  • 1.Whitley RJ. Herpes Simplex Virus. In: Knipe DM, Hensley PM, editors. Fields Virology. 4th ed. Vol. 2. Philadelphia: Lippinscott, Williams, and Wilkins; 2001. pp. 2461–2506. [Google Scholar]
  • 2.Olson LC, Buescher EL, Artenstein MS, Parkman PD. Herpesvirus infections of the human central nervous system. N Engl J Med. 1967 Dec 14;277(24):1271–1277. doi: 10.1056/NEJM196712142772401. [DOI] [PubMed] [Google Scholar]
  • 3.Whitley RJ. Herpes simplex virus infections of the central nervous system. A review. Am J Med. 1988 Aug 29;85(2A):61–67. [PubMed] [Google Scholar]
  • 4.Feldman S, Stokes DC. Varicella zoster and herpes simplex virus pneumonias. Semin Respir Infect. 1987 Jun;2(2):84–94. [PubMed] [Google Scholar]
  • 5.Czartoski T, Liu C, Koelle DM, Schmechel S, Kalus A, Wald A. Fulminant, acyclovir-resistant, herpes simplex virus type 2 hepatitis in an immunocompetent woman. J Clin Microbiol. 2006 Apr;44(4):1584–1586. doi: 10.1128/JCM.44.4.1584-1586.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Flewett TH, Parker RG, Philip WM. Acute hepatitis due to Herpes simplex virus in an adult. J Clin Pathol. 1969 Jan;22(1):60–66. doi: 10.1136/jcp.22.1.60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Joseph TJ, Vogt PJ. Disseminated herpes with hepatoadrenal necrosis in an adult. Am J Med. 1974 May;56(5):735–739. doi: 10.1016/0002-9343(74)90643-3. [DOI] [PubMed] [Google Scholar]
  • 8.Harel L, Smetana Z, Prais D, et al. Presence of viremia in patients with primary herpetic gingivostomatitis. Clin Infect Dis. 2004 Sep 1;39(5):636–640. doi: 10.1086/422643. [DOI] [PubMed] [Google Scholar]
  • 9.Magaret AS, Wald A, Huang ML, Selke S, Corey L. Optimizing PCR positivity criterion for detection of herpes simplex virus DNA on skin and mucosa. J Clin Microbiol. 2007 May 1;45(5):1618–1620. doi: 10.1128/JCM.01405-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wald A, Huang ML, Carrell D, Selke S, Corey L. Polymerase chain reaction for detection of herpes simplex virus (HSV) DNA on mucosal surfaces: comparison with HSV isolation in cell culture. J Infect Dis. 2003 Nov 1;188(9):1345–1351. doi: 10.1086/379043. [DOI] [PubMed] [Google Scholar]
  • 11.Stanberry LR, Floyd-Reising SA, Connelly BL, et al. Herpes simplex viremia: report of eight pediatric cases and review of the literature. Clin Infect Dis. 1994 Mar;18(3):401–407. doi: 10.1093/clinids/18.3.401. [DOI] [PubMed] [Google Scholar]
  • 12.Muller SA, Herrmann EC, Jr, Winkelmann RK. Herpes simplex infections in hematologic malignancies. Am J Med. 1972 Jan;52(1):102–114. doi: 10.1016/0002-9343(72)90012-5. [DOI] [PubMed] [Google Scholar]
  • 13.Ramsey PG, Fife KH, Hackman RC, Meyers JD, Corey L. Herpes simplex virus pneumonia: clinical, virologic, and pathologic features in 20 patients. Annals of internal medicine. 1982 Dec;97(6):813–820. doi: 10.7326/0003-4819-97-6-813. [DOI] [PubMed] [Google Scholar]
  • 14.Johnson JR, Egaas S, Gleaves CA, Hackman R, Bowden RA. Hepatitis due to herpes simplex virus in marrow-transplant recipients. Clin Infect Dis. 1992 Jan;14(1):38–45. doi: 10.1093/clinids/14.1.38. [DOI] [PubMed] [Google Scholar]
  • 15.Kusne S, Schwartz M, Breinig MK, et al. Herpes simplex virus hepatitis after solid organ transplantation in adults. The Journal of infectious diseases. 1991 May;163(5):1001–1007. doi: 10.1093/infdis/163.5.1001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kaufman B, Gandhi SA, Louie E, Rizzi R, Illei P. Herpes simplex virus hepatitis: case report and review. Clin Infect Dis. 1997 Mar;24(3):334–338. doi: 10.1093/clinids/24.3.334. [DOI] [PubMed] [Google Scholar]
  • 17.Frederick DM, Bland D, Gollin Y. Fatal disseminated herpes simplex virus infection in a previously healthy pregnant woman. A case report. The Journal of reproductive medicine. 2002 Jul;47(7):591–596. [PubMed] [Google Scholar]
  • 18.Fahy RJ, Crouser E, Pacht ER. Herpes simplex type 2 causing fulminant hepatic failure. Southern medical journal. 2000 Dec;93(12):1212–1216. [PubMed] [Google Scholar]
  • 19.Farr RW, Short S, Weissman D. Fulminant hepatitis during herpes simplex virus infection in apparently immunocompetent adults: report of two cases and review of the literature. Clin Infect Dis. 1997 Jun;24(6):1191–1194. doi: 10.1086/513646. [DOI] [PubMed] [Google Scholar]
  • 20.Zahariadis G, Jerome K, Corey L. Herpes simplex virus-associated sepsis in a previously infected immunocompetent adult. Annals of internal medicine. 2003 Jul 15;139(2):153–154. doi: 10.7326/0003-4819-139-2-200307150-00020. [DOI] [PubMed] [Google Scholar]
  • 21.Johnston C, Magaret A, Selke S, Remington M, Corey L, Wald A. Herpes Simplex Virus Viremia during Primary Genital Infection. The Journal of infectious diseases. 2008 May;9 doi: 10.1086/588676. [DOI] [PubMed] [Google Scholar]
  • 22.Ryncarz AJ, Goddard J, Wald A, Huang ML, Roizman B, Corey L. Development of a high-throughput quantitative assay for detecting herpes simplex virus DNA in clinical samples. J Clin Microbiol. 1999 Jun;37(6):1941–1947. doi: 10.1128/jcm.37.6.1941-1947.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jerome KR, Huang ML, Wald A, Selke S, Corey L. Quantitative stability of DNA after extended storage of clinical specimens as determined by real-time PCR. J Clin Microbiol. 2002 Jul;40(7):2609–2611. doi: 10.1128/JCM.40.7.2609-2611.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Corey L, Huang ML, Selke S, Wald A. Differentiation of herpes simplex virus types 1 and 2 in clinical samples by a real-time taqman PCR assay. J Med Virol. 2005 Jul 1;76(3):350–355. doi: 10.1002/jmv.20365. [DOI] [PubMed] [Google Scholar]
  • 25.Kurt-Jones EA, Belko J, Yu C, et al. The role of toll-like receptors in herpes simplex infection in neonates. The Journal of infectious diseases. 2005 Mar 1;191(5):746–748. doi: 10.1086/427339. [DOI] [PubMed] [Google Scholar]
  • 26.Kurt-Jones EA, Chan M, Zhou S, et al. Herpes simplex virus 1 interaction with Toll-like receptor 2 contributes to lethal encephalitis. Proceedings of the National Academy of Sciences of the United States of America. 2004 Feb 3;101(5):1315–1320. doi: 10.1073/pnas.0308057100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bochud PY, Magaret AS, Koelle DM, Aderem A, Wald A. Polymorphisms in TLR2 are associated with increased viral shedding and lesional rate in patients with genital herpes simplex virus Type 2 infection. The Journal of infectious diseases. 2007 Aug 15;196(4):505–509. doi: 10.1086/519693. [DOI] [PubMed] [Google Scholar]
  • 28.Casrouge A, Zhang SY, Eidenschenk C, et al. Herpes simplex virus encephalitis in human UNC-93B deficiency. Science (New York, NY. 2006 Oct 13;314(5797):308–312. doi: 10.1126/science.1128346. [DOI] [PubMed] [Google Scholar]
  • 29.Dupuis S, Jouanguy E, Al-Hajjar S, et al. Impaired response to interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nature genetics. 2003 Mar;33(3):388–391. doi: 10.1038/ng1097. [DOI] [PubMed] [Google Scholar]
  • 30.Garcia-Perez MA, Paz-Artal E, Corell A, et al. Mutations of CD40 ligand in two patients with hyper-IgM syndrome. Immunobiology. 2003;207(4):285–294. doi: 10.1078/0171-2985-00241. [DOI] [PubMed] [Google Scholar]
  • 31.Jawahar S, Moody C, Chan M, Finberg R, Geha R, Chatila T. Natural Killer (NK) cell deficiency associated with an epitope-deficient Fc receptor type IIIA (CD16-II) Clinical and experimental immunology. 1996 Mar;103(3):408–413. doi: 10.1111/j.1365-2249.1996.tb08295.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Puel A, Reichenbach J, Bustamante J, et al. The NEMO mutation creating the most-upstream premature stop codon is hypomorphic because of a reinitiation of translation. American journal of human genetics. 2006 Apr;78(4):691–701. doi: 10.1086/501532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Corey L, Adams HG, Brown ZA, Holmes KK. Genital herpes simplex virus infections: clinical manifestations, course, and complications. Annals of internal medicine. 1983 Jun;98(6):958–972. doi: 10.7326/0003-4819-98-6-958. [DOI] [PubMed] [Google Scholar]
  • 34.Limaye AP, Kirby KA, Rubenfeld GD, et al. Cytomegalovirus reactivation in critically ill immunocompetent patients. JAMA. 2008 Jul 23;300(4):413–422. doi: 10.1001/jama.300.4.413. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES