Skip to main content
NCBI home page
Endocrinology logoLink to Endocrinology
. 2009 Nov 3;151(1):358–368. doi: 10.1210/en.2009-0760

Deletion of the Novel Oocyte-Enriched Gene, Gpr149, Leads to Increased Fertility in Mice

Mark A Edson 1, Yi-Nan Lin 1, Martin M Matzuk 1
PMCID: PMC2803152  PMID: 19887567

Abstract

Through in silico subtraction and microarray analysis, we identified mouse Gpr149, a novel, oocyte-enriched transcript that encodes a predicted orphan G-protein-coupled receptor (GPR). Phylogenetic analysis of GPR149 from fish to mammals suggests that it is widely conserved in vertebrates. By multitissue RT-PCR analysis, we found that Gpr149 is highly expressed in the ovary and also in the brain and the digestive tract at low levels. Gpr149 levels are low in newborn ovaries but increase throughout folliculogenesis. In the ovary, we found that granulosa cells did not express Gpr149, whereas germinal vesicle and meiosis II stage oocytes showed high levels of Gpr149 expression. After fertilization, Gpr149 expression declined, becoming undetectable by the two-cell stage. To study the function of GPR149 in oocyte growth and maturation, we generated Gpr149 null mice. Surprisingly, Gpr149 null mice are viable and have normal folliculogenesis, but demonstrate increased fertility, enhanced ovulation, increased oocyte Gdf9 mRNA levels, and increased levels of FSH receptor and cyclin D2 mRNA levels in granulosa cells. Thus, Gpr149 null mice are one of the few models with enhanced fertility, and GPR149 could be a target for small molecules to enhance fertility in the assisted reproductive technology clinic.

Deletion of the highly conserved orphan G-protein-coupled receptor, GPR149, increases mouse fertility.

G protein-coupled receptors (GPCRs) make up the largest membrane receptor superfamily and are the most common targets of medicinal drugs (1). All members of this family have seven-transmembrane domains and can be broadly divided into two groups, the chemosensory GPCRs that respond to external sensory signals such as odors, pheromones, and tastes, and the endoGPCRs that respond to endogenous signals, including peptides, hormones, lipids, neurotransmitters, and nucleotides (2). Based on common sequence motifs, GPCRs are further subdivided into four to five main families according to two commonly used nomenclature systems, the A-F (3) and the GRAFS classification systems (4). These families include the class A (Rhodoposin-like), which is the largest family, class B (subdivided by the GRAFS system into Adhesion and Secretin), class C (Glutamate), and class F (Frizzled/Taste2) (reviewed in Ref. 1). Most GPCRs share common signaling mechanisms; through interactions with G-proteins, GPCRs regulate the synthesis of second messengers such as cAMP, inositol 1,4,5-trisphosphate, diacylglycerol, and calcium. Of the 367 human and 392 mouse endoGPCRs identified by database mining, 343 are common to both species, suggesting that the functions of many endoGPCRs are conserved in humans and mice (2). Approximately 140 endoGPCRs are classified as orphan receptors with unknown ligands (5). A better understanding of the physiological functions of these receptors could help prioritize candidates of pharmacological interest.

By microarray analysis, RT-PCR with degenerate and gene-specific primers, and expressed sequence tag (EST) database scanning, more than 30 GPCR mRNAs are estimated to be present in mouse oocytes (6). Many of these are orphan GPCRs with unknown endogenous ligands. The potential importance of orphan GPCRs in oocyte physiology is highlighted by studies demonstrating premature resumption of meiosis in oocytes from Gpr3 null female mice (7,8). The importance of bidirectional communication between oocytes and somatic cells during the course of folliculogenesis is widely accepted (9,10), and although it is known that the follicle cells around the antral oocyte are necessary to keep it in prophase of meiosis I, the communication pathways between follicle cells and oocytes that maintain this arrest remain unknown. Elevated cAMP in the oocyte is necessary for prophase meiotic arrest, and its production requires the activation of the oocyte heterotrimeric G protein, Gs (11). GPR3 has been shown to constitutively activate Gs, but in a manner independent of ovarian follicle cells, suggesting that it is not a direct target of the granulosa cell signal to the oocyte to maintain meiotic arrest (12).

We sought to identify additional oocyte-specific GPCRs that might be important in the cross talk that occurs between oocytes and granulosa cells during folliculogenesis and could therefore be novel contraceptive or in vitro fertilization targets. By in silico subtraction and microarray analysis, we identified the orphan GPCR, Gpr149, which we show is highly expressed in the mouse oocyte. Gpr149 has previously been identified in chicken embryo dorsal root ganglion and gonads (13), mouse ventral medial hypothalamus (14), and astrocytes induced to differentiate from a rat glial progenitor cell line (15). Although categorized as a class A, rhodopsin-related GPCR, GPR149 has many unique features, including a long, highly conserved carboxyl terminus and a lack of the first two charged amino acids of the characteristic Asp-Arg-Tyr (DRY) motif found at the end of the third transmembrane helix and important in G protein coupling (16). Furthermore, the transmembrane domains and carboxyl terminus of GPR149 lack similarities to other GPCRs or proteins. To determine the physiological role of GPR149 in mouse oocytes, we generated Gpr149 knockout mice. Unexpectedly, deletion of Gpr149 is not detrimental to female fertility but instead results in increased fertility and fecundity.

Materials and Methods

In silico subtraction and cross-species comparison

Using a previously described strategy (17), transcripts with a similar expression pattern to the oocyte-enriched gene, growth differentiation factor 9 (Gdf9), were downloaded from the Genomics Institute of Novartis Research Foundation Gene Expression Database Symatlas [(18), http://symatlas.gnf.org/symatlas/]. These oocyte-enriched candidates were organized by gene ontology using GoMiner (http://discover.nci.nih.gov/gominer/). The translated coding sequence of mouse GPR149 was used in a tBLASTn (http://www.ncbi.nlm.nih.gov/blast) search against the entire nonredundant and EST databases to identify putative mouse homologs as well as orthologs in humans and other species. University of California, Santa Cruz, Genome Browser (http://genome.ucsc.edu/) was also used to align mouse Gpr149 with the genomes of more divergent species, such as teleost fish, and matching exons were used to deduce open reading frames. Predicted GPR149 proteins of different species were aligned using the MEGALIGN program of DNASTAR software (Madison, WI).

Semiquantitative RT-PCR analysis

Total RNA from adult wild-type (WT) mouse tissues was obtained as described (19) and reverse transcribed using Superscript III reverse transcriptase and random hexamers (Invitrogen, Carlsbad, CA). Granulosa cells and germinal vesicle (GV) stage oocytes from juvenile WT mice were obtained by antral follicle puncture using a 26-gauge needle 44–46 h after ip injection of 5 IU pregnant mare serum gonadotropin (PMSG; Calbiochem, La Jolla, CA). To separate granulosa cells and oocytes, ovaries were pipetted 50 times and then passed through a 40-μm nylon filter (Nalgene, Rochester, NY) to obtain the granulosa cell population. The filter was then inverted and washed with M2 medium (Sigma, St. Louis, MO) to recover GV oocytes. For metaphase II stage oocytes, mice were given 5 IU human chorionic gonadotropin (hCG; Novarel; Ferring Pharmaceuticals, Parsippany, NJ) 46 h after PMSG, and 16–18 h later oocytes were recovered from the ampulla of the oviduct into M2 medium containing 0.5 mg/ml hyaluronidase (Sigma). For one- and two-cell embryos, after hCG, females were bred to WT males and embryos obtained as described (20). Total RNA was extracted from these cell types using the RNeasy mini kit (QIAGEN, Valencia, CA) and cDNA prepared as above. All gene-specific primers were designed to span exons. The primers for amplifying a 398-bp Gpr149 cDNA fragment were Gpr149-Det-1 forward, 5′-GTTGCCTTCGATGGGAAAAAG and Gpr149-Det-1 reverse, 5′-TGGGACAGTCGTCTCTCTGGA. Hprt1 and Gapdh served as loading controls and were amplified with the following primers: Hprt1 forward, 5′-CCTGGTTAAGCAGTACAGCC, reverse, 5′-TACTAGGCAGATGGCCACAG; Gapdh forward, 5′-AACTTTGGCATTGTGGAAGG, reverse, 5′-ACACATTGGGGGTAGGAACA.

5′ rapid amplification of cDNA 5′ ends (RACE)

To confirm the completeness of the 5′ end of Gpr149, 5′RACE was performed on oocyte cDNA using the SMART RACE cDNA amplification kit (BD Biosciences, San Jose, CA) and the following gene specific primer: 5′-TGCCAAGCTCAAGGGGAAGCT. Amplified DNA fragments were cloned into pGEM T-Easy vector (Promega, Madison, WI) and sequenced.

Generation and genotyping of GPR149 knockout mice

A targeting construct was prepared using a recombineering strategy (21). Briefly, a 13.2-kb genomic region containing exons 1 and 2 of Gpr149 was retrieved from BAC bMQ-398D6 (22) (Wellcome Trust Sanger Institute, Cambridge, UK). LoxP sites were introduced into nonconserved regions 500 bp upstream of exon 1 and in a nonconserved region of intron 1. The linearized targeting vector containing a Frt-flanked PGK-Neo cassette and a diphtheria toxin A expression cassette for positive and negative selection, respectively, was electroporated into AB2.1 embryonic stem (ES) cells from a 129S7/SvEv strain. ES cell clones were selected in M15 containing 0.18 mg/ml G418 (Gibco, Carlsbad, CA). Targeted clones were detected by Southern blot analysis of EcoRV-digested or NheI-digested DNA using 5′ and 3′ probes external to the homologous vector arms. Thirteen correctly targeted ES cell clones were expanded and five were injected into recipient C57BL/6J blastocysts to obtain chimeric mice that ultimately produced C57BL/6J;129S7/SvEv hybrid F1 Gpr149Flox/+ progeny. Gpr149+/− mice were generated by crossing the F1 progeny to EIIa-cre transgenic mice (23) (Jackson Laboratory, Bar Harbor, ME). Homozygous Gpr149 mutant mice (Gpr149−/−) were produced by intercrossing male and female Gpr149+/− mice. Mice were genotyped by Southern blot and PCR analysis. For PCR genotyping the following primers were used in a multiplex assay: WT forward, AGATTCATGTGGACCCCTCCTT; WT reverse, CCTGGAGAGATGCAACACACAC; and null-R1, TGAAACCCCACCACGTGTTTTA.

Fertility analysis

All mouse experiments were performed on a C57BL/6J;129S7/SvEvBrd hybrid background in accordance with protocols approved by the Institutional Care and Use Committee of Baylor College of Medicine. To assess reproductive performance, individually housed 6-wk-old Gpr149−/− and Gpr149+/− female littermates were bred to WT or Gpr149+/− males. The number of litters and pups born per litter were recorded over the course of 6 months.

Estrous cycle monitoring

Vaginal smears from 6- to 8-wk-old Gpr149+/− and Gpr149−/− mice were collected daily between 1100 and 1200 h over the course of 1 month. Each cage contained five females of either genotype and nestlets from WT male cages were added weekly to maintain cycling. Smears were diluted in PBS, examined under a light microscope, and classified into one of four phases of the estrous cycle (prestrus, estrus, metestrus, or diestrus) as described elsewhere (24). To gauge cycle progression, smears were read at 4-d intervals by the same individual without knowledge of genotype.

Serum hormonal analysis

Randomly cycling 12-wk-old mice were anesthetized with isoflurane (Abbott Laboratories, Chicago, IL), and blood was collected by cardiac puncture. Serum was prepared using microtainer tubes (Becton Dickinson, Franklin Lakes, NJ), and FSH and LH measurements were performed by the University of Virginia Ligand Core Facility (Specialized Cooperative Center Program in Reproduction and Infertility Research, National Institutes of Health Grant IH U54 HD28934).

Histological analysis and quantification of growing follicles

Ovaries were fixed overnight in 10% neutral buffered formalin and then transferred to 70% ethanol. Tissue processing and embedding were performed by the Department of Pathology Core Services Laboratory (Baylor College of Medicine, Houston, TX), and 5-μm sections were stained with periodic acid-Schiff reagent and hematoxylin counterstain. The number of preantral and antral follicles was determined as described previously (25,26). Briefly, the number of healthy growing follicles in the five largest serial sections from 50-μm intervals was recorded and normalized to the total area of the section. Measurements were performed using AxioVision 4.0 software (Carl Zeiss, Jena, Germany), and results are reported as the average number of follicles/mm2.

Ovulation and oocyte viability assays

Superovulation of 21- to 25-d-old mice was performed as described elsewhere (20) and above, and the number of retrieved oocytes per female was recorded. In vivo fertilization was determined by housing females with WT males at the time of hCG administration. Females with a copulatory plug were euthanized 40–44 h after hCG, and unfertilized oocytes and two-cell embryos were flushed from the oviducts with M2. Embryos were cultured at 37 C with 5% CO2 in M16 (Sigma) microdrops containing 100 U/ml penicillin-streptomycin (Invitrogen) and monitored for progression to the blastocyst stage over the course of 3 d.

Natural ovulation was determined by housing 6- to 16-wk-old females with stud males and checking for copulation plugs on a daily basis. Females with a copulatory plug were euthanized and cumulus-oocyte complexes (COCs) were collected from the oviduct in M2 containing 0.3 mg/ml hyaluronidase. Fertilization was assessed by pronucleus formation and extrusion of the second polar body, and cleavage to the two-cell and blastocyst stages was assessed after culturing zygotes in M16 microdrops for 24 h and 4 d, respectively.

Quantitative PCR

Granulosa cells and oocytes were isolated as describe above. Total RNA from granulosa cells of individual WT and Gpr149−/− mice was extracted using the RNeasy minikit (QIAGEN). Oocytes from three to four animals of each genotype were pooled, and total RNA was extracted using the RNeasy microkit (QIAGEN). RNA was reverse transcribed in a 50-μl reaction using 250 U Superscript III reverse transcriptase (Invitrogen). Granulosa cell samples were diluted 20-fold and oocyte samples were diluted 15-fold, and 5 μl were used for each quantitative PCR, which was performed on an ABI prism 7500 sequence detection system (Applied Biosystems, Foster City, CA). The following predesigned TaqMan gene expression assays (Applied Biosystems) were used: Fshr, Mm00442819; Ccnd2, Mm00438071; Lhcgr, Mm0442931; Bmp15, Mm00437797; Gdf9, Mm00433565. The relative quantity of transcript was calculated according to the 2−ΔΔCT method (27).

In vitro cumulus expansion assays

Nonexpanded COCs were isolated into culture medium by needle puncture of large antral follicles of 3- to 4-wk-old mice 44–46 h after injection of 5 IU PMSG. Intact COCs from individual animals (n = 3–4 animals/genotype) were cultured in 30-μl droplets of MEM (Invitrogen) supplemented with 5% heat-inactivated fetal bovine serum (Sigma), 25 mm HEPES (Sigma), 0.25 mm sodium pyruvate (Invitrogen), 3 mm l-glutamine (Invitrogen), and 100 U/ml penicillin-streptomycin, in the presence or absence of 10 ng/ml recombinant human FSH (Organon, West Orange, NJ). Cumulus expansion was assessed after 9, 12, and 20 h of culture.

Statistical analysis

Data are presented as the mean ± sem. JMP version 8.0 software (SAS Software, Cary, NC) was used for statistical analysis. Differences between groups were evaluated using the Student’s t test for single comparisons or one-way ANOVA followed by Tukey’s honestly significant differences test for multiple comparisons. P < 0.05 was considered statistically significant.

Results

Identification of Gpr149 as an oocyte-enriched gene by in silico subtraction

To identify novel oocyte-specific GPCRs that could be potential targets for fertility control, we took advantage of publicly available microarrays and EST data (17). Using the Genomics Institute of Novartis Research Foundation SymAtlas database, which contains microarray data from 61 mouse tissues, including oocytes and fertilized eggs (18), we retrieved transcripts with an expression pattern similar to the oocyte-enriched gene, Gdf9. Using GoMiner, these transcripts were grouped by gene ontology into the GPCR category of molecular function, and, in the process, we identified Gpr149. As proof of principle, this strategy also identified an additional orphan GPCR, Gpr3, which is required to maintain meiotic arrest in mouse oocytes (7,8). To verify the presence of Gpr149 in the oocyte, we performed 5′RACE analysis and RT-PCR to clone the 5′ untranslated region and open reading frame of the predicted Gpr149 cDNA from WT oocyte RNA. Sequencing of the cloned Gpr149 cDNA revealed a T/G single-nucleotide polymorphism (SNP) that would result in an Ile for Ser at amino acid 357 of GPR149. This SNP was also found in the Celera assembly of the mouse genome (SNP rs31283096).

After confirming that Gpr149 was expressed in oocytes, we determined the efficacy of our in silico subtraction strategy to identify oocyte-enriched genes by performing RT-PCR on RNA from multiple adult mouse tissues (Fig. 1A). In addition to being expressed in the ovary, Gpr149 is also expressed in the brain and at lower levels in the stomach and small intestine.

Figure 1.

Figure 1

Open in a new tab

Expression profiles of mouse Gpr149. A, Semiquantitative multitissue RT-PCR demonstrates that Gpr149 transcripts are abundant in oocytes (Oo) but also found in brain (Br) and at lower levels in stomach (St) and small intestine (In). B, RT-PCR in ovaries of different ages shows an increase of Gpr149 during folliculogenesis. C, In the ovary, Gpr149 is found only in oocytes and transcript levels decrease after fertilization. Gapdh and Hprt1 were used as loading controls. He, Heart; Li, liver; Sp, spleen; Lu, lung; Ki, kidney; Sk, skeletal muscle; Te, testis; Ov, ovary; Nb, newborn; Ad, adult; GC, granulosa cell; GV, germinal vesicle; M-II, meiosis-II oocyte; 1-C, one-cell embryo; 2-C, two-cell embryo.

Microarray data profiling of gene expression patterns in oocytes derived from primordial to large antral follicles (28) that is available on the Gene Expression Omnibus database (GEO; www.ncbi.nlm.nih.gov/geo/) (GEO data set 1266) suggested Gpr149 increases during the course of follicular development, particularly in the primordial to primary follicle transition. To indirectly assess the expression of Gpr149 in oocytes of different stage follicles, we isolated ovaries from juvenile females of different ages. In newborn ovaries, which contain germ cell cysts and primordial follicles, Gpr149 levels were low. By postnatal day (P) 15, ovaries contain follicles up to the preantral stage, and by P21, antral follicles begin to form. Gpr149 was more abundant in P15 and P21 ovaries relative to newborn (Fig. 1B), corroborating the microarray data that showed its expression increases throughout follicular development (28). Within the ovary, Gpr149 expression is restricted to oocytes, and it is not detected in the somatic compartment. After fertilization, Gpr149 mRNA decreases dramatically, and it is undetectable by the two-cell embryo stage (Fig. 1C). The decline in Gpr149 after fertilization is consistent with microarray data from preimplantation mouse development (29) (GEO data set 814).

Structural characterization of the putative GPR149 protein and identification of orthologous genes

Mouse Gpr149 encodes a predicted heptahelical protein of 732 amino acids with a coiled-coil domain at the extreme C terminus as inferred by the SMART protein program [http://smart.embl-heidelberg.de/ (30)]. Using multiple genomic databases and deduced protein alignment, we identified conserved orthologs in the majority of vertebrates from teleost fish species through mammals that share similar predicted secondary structures (Fig. 2A). The orthologous genes are all located in syntenic chromosomal regions, distal to the DEAH (Asp-Glu-Ala-His) box polypeptide 36 (DHX36) gene. Despite the presence of Dhx36 in the zebrafish genome, however, we did not identify a Gpr149 ortholog in zebrafish. The full-length mouse and human GPR149 proteins share 78.3% identity. Mouse GPR149 has a long carboxyl terminus of about 365 amino acids, of which the last approximately 220 amino acids share nearly 90% identity from humans to frogs (Fig. 2B). After extensive BLAST searches against the nonredundant database using the full-length, transmembrane, and C-terminal domains of mouse GPR149, we did not identify any GPCR homologs closely related to GPR149. Furthermore, although GPR149 belongs to the class A, rhodopsin family of GPCRs, it does not have the characteristic DRY motif (Asp-Arg-Tyr) following the third transmembrane helix on the cytosolic side of the membrane that is believed to be important in G protein coupling (16). The corresponding motif at this location in GPR149 is a highly conserved NFY from humans to frogs and TFY in pufferfish, which could mean GPR149 is not actually a GPCR but instead serves some other function in the oocyte (see Discussion).

Figure 2.

Figure 2

Open in a new tab

Alignment and percent identities of GPR149 orthologs. GPR149 is conserved from fish to humans (A). Full-length human and mouse GPR149 proteins are 78.4% identical, whereas the C-termini of GPR149 orthologs share approximately 90% homology from amphibians to humans (B). Predicted transmembrane helices (Tm) are underlined and asterisks at the end of transmembrane helix 3 denote a highly conserved NFY (TFY in Fugu) motif in place of the traditional DRY motif found in the majority of GPCRs.

Generation of Gpr149 mutant mice

The oocyte-enriched expression pattern of Gpr149 and unique, conserved features of GPR149 orthologs suggested that it could have an important function during oocyte development. We used a reverse genetics approach to study the physiological role of GPR149 in mouse oocytes. Because Gpr149 was not exclusively expressed in the oocyte, we designed a targeting vector with loxP sites flanking exon 1 to allow for conditional deletion of Gpr149 in oocytes, if necessary (Fig. 3A). Cre-mediated recombination would delete exon 1, which includes the transcriptional start site and the N-terminal 328 codons, including the signal peptide sequence and the first six transmembrane regions of GPR149. We generated a targeted Gpr149 allele (Gpr149Flox) in embryonic stem cells using homologous recombination, and after germline transmission of the floxed allele, F1 Gpr149Flox/+ mice were crossed with EIIa-cre mice to produce mice heterozygous for the null allele (Gpr149tm1Zuk; herein called Gpr149−). Successful recombination was verified by Southern blot analysis using both 5′ and 3′ external probes (Fig. 3B). Despite the expression of Gpr149 in some tissues outside of the ovary, intercrossing heterozygous mutant mice produced viable homozygous null (Gpr149−/−) mice with no apparent gross abnormalities. Moreover, male and female offspring from heterozygous mating pairs were born in approximately a 1:1 ratio with an expected Mendelian distribution [i.e. the genotypes of 169 littermate pups were 40 Gpr149+/+ (23.7%), 85 Gpr149+/− (50.3%), 44 Gpr149−/− (26%)], indicating that the absence of GPR149 does not alter viability. To confirm that our strategy created a null allele, we performed RT-PCR using multiple primer pairs that spanned exons downstream of exon 1; the absence of Gpr149 mRNA in the oocytes of homozygous mutants (Fig. 3D) confirmed that the Gpr149− allele was null.

Figure 3.

Figure 3

Open in a new tab

Targeted disruption of Gpr149. A, Gpr149 genomic locus and targeting vector for generation of a Gpr149 floxed allele. A targeting vector with loxP sites surrounding exon 1 (EX1) was introduced into AB2.1 ES cells. Recombination of the targeted allele was achieved by crossing F1 animals to EIIa-Cre transgenic mice. B, Southern blot analysis of EcoRV (EV)-digested tail DNA extracted from WT, Gpr149+/−, and Gpr149−/− mice, using a 3′ external probe that detects a 19.3 kb WT and an 8.8 kb null allele. C, PCR analysis for genotyping WT, Gpr149+/−, and Gpr149−/− mice. The sizes of predicted WT and null alleles are 360 and 449 bp, respectively. D, Confirmation of the absence of Gpr149 cDNA in Gpr149−/− oocytes using primers spanning exons 2 and 3. Identical results were obtained using primers spanning exons 3 and 4 (not shown). DTA, Diphtheria toxin fragment A; N, NheI; X; XhoI.

Gpr149 null females show increased fertility and fecundity

To assess the potential roles of GPR149 in female fertility, Gpr149−/− and Gpr149+/− females were bred to WT or Gpr149+/− males on a mixed genetic background (B6;129S7) beginning at 6 wk of age. Over the course of 6 months of breeding, 10 Gpr149+/− females produced an average of 46 pups per female from 64 litters (1.06 ± 0.03 litters per month) with an average litter size of 7.09 ± 0.59 pups per litter. Gpr149−/− females produced an average 65 pups per female from 72 litters (1.2 ± 0.03 litters per month, P < 0.01) with a modest, but significant increase in mean litter size (9.02 ± 0.58 pups per litter, P < 0.05) (Fig. 4, A–C). Thus, the significant increases in litter size and litters per month in Gpr149−/− females translated to an approximate 40% increase in the cumulative number of pups produced per female, relative to Gpr149+/− control females. There was, however, no difference in the time to first litter between control (21.0 ± 0.5 d) and Gpr149−/− females (22.1 ± 0.6 d). These data are summarized in Table 1.

Figure 4.

Figure 4

Open in a new tab

Fertility and estrous cycle analysis in Gpr149−/− and control females. A, Average number of pups produced by Gpr149−/− and Gpr149+/− females over the course of 6 months of breeding (n = 10 per genotype). Gpr149−/− produced approximately 40% more pups during this time. Both an increase in average litter size (B) and litters per month (mo; C) contribute to the higher cumulative number of pups produced by Gpr149−/− females. D and E, Vaginal smears from 6- to 8-week-old females were collected over the course of 1 month and assigned to one of four phases of the estrous cycle. D, The percent of time in estrus for Gpr149−/− females (n = 5) was significantly higher compared with Gpr149+/− females (n = 4). E, There were also fewer days between estrus in Gpr149−/− females compared with Gpr149+/− females. *, P < 0.05; **, P < 0.01 Student’s t test.

Table 1.

Fertility testing of Gpr149+/− control and Gpr149−/− females over 6 months

Genotype n Litters Total pups Pups/litter Litters/month Time to first litter (d)
Gpr149+/− 10 64 458 7.09 ± 0.59 1.07 ± 0.03 21.0 ± 0.5
Gpr149−/− 10 72 646 9.02 ± 0.58a 1.2 ± 0.03b 22.1 ± 0.6
Open in a new tab

Results are shown as the mean ± sem. 

a

P < 0.05, Student’s t test. 

b

P < 0.01, Student’s t test. 

To determine whether the increase in fertility in Gpr149−/− females might be due to alterations in the hypothalamic-pituitary-gonadal (HPG) axis, serum gonadotropins were measured in randomly cycling mice at 12 wk of age (n = 5–6 mice for each genotype). No differences were detected in the levels of FSH and LH between Gpr149−/− and Gpr149+/− mice (Gpr149−/− FSH: 5.5 ± 0.6, LH: 0.33 ± 0.04; Gpr149+/− FSH: 5.25 ± 0.64, LH: 0.35 ± 0.04; supplemental Table S1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org). Despite normal gonadotropin levels, estrous cycle monitoring of 6- to 8-wk-old females indicated that Gpr149−/− females spend more time in estrus (Fig. 4D). In addition, although the length of estrous cycles for Gpr149+/− females did not differ from previous reports for WT females housed in similar numbers (31), Gpr149−/− females had shorter cycles with fewer days between estrus compared with control females (Fig. 4E).

Histological analysis of Gpr149 null ovaries

To evaluate whether loss of Gpr149 impacts follicular development, ovaries from 6-, 12-, and 52-wk-old females were analyzed. No gross changes in ovarian size were noticeable at these time points. Histologically, both control and Gpr149−/− ovaries contained follicles in all stages of development at the ages examined with no obvious discrepancies between control and experimental ovaries (Fig. 5, A–F). Upon closer inspection of ovaries from 12-wk-old females, however, a significant increase in the number of preantral and antral follicles was observed in Gpr149−/− ovaries (P < 0.05; Fig. 5G).

Figure 5.

Figure 5

Open in a new tab

Histologic analysis of Gpr149+/− and Gpr149−/− ovaries. Ovaries from Gpr149+/− and Gpr149−/− mice at 6 weeks (A and B), 12 weeks (C and D), and 1 yr (E and F), demonstrating normal folliculogenesis with follicles in all stages of development (n ≥ 3 mice of each genotype). PF, primary follicle; SF, secondary follicle; PrF, preantral follicle; AF, antral follicle; CL, corpus luteum. All images were taken at 25×. G, Quantification of preantral and antral follicles per surface area (*, P < 0.05; Student’s t test).

Increased ovulation and gene expression changes in Gpr149 null females

To determine whether the increased number of pups born was due to increased ovulation, immature Gpr149−/−, Gpr149+/−, and Gpr149+/+ (WT) littermates were subjected to a superovulation regimen of PMSG followed by hCG, and oocytes were recovered from the oviducts the following morning. Both Gpr149−/− and Gpr149+/− females ovulated more oocytes compared with WT littermates, but there was no difference in the ovulatory response to exogenous gonadotropins between heterozygous and homozygous mutant mice (Fig. 6A). However, when superovulated immature females were mated to adult WT males, the fertilization of Gpr149−/− oocytes was greater than that of Gpr149+/− or WT oocytes (Fig. 6B). In addition, the spontaneous ovulation of unstimulated adult Gpr149−/− females was higher relative to both Gpr149+/− and WT females (Fig. 6C). When cultured in vitro, the developmental potential of fertilized oocytes, as determined by progression of one- or two-cell embryos to the blastocyst stage, did not differ between Gpr149−/− and control oocytes (data not shown).

Figure 6.

Figure 6

Open in a new tab

Enhanced ovulation and fertilization success in Gpr149−/− females. A, Average number of oocytes ovulated by 3-wk-old Gpr149+/+ (WT), Gpr149+/−, and Gpr149−/− females after pharmacological superovulation. Mice were superovulated and oocytes were obtained from the ampulla of the oviduct 16–18 h after hCG. Although there was no difference in the mean number of oocytes obtained from Gpr149+/− and Gpr149−/− females [51.2 ± 3.3 (n = 10) and 47.7 ± 3.2 (n = 12), respectively], both heterozygous and homozygous mutant females ovulated significantly more oocytes than WT littermates (29.2 ± 2.2, n = 5) in response to exogenous gonadotropins. B, Average fertilization and cleavage rate of oocytes from WT, Gpr149+/−, and Gpr149−/− females. Three- to 4-wk-old mice were mated to WT males after superovulation, and embryos and unfertilized oocytes were flushed from the oviducts 1.5 d after conception. A significantly higher proportion of oocytes from Gpr149−/− were fertilized and progressed to the two-cell stage [WT, 86.9 ± 1.8% (n = 6); Gpr149+/− 91.8 ± 0.9% (n = 7); Gpr149−/− 96.1 ± 0.6% (n = 8)]. C, Average number of oocytes naturally ovulated by adult WT, Gpr149+/−, and Gpr149−/− females. Compared with WT and Gpr149+/− females, more COCs were found in the ampulla of Gpr149−/− females the morning after identification of a copulation plug after natural mating [WT 7.7 ± 0.7 (n = 7); Gpr149+/− 7.4 ± 0.6 (n = 7); Gpr149−/− 9.9 ± 0.5)n = 8)]. Results shown in all panels are from at least four independent experiments. Data were analyzed using one-way ANOVA and Tukey’s honestly significant differences test. Bars with a different letter (a, b, c) are significantly different at P < 0.05.

Because serum FSH and LH levels were not different in Gpr149−/− and Gpr149+/− mice, yet these animals showed an increased ovulatory response to exogenous gonadotropins relative to WT littermates, we examined whether an altered expression of FSH receptor (Fshr) and LH receptor (Lhcgr) in granulosa cells might account for the enhanced ovulation. As shown in Fig. 7, in Gpr149 null granulosa cells, Fshr was significantly increased relative to WT granulosa cells, and there was a trend toward increased Lhcgr. Cyclin D2 (Ccnd2), a downstream target of FSH receptor signaling pathways that promotes granulosa cell proliferation (32), was also significantly up-regulated.

Figure 7.

Figure 7

Open in a new tab

Gene expression changes in granulosa cells and oocytes from immature WT and Gpr149−/− mice. Real-time PCR analysis of mRNA from 3-wk-old WT and Gpr149−/− mice. Granulosa cells were collected from the ovaries of individual WT and Gpr149−/− PMSG-stimulated mice (n ≥ 6 mice of each genotype) and GV stage oocytes were pooled from three to four mice of each genotype (n = 3 independent WT pools, and n = 4 independent Gpr149−/−pools). The relative quantity (RQ) of Fshr and Ccnd2 in granulosa cells and Gdf9 in oocytes was significantly increased, and there was a trend toward increased Lhcgr in granulosa cells. *, P < 0.05; **, P < 0.01 Student’s t test.

GDF9 and bone morphogenetic protein 15 (BMP-15) are oocyte-secreted factors that have been implicated in the regulation of Fshr levels in rat granulosa cell and preantral follicle culture systems. In particular, BMP15 appears to decrease Fshr (33), whereas GDF9 increases Fshr expression (34). To determine whether expression of BMP15 and GDF9 was affected in Gpr149 null mice, we obtained GV stage oocytes from PMSG-primed WT and Gpr149−/− mice. Compared with WT oocytes, the relative levels of Bmp15 were not changed in Gpr149−/− oocytes (data not shown); however, Gdf9 was significantly increased (Fig. 7).

The culture of COCs in the presence of serum and FSH stimulates cumulus expansion in vitro (35). To determine whether the increase in oocyte-expressed Gdf9 and granulosa cell-expressed Fshr might lead to more robust cumulus expansion, intact, unexpanded COCs were collected from large antral follicles of WT and Gpr149−/− females 44–46 h after administration of PMSG. Although the degree of cumulus expansion did not appear to differ at the time points examined (supplemental Fig. S1), the number of intact COCs recovered from large antral follicles of Gpr149−/− ovaries was slightly higher than the number obtained from control ovaries (21.7 ± 3.2, control; 30.3 ± 1.7, Gpr149−/−; P < 0.05).

Discussion

In silico screening techniques can be powerful tools for identifying conserved, oocyte-specific or enriched candidate genes to study further in vivo. We previously used these strategies to identify genes with critical functions in oogenesis including Nobox and Sohlh1 (36,37). In a similar manner, we used various databases to identify mouse Gpr149 as an oocyte-enriched transcript. By RT-PCR, we found that Gpr149 was indeed oocyte-enriched and that its expression increased with follicular development and decreased after fertilization, thus confirming much of the publicly available microarray data. Validating the efficacy of our database mining strategy, we also identified an additional orphan GPCR, Gpr3, which is essential for maintaining meiotic arrest (7,8). Based on this expression pattern and the fact that predicted GPR149 proteins across multiple vertebrate species share interesting amino acid sequence features that are generally not found in other GPCRs, we used a reverse genetics approach to determine the potential importance of GPR149 in oocyte physiology. Thus, the in silico strategy is both important and efficient as an initial screen of genes in a particular family that may be important in germ cell biology.

Although potentially critical functions for GPCRs in oocyte development are highlighted by the premature resumption of meiosis in Gpr3 null mice (7,8), the large size of this receptor family and the fact that many different receptors activate a limited number of G proteins to influence downstream signaling pathways suggests there may be receptors with redundant functions. For example, GPR3 is closely related to two additional GPCRs, GPR6 and GPR12, all of which have been shown to exhibit constitutive activation of Gs proteins leading to increased cAMP (6,38,39,40). Gpr12 null mice, however, do not display a leaky meiotic arrest, suggesting that GPR12 by itself is not required to maintain meiotic arrest or that GPR3 is sufficient to compensate for loss of GPR12 (6). The converse is not true because GPR12 activity does not appear sufficient to maintain meiotic arrest in Gpr3 null mice. We did not, however, identify any GPCR homologs that appear to share identity with GPR149, suggesting a related GPCR is not likely to compensate in Gpr149 null mice. Alternatively, because some GPCRs are capable of modulating the function of other receptors through heterodimerization (41,42), GPR149 could potentially dimerize with one of the many other GPCRs present in the oocyte (6) to regulate its activity or localization. In the absence of GPR149, the function of its candidate interacting partner could be altered, contributing to the phenotype we observed.

In our study, we showed that absence of GPR149 results in enhanced fertility and ovulation. Although we cannot exclude the possibility that global deletion of Gpr149 disrupts a neuroendocrine or other regulatory pathway that might influence fertility, the HPG axis appears to be intact, as determined by serum gonadotropins. The increase in Gdf9 in Gpr149−/− oocytes, and in Fshr and FSH target gene, Ccnd2, in the surrounding granulosa cells suggest an intraovarian regulatory loop is altered in Gpr149−/− mice. GDF9 has been shown to up-regulate Fshr and attenuate apoptosis in a rat in vitro culture system (34). Although not significant, there was also a trend toward elevated Lhcgr in granulosa cells, which prepares the follicles for the LH-triggered ovulation (10). An enhanced response to pituitary gonadotropins may allow more developing preantral and antral follicles to escape atresia, thereby contributing to the increase in litter size and ovulatory response in Gpr149−/− mice, without depleting the reserve of primordial follicles. Such a mechanism would account for the continued presence of growing follicles in older Gpr149−/− ovaries and our observation that 14- to 15-month-old Gpr149−/− females continue to have litters of six or more pups on a regular basis. It is possible, however, that a neural network, other than the HPG axis could be altered in Gpr149−/− mice. For example, Gpr149 has also been detected in the ventral medial hypothalamus (14), an estrogen-responsive area known to play a role in lordosis behavior (43).

It is also possible that under normal conditions, GPR149 may have only a minor role in oocyte physiology. In the context of environmental stresses, such as food deprivation or extremes of temperature, the increase in ovulation that we observed in Gpr149 null mice would be disadvantageous. Dietary restriction in mice leads to cessation of estrous cycles and an increase in follicular reserves (44). In this case, GPR149 could have both an ovarian and neuroendocrine function in preventing ovulation and exhaustion of the ovarian reserve until a return to conditions more favorable for reproductive success.

As has been observed for BMP15, there might be species-specific differences regarding the importance of GPR149 in folliculogenesis and/or oocyte physiology. Bmp15 null mice have subtle defects in fertility with a slight decrease in ovulation and successful fertilization rates (45). Polymorphisms in sheep BMP15 that cause nonsense or missense mutations in the BMP15 protein, however, lead to increased ovulation in heterozygous carriers but sterility in homozygous carriers (46,47). Although both heterozygous and homozygous Gpr149 mutant mice exhibited an increased ovulatory response to exogenous gonadotropins relative to WT littermates, it is possible that mutations of GPR149 in monovulatory species, such as ruminants and humans, that alter the levels or activity of GPR149 protein might have a more dramatic effect from what we have observed in mice. Furthermore, support for species-specific differences for GPCR function in oocytes is seen with GPR3 and GPR12. Gpr12 but not Gpr3 is detected in rat oocytes, and knockdown of Gpr12 but not Gpr3 causes meiotic maturation; however, as mentioned, Gpr12−/− mice do not have defects in meiotic maturation (6).

Although we focused our studies on the reproductive findings in Gpr149−/− mice, we detected Gpr149 in tissues outside the ovary, most notably the brain and the digestive tract. In the chicken embryonic digestive tract, Gpr149 was predominantly localized to the enteric neurons of the gut wall (13), and in the mouse, Gpr149 is reportedly enriched in the ventral medial hypothalamus (14). More detailed localization and functional studies in the brain and digestive tract may provide insight into additional neuroendocrine and/or physiological functions for GPR149 outside reproduction. For example, in addition to its oocyte-enriched expression pattern and critical function in meiotic arrest, Gpr3 is abundant in the brain. Detailed behavioral and neurochemical studies in Gpr3−/− mice have uncovered a critical role for GPR3 in coping mechanisms when faced with stressful conditions (48). Thus, the changes in estrous cyclicity in Gpr149−/− females could possibly be attributed to intraovarian or neuroendocrine alterations (or both). Conditional deletion of Gpr149 in oocytes or specific neuronal compartments would help clarify a tissue-specific role for GPR149 in regulating estrous cycles.

Thus, whereas the enhanced fertility phenotype that we observed in Gpr149 null mice was not anticipated, it may still be a candidate gene to evaluate in humans and other species with increases in multigestation births. Moreover, because we observed an increase in ovulation and fertility in Gpr149 null mice that suggests GPR149 might somehow function as a brake on ovulation or recruitment of the cohort of developing follicles that survives to the preovulatory stage, it would be interesting to determine whether overexpression of Gpr149 would have the opposite effect. These studies may be extremely important for more precise modulation of fertility in women who are being treated for fertility issues in the assisted reproductive technology clinic.

Supplementary Material

[Supplemental Data]
en.2009-0760_index.html (714B, html)

Acknowledgments

We thank Ankur Nagaraja for collection of the multitissue RNA library; Qinglei Li for help with the cumulus expansion studies; Pumin Zhang and JoAnne Richards for reagents; Roopa Nalam for assistance with figure formatting; and Claudia Andreu-Vieyra, Michelle Myers, and Roopa Nalam for insightful discussions.

Footnotes

This work was supported by National Institutes of Health Grants HD33438 (to M.M.M), T32GM07730, and T32HD007165, and a scholarship from Baylor Research Advocates for Student Scientists (to M.A.E.).

Present address for Y.-N.L.: Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan, Republic of China.

Disclosure Summary: The authors have nothing to disclose.

First Published Online November 3, 2009

Abbreviations: BMP-15, Bone morphogenetic protein 15; COC, cumulus-oocyte complex; endoGPCR, GPCR that responds to endogenous signals; ES, embryonic stem; EST, expressed sequence tag; GDF9, growth differentiation factor 9; GEO, Gene Expression Omnibus; GPCR, G protein-coupled receptor; GV, germinal vesicle; hCG, human chorionic gonadotropin; HPG, hypothalamic-pituitary-gonadal; P, postnatal day; PMSG, pregnant mare serum gonadotropin; RACE, rapid amplification of cDNA 5′ ends; SNP, single-nucleotide polymorphism; WT, wild type.

References

  1. Lagerström MC, Schiöth HB 2008 Structural diversity of G protein-coupled receptors and significance for drug discovery. Nat Rev Drug Discov 7:339–357 [DOI] [PubMed] [Google Scholar]
  2. Vassilatis DK, Hohmann JG, Zeng H, Li F, Ranchalis JE, Mortrud MT, Brown A, Rodriguez SS, Weller JR, Wright AC, Bergmann JE, Gaitanaris GA 2003 The G protein-coupled receptor repertoires of human and mouse. Proc Natl Acad Sci USA 100:4903–4908 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Kolakowski Jr LF 1994 GCRDb: a G-protein-coupled receptor database. Receptors Channels 2:1–7 [PubMed] [Google Scholar]
  4. Fredriksson R, Lagerström MC, Lundin LG, Schiöth HB 2003 The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol Pharmacol 63:1256–1272 [DOI] [PubMed] [Google Scholar]
  5. Harmar AJ, Hills RA, Rosser EM, Jones M, Buneman OP, Dunbar DR, Greenhill SD, Hale VA, Sharman JL, Bonner TI, Catterall WA, Davenport AP, Delagrange P, Dollery CT, Foord SM, Gutman GA, Laudet V, Neubig RR, Ohlstein EH, Olsen RW, Peters J, Pin JP, Ruffolo RR, Searls DB, Wright MW, Spedding M 2009 IUPHAR-DB: the IUPHAR database of G protein-coupled receptors and ion channels. Nucleic Acids Res 37:D680–D685 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Hinckley M, Vaccari S, Horner K, Chen R, Conti M 2005 The G-protein-coupled receptors GPR3 and GPR12 are involved in cAMP signaling and maintenance of meiotic arrest in rodent oocytes. Dev Biol 287:249–261 [DOI] [PubMed] [Google Scholar]
  7. Ledent C, Demeestere I, Blum D, Petermans J, Hämäläinen T, Smits G, Vassart G 2005 Premature ovarian aging in mice deficient for Gpr3. Proc Natl Acad Sci USA 102:8922–8926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Mehlmann LM, Saeki Y, Tanaka S, Brennan TJ, Evsikov AV, Pendola FL, Knowles BB, Eppig JJ, Jaffe LA 2004 The Gs-linked receptor GPR3 maintains meiotic arrest in mammalian oocytes. Science 306:1947–1950 [DOI] [PubMed] [Google Scholar]
  9. Matzuk MM, Burns KH, Viveiros MM, Eppig JJ 2002 Intercellular communication in the mammalian ovary: oocytes carry the conversation. Science 296:2178–2180 [DOI] [PubMed] [Google Scholar]
  10. Edson MA, Nagaraja, AK, Matzuk MM, 2009 The mammalian ovary from genesis to revelation. Endocr Rev 30:624–712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Mehlmann LM, Jones TL, Jaffe LA 2002 Meiotic arrest in the mouse follicle maintained by a Gs protein in the oocyte. Science 297:1343–1345 [DOI] [PubMed] [Google Scholar]
  12. Freudzon L, Norris RP, Hand AR, Tanaka S, Saeki Y, Jones TL, Rasenick MM, Berlot CH, Mehlmann LM, Jaffe LA 2005 Regulation of meiotic prophase arrest in mouse oocytes by GPR3, a constitutive activator of the Gs G protein. J Cell Biol 171:255–265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Friedel RH, Stubbusch J, Barde YA, Schnürch H 2001 A novel 7-transmembrane receptor expressed in nerve growth factor-dependent sensory neurons. Mol Cell Neurosci 17:31–40 [DOI] [PubMed] [Google Scholar]
  14. Kurrasch DM, Cheung CC, Lee FY, Tran PV, Hata K, Ingraham HA 2007 The neonatal ventromedial hypothalamus transcriptome reveals novel markers with spatially distinct patterning. J Neurosci 27:13624–13634 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. De Smet C, Nishimori H, Furnari FB, Bögler O, Huang HJ, Cavenee WK 2002 A novel seven transmembrane receptor induced during the early steps of astrocyte differentiation identified by differential expression. J Neurochem 81:575–588 [DOI] [PubMed] [Google Scholar]
  16. Rovati GE, Capra V, Neubig RR 2007 The highly conserved DRY motif of class A G protein-coupled receptors: beyond the ground state. Mol Pharmacol 71:959–964 [DOI] [PubMed] [Google Scholar]
  17. Andreu-Vieyra C, Lin YN, Matzuk MM 2006 Mining the oocyte transcriptome. Trends Endocrinol Metab 17:136–143 [DOI] [PubMed] [Google Scholar]
  18. Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, Zhang J, Soden R, Hayakawa M, Kreiman G, Cooke MP, Walker JR, Hogenesch JB 2004 A gene atlas of the mouse and human protein-encoding transcriptomes. Proc Natl Acad Sci USA 101:6062–6067 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Roy A, Lin YN, Agno JE, DeMayo FJ, Matzuk MM 2007 Absence of tektin 4 causes asthenozoospermia and subfertility in male mice. FASEB J 21:1013–1025 [DOI] [PubMed] [Google Scholar]
  20. Nagaraja AK, Andreu-Vieyra C, Franco HL, Ma L, Chen R, Han DY, Zhu H, Agno JE, Gunaratne PH, DeMayo FJ, Matzuk MM 2008 Deletion of Dicer in somatic cells of the female reproductive tract causes sterility. Mol Endocrinol 22:2336–2352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu P, Jenkins NA, Copeland NG 2003 A highly efficient recombineering-based method for generating conditional knockout mutations. Genome Res 13:476–484 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Adams DJ, Quail MA, Cox T, van der Weyden L, Gorick BD, Su Q, Chan WI, Davies R, Bonfield JK, Law F, Humphray S, Plumb B, Liu P, Rogers J, Bradley A 2005 A genome-wide, end-sequenced 129Sv BAC library resource for targeting vector construction. Genomics 86:753–758 [DOI] [PubMed] [Google Scholar]
  23. Lakso M, Pichel JG, Gorman JR, Sauer B, Okamoto Y, Lee E, Alt FW, Westphal H 1996 Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc Natl Acad Sci USA 93:5860–5865 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Goldman JM, Murr AS, Cooper RL 2007 The rodent estrous cycle: characterization of vaginal cytology and its utility in toxicological studies. Birth Defects Res B Dev Reprod Toxicol 80:84–97 [DOI] [PubMed] [Google Scholar]
  25. Cheng G, Weihua Z, Mäkinen S, Mäkelä S, Saji S, Warner M, Gustafsson JA, Hovatta O 2002 A role for the androgen receptor in follicular atresia of estrogen receptor β knockout mouse ovary. Biol Reprod 66:77–84 [DOI] [PubMed] [Google Scholar]
  26. Pangas SA, Li X, Robertson EJ, Matzuk MM 2006 Premature luteinization and cumulus cell defects in ovarian-specific Smad4 knockout mice. Mol Endocrinol 20:1406–1422 [DOI] [PubMed] [Google Scholar]
  27. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2[-ΔΔC(T)] method. Methods 25:402–408 [DOI] [PubMed] [Google Scholar]
  28. Pan H, O'brien MJ, Wigglesworth K, Eppig JJ, Schultz RM 2005 Transcript profiling during mouse oocyte development and the effect of gonadotropin priming and development in vitro. Dev Biol 286:493–506 [DOI] [PubMed] [Google Scholar]
  29. Zeng F, Baldwin DA, Schultz RM 2004 Transcript profiling during preimplantation mouse development. Dev Biol 272:483–496 [DOI] [PubMed] [Google Scholar]
  30. Letunic I, Doerks T, Bork P 2009 SMART 6: recent updates and new developments. Nucleic Acids Res 37:D229–D232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nelson JF, Felicio LS, Randall PK, Sims C, Finch CE 1982 A longitudinal study of estrous cyclicity in aging C57BL/6J mice: I. Cycle frequency, length and vaginal cytology. Biol Reprod 27:327–339 [DOI] [PubMed] [Google Scholar]
  32. Sicinski P, Donaher JL, Geng Y, Parker SB, Gardner H, Park MY, Robker RL, Richards JS, McGinnis LK, Biggers JD, Eppig JJ, Bronson RT, Elledge SJ, Weinberg RA 1996 Cyclin D2 is an FSH-responsive gene involved in gonadal cell proliferation and oncogenesis. Nature 384:470–474 [DOI] [PubMed] [Google Scholar]
  33. Otsuka F, Yamamoto S, Erickson GF, Shimasaki S 2001 Bone morphogenetic protein-15 inhibits follicle-stimulating hormone (FSH) action by suppressing FSH receptor expression. J Biol Chem 276:11387–11392 [DOI] [PubMed] [Google Scholar]
  34. Orisaka M, Orisaka S, Jiang JY, Craig J, Wang Y, Kotsuji F, Tsang BK 2006 Growth differentiation factor 9 is antiapoptotic during follicular development from preantral to early antral stage. Mol Endocrinol 20:2456–2468 [DOI] [PubMed] [Google Scholar]
  35. Buccione R, Vanderhyden BC, Caron PJ, Eppig JJ 1990 FSH-induced expansion of the mouse cumulus oophorus in vitro is dependent upon a specific factor(s) secreted by the oocyte. Dev Biol 138:16–25 [DOI] [PubMed] [Google Scholar]
  36. Pangas SA, Choi Y, Ballow DJ, Zhao Y, Westphal H, Matzuk MM, Rajkovic A 2006 Oogenesis requires germ cell-specific transcriptional regulators Sohlh1 and Lhx8. Proc Natl Acad Sci USA 103:8090–8095 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rajkovic A, Pangas SA, Ballow D, Suzumori N, Matzuk MM 2004 NOBOX deficiency disrupts early folliculogenesis and oocyte-specific gene expression. Science 305:1157–1159 [DOI] [PubMed] [Google Scholar]
  38. Eggerickx D, Denef JF, Labbe O, Hayashi Y, Refetoff S, Vassart G, Parmentier M, Libert F 1995 Molecular cloning of an orphan G-protein-coupled receptor that constitutively activates adenylate cyclase. Biochem J 309(Pt 3):837–843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Tanaka S, Ishii K, Kasai K, Yoon SO, Saeki Y 2007 Neural expression of G protein-coupled receptors GPR3, GPR6, and GPR12 up-regulates cyclic AMP levels and promotes neurite outgrowth. J Biol Chem 282:10506–10515 [DOI] [PubMed] [Google Scholar]
  40. Uhlenbrock K, Gassenhuber H, Kostenis E 2002 Sphingosine 1-phosphate is a ligand of the human gpr3, gpr6 and gpr12 family of constitutively active G protein-coupled receptors. Cell Signal 14:941–953 [DOI] [PubMed] [Google Scholar]
  41. Levoye A, Dam J, Ayoub MA, Guillaume JL, Jockers R 2006 Do orphan G-protein-coupled receptors have ligand-independent functions? New insights from receptor heterodimers. EMBO Rep 7:1094–1098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Milligan G, Smith NJ 2007 Allosteric modulation of heterodimeric G-protein-coupled receptors. Trends Pharmacol Sci 28:615–620 [DOI] [PubMed] [Google Scholar]
  43. Pfaff DW, Kow LM, Loose MD, Flanagan-Cato LM 2008 Reverse engineering the lordosis behavior circuit. Horm Behav 54:347–354 [DOI] [PubMed] [Google Scholar]
  44. Nelson JF, Gosden RG, Felicio LS 1985 Effect of dietary restriction on estrous cyclicity and follicular reserves in aging C57BL/6J mice. Biol Reprod 32:515–522 [DOI] [PubMed] [Google Scholar]
  45. Yan C, Wang P, DeMayo J, DeMayo FJ, Elvin JA, Carino C, Prasad SV, Skinner SS, Dunbar BS, Dube JL, Celeste AJ, Matzuk MM 2001 Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol Endocrinol 15:854–866 [DOI] [PubMed] [Google Scholar]
  46. Hanrahan JP, Gregan SM, Mulsant P, Mullen M, Davis GH, Powell R, Galloway SM 2004 Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biol Reprod 70:900–909 [DOI] [PubMed] [Google Scholar]
  47. McNatty KP, Smith P, Moore LG, Reader K, Lun S, Hanrahan JP, Groome NP, Laitinen M, Ritvos O, Juengel JL 2005 Oocyte-expressed genes affecting ovulation rate. Mol Cell Endocrinol 234:57–66 [DOI] [PubMed] [Google Scholar]
  48. Valverde O, Célérier E, Baranyi M, Vanderhaeghen P, Maldonado R, Sperlagh B, Vassart G, Ledent C 2009 GPR3 receptor, a novel actor in the emotional-like responses. PloS One 4:e4704 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental Data]
en.2009-0760_index.html (714B, html)
en.2009-0760_1.pdf (1MB, pdf)

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES