Skip to main content
Annals of Botany logoLink to Annals of Botany
. 2006 Nov;98(5):965–974. doi: 10.1093/aob/mcl189

Expression Profiling of the 14-3-3 Gene Family in Response to Salt Stress and Potassium and Iron Deficiencies in Young Tomato (Solanum lycopersicum) Roots: Analysis by Real-time RT–PCR

WEI FENG XU 1,2, WEI MING SHI 1,*
PMCID: PMC2803592  PMID: 16943217

Abstract

• Background and Aims Mineral nutrient deficiencies and salinity constitute major limitations for crop plant growth on agricultural soils. 14-3-3 proteins are phosphoserine-binding proteins that regulate the activities of a wide array of targets via direct protein–protein interactions and may play an important role in responses to mineral nutrients deficiencies and salt stress. In the present study, the expression profiling of the 14-3-3 gene family in response to salt stress and potassium and iron deficiencies in young tomato (Solanum lycopersicum) roots was investigated in order to analyse the 14-3-3 roles of the proteins in these abiotic stresses.

• Methods Sequence identities and phylogenetic tree creation were performed using DNAMAN version 4.0 (Lynnon Biosoft Company). Real-time RT–PCR was used to examine the expression of each 14-3-3 gene in response to salt stress and potassium and iron deficiencies in young tomato roots.

• Key Results The phylogenetic tree shows that the 14-3-3 gene family falls into two major groups in tomato plants. By using real-time RT–PCR, it was found that (a) under normal growth conditions, there were significant differences in the mRNA levels of 14-3-3 gene family members in young tomato roots and (b) 14-3-3 proteins exhibited diverse patterns of gene expression in response to salt stress and potassium and iron deficiencies in tomato roots.

• Conclusions The results suggest that (a) 14-3-3 proteins may be involved in the salt stress and potassium and iron deficiency signalling pathways in young tomato roots, (b) the expression pattern of 14-3-3 gene family members in tomato roots is not strictly related to the position of the corresponding proteins within a phylogenetic tree, (c) gene-specific expression patterns indicate that isoform-specificity may exist in the 14-3-3 gene family of tomato roots, and (d) 14-3-3 proteins (TFT7) might mediate cross-talk between the salt stress and potassium and iron-deficiency signalling pathways in tomato roots.

Keywords: Solanum lycopersicum, real-time RT–PCR, expression, gene family, 14-3-3, salt stress and potassium deficiency, iron deficiency

INTRODUCTION

Mineral nutrient deficiencies and salinity constitute major limitations for crop plant growth on agricultural soils around the world (Maathuis et al., 2003; Tester and Davenport, 2003). Among the essential mineral nutrients, potassium is the macronutrient (along with nitrogen and phosphorus) that requires the greatest agricultural investment with regard to fertilizer inputs, and iron is the micronutrient that is most limiting to agricultural production worldwide (Kochian, 2000). Plant growth depends on mineral nutrients absorbed from the soil by roots. Problems arise in saline soils, since high concentrations of sodium disrupt potassium, iron and other mineral nutrition, create hyperosmotic stress, and cause secondary problems such as oxidative stress (Zhu, 2001). Roots are the primary organs involved in mineral acquisition and salt tolerance for higher plants and function at the interface with the rhizosphere, the zone of soil immediately surrounding plant roots that is modified by root activity. In this critical zone, plants roots perceive and respond to their environment. To survive, plants have developed some flexible strategies to cope with fluctuation in their environment and thus to minimize the adverse effects of mineral nutrient deficiencies and salt stress. These include signalling systems particularly adapted to mineral nutrient deficiencies and salinity. Research in this area over the past decades has led to the identification of structural genes of primary importance for salt tolerance, mineral nutrition acquisition and utilization, including ion transporters and enzymes involved in ion assimilation. From this work it has become apparent that salt tolerance, mineral nutrient acquisition and utilization are a highly regulated and complex set of processes relying not only on ion transporters and enzymes involved in ion assimilation, but also on powerful regulatory mechanisms controlling the abundance and activity of transporters and enzymes (Wang et al., 2002; Vert et al., 2003; Zhu, 2003).

14-3-3 proteins (a family of regulatory proteins) are phosphoserine-binding proteins that regulate the activities of a wide array of targets via direct protein–protein interactions (Bridges and Moorhead, 2004). Plant 14-3-3 proteins bind a range of transcription factors and other signalling proteins, and have roles in regulating plant development and stress response (Chung et al., 1999; Roberts, 2003). Some recent studies suggest that, in higher plants, 14-3-3 proteins may play an important role in responses to mineral nutrient deficiencies, ion transport and salt stress. The activities of ion transporters are modulated by signalling proteins in response to environmental factors. Signalling proteins known to interact with ion transporters include protein kinases, phosphatases and 14-3-3 proteins. Apart from their well-established roles in regulating the activity of plasma membrane H+-ATPase that play a major role in abiotic stress (Sanders and Bethke, 2000; Shen et al., 2005), 14-3-3 proteins are also regulatory partners of plant K+ channels (Véry and Sentenac, 2003). What is more, in higher plants, 14-3-3 proteins also interact with APX and ABA, which play important roles in salt stress responses (Zhang et al., 1997; Finkelstein et al., 2002; Wijngaard et al., 2005). Additional evidence for the involvement of 14-3-3 proteins in salt and ion stress responses comes from the regulation of 14-3-3 gene expression by potassium and iron deficiencies in tomato roots and the association of 14-3-3 proteins with the G-box promoter element of a salt-induced gene in tobacco (Chen et al., 1994; Wang et al., 2002).

In China, tomato (Solanum lycopersicum) is a widely distributed annual vegetable crop providing an important dietary contribution to human health and nutrition. In recent years, tomato has been targeted for genome sequencing by an international consortium currently funded and supported by ten contributing countries (Fei et al., 2006). Hence, tomato is becoming a model plant for studying physiology, biochemistry and molecular biology mechanisms of the vegetables. In tomato plants, 14-3-3 proteins are encoded by a multigene family. So far, at least 12 genes named TFT1–TFT12, predicted to encode 14-3-3 proteins, have been identified in tomato (see http://www.lancs.ac.uk/staff/robertmr/tft_ests.htm). By using northern blot analysis, the expression of the 14-3-3 gene family in response to fusicoccin stress has been examined in tomato leaves, and results suggested that 14-3-3 genes showed different expression patterns in leaves after challenges (Roberts and Bowles, 1999). In addition, expression of TFT7 (X95905), one of the 14-3-3 gene family members, was induced by nitrate resupply, and potassium and iron deficiencies in tomato roots (Wang et al., 2001, 2002). Although the gene expression of 14-3-3 proteins under biotic and abiotic stress has been investigated (Roberts et al., 2002), expression profiling of the 14-3-3 gene family in response to salt stress and potassium and iron deficiencies in young tomato root has not been studied.

Gene expression levels were commonly determined using northern blot analysis. In recent years, real-time RT–PCR has become the method of choice to measure accurately transcript abundance of selected genes (Gachon et al., 2004). Firstly, the analysis of more than ten genes by northern blotting is fairly tedious and repetitive. Secondly, genes expressed at a very low level remain difficult to detect by northern blotting. Thirdly, closely related genes that are very similar at the sequence level may cross-hybridize during northern blot procedures and, therefore, it may be difficult to determine the RNA level of a specific member of a gene family. These problems are resolved by the high specificity of real-time RT–PCR guaranteed by the use of at least two specific primers. Thus, in the present study, real-time RT–PCR was used to study the expression profile of the entire 14-3-3 gene family members in response to salt stress and potassium and iron deficiencies in young tomato roots.

MATERIALS AND METHODS

Plant material, growth conditions and stress treatment

Tomato (Solanum lycopersicum L. ‘Hezuo906’) plants were grown hydroponically in black pots containing 3 L of modified one-fifth Hoagland's solution (control), which consists of the following macronutrients: KNO3, 1·0 mm; Ca (NO3)2, 1·0 mm; KH2PO4, 0·2 mm; and MgSO4, 0·3 mm; and the following micronutrients: H3BO3, 13·3 μm; MnCl2, 3·0 μm; CuSO4, 0·5 μm; ZnSO4, 1·0 μm; Na2MoO4, 0·1 μm; NaCl, 2 μm; CoCl2, 0·01 μm; and NiSO4, 0·1 μm. The solutions were supplemented with 20 μm Fe-EDDHA. Six plants were grown in each pot in a controlled environmental growth chamber in the light with 250 μmol m−2 s–1 photosynthetic photon flux at 25 °C, 70 % relative humidity for 16 h (from 0600 to 2200 h); in the dark at 21 °C and 70 % relative humidity for 8 h (from 2200 to 0600 h). The nutrient solution was changed twice weekly and aerated.

After 2 weeks of growth, potassium was withheld from the nutrient solution by replacing the 1·0 mm KNO3 and 0·2 mm KH2PO4 with 1·0 mm NaNO3 and 0·2 mm NaH2PO4. For iron deficiency solution, the 20 μm Fe-EDDHA was simply left out of the nutrient solution. A salt treatment was imposed by the addition of NaCl to the nutrient solution to a final concentration of 100 mm. The six plants in a single pot were harvested at 0, 3, 6, 12, 24 and 48 h after the plants were exposed to these treatments. Control plants grown under nutrient-sufficient conditions were harvested at the same 0-, 3-, 6-, 12-, 24- and 48-h time points, and roots were harvested for RNA extraction in an identical fashion to the nutrient-deprived and salt stress plants. To minimize the effect due to light/dark exposure and/or circadian-regulated responses, these treatments were initiated at 0900 h, which was 3 h into the light period. In addition, all plant tissues for the other time points were harvested during periods of light exposure. Roots were then separated, frozen and stored in −80 °C until RNA isolation.

DNA and protein sequence database analysis

Database searches were performed at the National Center of Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov) and The Institute for Genomic Research (TIGR, http://www.tigr.org). Sequence identity and phylogenetic trees were performed using DNAMAN version 4.0 (Lynnon Biosoft Company).

RNA extraction and cDNA preparation

Total RNA was extracted from young tomato roots using TRIZOL® Reagent (Invitrogen) according to the manufacturer's protocol and then checked for absence of DNA contamination using PCR. Quality of total RNA was tested by agarose–formaldehyde gel electrophoresis using standard protocols. Only RNA without DNA contamination and detectable degradation of 26S rRNA was used for subsequent preparation of cDNA synthesis. Five micrograms of total RNA was used to synthesize cDNA by reverse transcriptase powerscript™ (BD Bioscience Clontech) following the manufacturer's protocol. The cDNA samples were used as a template to quantify target gene expression level.

Primer design, PCR product identity, cloning and sequencing

Gene sequences are available in GenBank or TIGR (see Table 1 for details), and primer pairs for real-time RT–PCR were designed using Primer 5 software (Table 2). Gene-specific primers were chosen so that the resulting PCR product had approximately the size of 200–300 bp. The quantity of PCR product was measured using a spectrophotometer, and its quality was checked by agarose gel electrophoresis, taking the generation of only one single band of the expected size as a criterion for specificity. Amplified fragments of each gene were cloned into the pMD18-T Vector (TaKaRa, Japan). The recombinant plasmids including the size of the inserted PCR product were identified by restriction mapping using enzymes with recognition sequences within the multiple cloning site of the vector and the cDNA-cloned inserts were sequenced for confirmation of specific amplification. In addition, the plasmids were diluted several times to generate templates from 109 to 103 copies, and used for standard curves for the estimation of copy number in each cDNA studied. For monitoring the degree of potential template degradation during the preparation of cDNA and the expression of undetectable genes in tomato roots, two different primer pairs spanning proximal and distal parts of mRNA with respect to the translation stop-codon of these genes were used (see Table 2 for details). Intact mRNA, converted to full-length cDNA, resulted in the amplifications of PCR products with identical numbers of the threshold cycles (measured by real-rime RT–PCR), irrespective of the use of ‘distal’ or ‘proximal’ primer pairs (Panchuk et al., 2002). If two different primers pair for the same gene cannot amplify some fragments from the cDNA of tomato roots, the gene expression was not detectable.

Table 1.

Tomato 14-3-3 gene code and protein sequences identity within the 14-3-3 gene family of tomato

TFT1 X95900 99369 100
TFT2 X95901 98834 77·7 100 100 100 100 100 100 100 100 100 100 100
TFT3 X95902 98836 74·9 91·7 85·2 84·6 93·7 67·9 74·2 86·2 63·6 76·1 69·1
TFT4 AJ504807 98629 73·1 84·2 86·7 84·0 68·3 63·5 79·9 59·8 70·4 66·9
TFT5 X95903 98835 73·8 86·6 87·9 67·3 63·2 71·3 66·7 61·7 77·6
TFT6 X95904 98837 74·7 88·2 68·3 62·3 69·7 75·0 68·5 72·0
TFT7 X95905 99225 64·9 67·6 63·7 70·1 74·5 85·5 79·8
TFT8 X98864 102006 62·3 64·3 69·9 75·4 85·4 69·8
TFT9 X98865 99262 61·2 71·5 74·8 91·9 69·6
TFT10 X98866 99498 83·5 77·2 85·4 68·5
TFT11 – 98628 72·0 84·5 69·9
TFT12 – 99263 66·4 71·8

Table 2.

Genes and gene-specific primers used for real-time RT–PCR experiments

Gene Code Primer (5′ to 3′) Amplicon size and position to stop-codon (α-tubulin)
α-Tubulin TC115716 [F]:TGAACAACTCATAAGTGGCAAAG 198-bp position (−1087 bp)
LeIRT1 AF246266 [R]:TCCAGCAGAAGTGACCCAAGAC Position (−890 bp)
JWS-21 AW062239 [F]: CCAATCTCAATCGCCTTAT 299-bp position (−680 bp)
TFT1 X95900 [R]: CACCACATCACCACGGAAC Position (−382 bp)
TFT2 X95901 [F]: GCGTTACCCTTAAAAATCATAG 261 bp
TFT3 X95902 [R]: CATTGCCACAAATCCAGTAAAG 263 bp
TFT4 AJ504807 [F]: AGTCCACAACTAAAAGGTGAACATC 307 bp
TFT5 X95903 [R]: CAAGAGTTGCTTTCATTTTCCAGTAC 248 bp
TFT6 X95904 [F]: GAGGGTAGGAAGAACGATGAG 251 bp
TFT7 X95905 [R]: ACCCAAGTCGTATCGGATGTG 262 bp
TFT8 X98864 [F]: AGCCTCGTGGCGTATTATCTC 214 bp
TFT9 X98865 [R]: CAGCTCCGGTCTTAAATTCAG 286 bp
TFT10 X98866 [F]: CCTTGGCTCGGAAGAACTAAC 210 bp
TFT11 TC98628 [R]: CAGATGTTGCTGAAGGAATAAG 266 bp
TFT12 TC99263 [F]: CTGAGCGATACGAGGAAATG 237 bp
[R]: CTCAAAATCCCATCACAAATC 281 bp
[F]: TTGAACGGTGAGGAACTTAC 213 bp
[R]: ACTTGAGGATGCCGTTACAG 276 bp
[F]: TTACGAGGAGATGGTAGAGTTC 238 bp
[R]: AGAGCCAATGAGCTTAGAATC 212 bp
[F]: ACCTCGTTCCTTCGTCCACTAC
[R]: AATTCAATGCGAGTCCAAGTC
[F]: GCGAATCTGGATGTTGAACTG
[R]: ACAGTTGATTCACCAGCAGTAC
[F]: CAATTACCCATCCCATCCG
[R]: GAGCCTCTTCTCCATCCTCTG
[F]: TGAATTGACTGTGGAGGAAAG
[R]: AATAGTCTCCCTTCATCTTGTG
[F]: GCGGAAGAACGAAGAACATG
[R]: TGCTTCCTCTCATCACCAATC
[F]: GGCTCCTACTCACCCAATCAG
[R]: TGTCCATCACCCGACTCTTG
[F]: AAGAGCTTCATGGCGTATT
[R]: GAACTCAGCGAGGTAACGA
[F]: TCATCCGATTCGTCTTGGT
[R]: CAGGCAAATCAGAAGTCCATA

Real-time RT–PCR and quantification of mRNA levels

The real-time RT–PCR was performed in 25 μL of reaction mixture composed of cDNA and master mix [final concentrations: 1 unit of Tag™ polymerase (TaKaRa, Japan), 50 mm KCl, 10 mm Tris, pH 8·3, 3 mm MgCl2, 300 mm each dNTPs (TaKaRa), and 0·5 μm gene-specific primers] using the DNA Engine Opticon 2 system (MJ, USA) for continuous fluorescence detection. Amplification of PCR products were monitored via intercalation of SYBR-Green (1 : 200 000 dilution of 10 000× stock solution). The following program was applied: initial polymerase activation: 94 °C, 5 min, then 35 cycles at 94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min. The specificity of the PCR amplification was checked with a melt curve analysis (from 55 °C to 94 °C) following the final cycle of the PCR. PCR conditions were optimized for high amplification efficiency >95 % for all primer pairs used. Efficiency was determined by comparison of experimentally determined and theoretically expected copy number of the same recombinant plasmids using 109 to 103 copies per reaction.

All experiments were repeated at least twice for cDNA prepared from two batches of plants. Using standardized conditions, deviations of threshold values were <1·0 cycle for independent cDNA preparation and <0·5 cycles for replicates of the same cDNA. Much research had shown that α-tubulin is a strongly and constitutively expressed ‘housekeeping’ gene in tomato roots (Wang et al., 2001, 2002; Coker and Davies, 2003), so the quantification of mRNA levels was based on the comparison with the level of mRNA for α-tubulin. As an additional control, mRNA levels were monitored for two stress-up-regulated genes, LeIRT1 and JWS-21, coding for an iron transporter in tomato root in response to iron and potassium deficiencies (Wang et al., 2002) and a salt-stressed gene in tomato root (Wei et al., 2000), respectively.

The copy number of the gene was determined by using the manufacturer supplied option monitor 2.02 software. In the software, the mass of a single plasmid template containing the target sequence was calculated and this mass was equated to one copy of the target gene sequence. The plasmid template was then quantified and diluted several times to generate templates from 109 to 103 copies. Data were plotted to generate the standard curve. Plotting the values obtained by real-time RT–PCR from any sample against this standard curve yields the approximate copy number of the gene studied in the sample. α-Tubulin mRNA, which was defined as 100 REU (relative expression units), was used as an internal standard in all experiments. The expression level of genes corresponds to the ratio of the copy number of cDNA of the studied gene on the copy number of the ‘housekeeping’ gene α-tubulin multiplied by 100 REU.

Statistical methods

Statistical analysis was conducted using procedures in SigmaPlot2001. Changes in the relative expression levels (REU) of gene mRNA were checked for statistical significance according to Student's t-test. The results were considered statistically significant if the P-value was <0·05 in the Student's t-test.

RESULTS

Tomato 14-3-3 gene family

Twelve protein sequences encoding 14-3-3s searched from the GenBank or TIGR database, named TFT1–TFT12, were analysed in tomato roots (Table 1). The results of protein sequence identity (Table 1) suggest that the percentage of identical protein sequences in the tomato 14-3-3 gene family ranged from 59·8 % to 93·7 %. The highest percentage of similarity was found between the TFT5 and TFT6 proteins (93·7 %), followed by the TFT4 and TFT11 pair (91·9 %). The lowest score was observed between TFT8 and TFT10 proteins (59·8 %) when compared with all the other members of the family. Thus, like Arabidopsis thaliana, the 14-3-3 gene family of tomato is also highly conserved. In addition, the phylogenetic tree (Fig. 1) shows that the tomato 14-3-3 gene family falls into two major groups: the TFT1/TFT10, TFT4/TFT11, TFT2/TFT3 and TFT5/TFT6 forming a major group in the upper part of tree, and the TFT7, TFT8/TFT9, and TFT12 forming a lower group. Furthermore, the phylogenetic tree places TFT1 and TFT10 in one cluster, TFT4 and TFT1 in one cluster, TFT2 and TFT3 in one cluster, TFT5 and TFT6 in one cluster, TFT8 and TFT9 in one cluster and TFT7 and TFT12 on their own. As described above, these results reveal the evolutionary relationship of 14-3-3 proteins in tomato.

Fig. 1.

Fig. 1.

Phylogenetic relationships between protein sequences encoding the 14-3-3 gene family in tomato. Accession numbers for 14-3-3 proteins are listed in Table 1. The dendrogram was produced using DNAMAN version 4.0 (Lynnon Biosoft Company). A neighbour joining (NJ) tree was generated; relative branch length was indicated.

Evaluation of experiment systems for real-time RT–PCR

To avoid bias, real-time RT–PCR is typically referenced to a housekeeping gene as the internal control gene. Ideally, the conditions of the experiment should not influence the expression of this internal control gene. α-Tubulin, the choice of a housekeeping gene in tomato roots for this study, was the internal control gene. In addition, two stress-up-regulated genes, LeIRT1 (an iron transporter) and JWS-21 (a salt-stressed gene), were used as a further control. No significant change was found on LeIRT1 and JWS-21 mRNA levels under control conditions, whereas salt stress and potassium and iron deficiencies caused their up-regulation (Fig. 2). These results agree well with the finding of Wei et al. (2000) and Wang et al. (2002). Thus, it is very clear that the experiment systems and selection of housekeeping gene for real-time RT–PCR are reliable and accurate in the present study.

Fig. 2.

Fig. 2.

mRNA levels for genes coding for LeIRT1 (an iron transporter) and JWS-21 (a salt-stressed gene) in young tomato roots. Tomato plants were grown hydroponically for 2 weeks on one-fifth Hoagland's solution (control) and transferred to 100 mm NaCl stress and potassium and iron deficiency solutions. The tomato roots were harvested at 0, 3, 6, 12, 24 and 48 h after the plants were exposed to these treatments and control. Total RNA were extracted from tomato roots, converted to cDNA and subjected to comparative real-time RT–PCR quantification. Relative expression levels were calculated and normalized with respect to α-tubulin mRNA (=100 REU). Bars show mean ± s.d. (n = 6). The results were considered statistically significant if the P-value was <0·05 in Student's t-test. Note: different scales are used in the graphs.

Real-time RT–PCR analysis of the 14-3-3 gene expression in young tomato roots

Subsequently, by using real-time RT–PCR, the expression patterns of all 12 different 14-3-3 genes were analysed and summarized (Fig. 3 and Table 3). Under normal growth conditions (control) expression of TFT1, TFT5 and TFT10 appeared to be high, TFT4, TFT6 and TFT7 moderate, and TFT2, TFT3, TFT9 and TFT11 very low in young tomato roots. In addition, the expression of TFT8 and TFT12 were not detected in tomato roots by using two different primer pairs.

Fig. 3.

Fig. 3.

mRNA levels for different 14-3-3 genes in young tomato roots. Tomato plants were grown hydroponically for 2 weeks on one-fifth Hoagland's solution (control) and transferred to 100 mm salt stress and potassium and iron deficiency solutions. The tomato roots were harvested at 0, 3, 6, 12, 24 and 48 h after the plants were exposed to these treatments and control. Total RNA was extracted from tomato roots, converted to cDNA and subjected to comparative real-time RT–PCR quantification. Relative expression levels were calculated and normalized with respect to α-tubulin mRNA (=100 REU). In addition, CK, K, Fe and Na stand for control, potassium deficiency, iron deficiency and 100 mm salt stress, respectively. Bars show mean ± s.d. (n = 6). The results were considered statistically significant if the P-value was <0·05 in Student's t-test. Note: different scales are used in the graphs.

Table 3.

Summary of 14-3-3 gene family features

The gene expression in response to

Gene The level of mRNA in untreated roots K deficiency Fe deficiency Salt (100 mm)
TFT1 High → → ↑
TFT2 Low ↑ → →
TFT3 Low ↑ → →
TFT4 Moderate ↑ → ↑
TFT5 High ↑ → →
TFT6 Moderate ↑ → →
TFT7 Moderate ↑ ↑ ↑
TFT8 N.D. N.D. N.D. N.D.
TFT9 Low ↑ → →
TFT10 High ↑ → ↑
TFT11 Low → → →
TFT12 N.D. N.D. N.D. N.D.

The expression of mRNA level exceeding 20 REU is defined as high; the expression of mRNA level from 10 to 20 REU is defined as moderate; the expression of mRNA level <10 is defined as low.

↑ indicates that expression is up-regulated; ↓ indicates that expression is down-regulated; → indicates that expression is not changed; N.D. indicated that expression is not detectable.

Tomato plants were subjected to salinity and potassium and iron deficiencies for a period of time, and the expression levels of 14-3-3 proteins were measured. Potassium deficiency greatly increased the expression of most of the 14-3-3 gene family members except for TFT1 and TFT11. TFT10, a high expression 14-3-3 gene, showed an approx. 2-fold increase of expression by potassium deficiency. Furthermore, the expression level of TFT4 investigated in this study increased nearly up to 3-fold at 2 d after potassium deficiency. On the other hand, under iron deficiency the expression levels of most of the 14-3-3 gene family members were not altered significantly; only TFT7 was up-regulated.

Under salt-stress conditions, steady-state transcript levels of most of the 14-3-3 gene family members appeared relatively unchanged, but significant up-regulation of four genes, TFT1, TFT4, TFT7 and TFT10, was observed repeatedly. Interestingly, these abiotic stresses (salinity and potassium and iron deficiencies) did not significantly decrease the expression of the 14-3-3 gene family members in tomato roots. In this study, only one of the 14-3-3 genes (TFT7) was found to respond to salt stress and potassium and iron deficiencies. TFT7 responded most strongly to iron deficiency, whereas its response to potassium and salt stress was moderate. Table 3 summarizes 14-3-3 gene expression profiling in tomato roots.

DISCUSSION

The 14-3-3 proteins are a family of ubiquitous regulatory molecules which have been found in virtually every eukaryotic organism and tissue. Discovered 34 years ago, 14-3-3 proteins were first studied in mammalian nervous tissues, but in the past decade their indispensable role in higher plants adapted to biotic and abiotic stress has been increasingly established (Roberts et al., 2002). Most higher plant species have more than one 14-3-3 isoform. In Arabidopsis, tobacco and tomato, 13, 11 and 12 isoforms have been found, respectively (see http://www.lancs.ac.uk/staff/robertmr/tft_ests.htm). So far, 14-3-3 proteins are thought to be involved in a large range of abiotic signalling processes and interact with many target molecules, including plasma membrane H+-ATPase, ion channels, APX (ascorbate peroxidase) and ABA (abscisic acid). These are all very important for plants adapted to mineral nutrient deficiencies and salinity (Palmgren, 2001; Yan et al., 2004; Wijngaard et al., 2005). Thus, it is hypothesized that 14-3-3 proteins would also be involved in regulation of the higher plant response to the soil abiotic stresses of high salt, and deficiencies of potassium and iron. In this study, real-time RT–PCR technology with tomato roots was used to investigate the expression profiling of the 14-3-3 gene family in response to the above three stress conditions. The mRNA expression level evidence found indicates that 14-3-3 proteins, particularly TFT7, are involved and would be excellent candidates to modulate plants adapted to salt stress and potassium and iron deficiencies.

14-3-3 proteins may be involved in the salt stress and potassium and iron deficiencies signalling pathways in young tomato roots

Under high-salt conditions, plant growth is severely inhibited due to ionic, osmotic and oxidative stress (Zhu, 2001). It is well known that, in higher plants, the plasma membrane H+-ATPase play an important role in ion homeostasis under salt stress and is activated by binding of 14-3-3 protein to the phosphorylated C terminus (Comparot et al., 2003; Zhu, 2003). Under osmotic stress, a marked increase in the enzyme activity of the plasma membrane H+-ATPase was accompanied by accumulation of 14-3-3 proteins in plasma membrane in maize root (Shanko et al., 2003). What is more, the increased 14-3-3 protein contents were found in the plasma membrane of tomato cells upon osmotic shock (Kerkeb et al., 2002). Many studies show that APX, which interacts with 14-3-3 proteins, also plays a very important role in protecting plants from osmotic and oxidative stress (Yan et al., 2004). Furthermore, overexpression of 14-3-3 proteins in potato improves the total antioxidant potential (Lukaszewicz et al., 2002). Therefore, 14-3-3 proteins may take part in the signalling pathways regulating plants in response to salt stress. However, using real-time RT–PCR, it was found that the most of the 14-3-3 gene family members appeared relatively unchanged under salt-stress conditions. But significant up-regulation of four genes, TFT1, TFT4, TFT7 and TFT10, was observed repeatedly in the young roots (Fig. 3 and Table 3). This evidence suggests that at least some of the 14-3-3 proteins may be involved in the salt signalling pathways in higher plants.

Potassium, the most abundant cation in plant cells, plays essential roles in maintaining the membrane potential, ion homeostasis, enzyme activation, signal transduction, and many other physiological processes (Chérel, 2004). Recently, circumstantial evidence suggests that 14-3-3 proteins are regulatory partners of plant K+ channels and play a role in potassium homeostasis in the plants. For example, overexpression of plant 14-3-3 proteins in tobacco strongly enhanced the mesophyll K+ outward conductance and addition of plant 14-3-3 proteins to the tomato cell cytoplasm in patch-clamp experiments had the same effect (Bunney et al., 2002). However, in the barley embryonic root, 14-3-3 proteins affected both channels (K+in and K+out channels) in an opposite fashion: whereas K+in channel activity was fully dependent upon 14-3-3 proteins, K+out channel activity was reduced by 14-3-3 proteins (Wijngaard et al., 2005). In this study, potassium deficiency treatment greatly increased the expression of most of the 14-3-3 gene family members except for TFT1, TFT11 and TFT10, in the young tomato roots (Fig. 3 and Table 3). As far as TFT7 expression was concerned, the results were in approximate agreement with those of Wang et al. (2002). Therefore, according to these results of gene expression, it is reasonable to assume that 14-3-3 proteins may also be involved in the potassium homeostasis signalling pathways in young tomato roots.

Iron is often unavailable to plants because it tends to form insoluble ferric hydroxide complexes in aerobic environments at neutral or basic pH. Iron deficiency can cause severe yield loss, so researchers have worked for many decades to have a better understanding of how plants mobilize iron from soil (Curie and Briat, 2003). Dicots mobilize soil iron by the combined action of the plasma membrane H+-ATPase and ferric chelate reductase (Schmidt, 2003). Because 14-3-3 proteins play indispensable roles in activation of the plasma membrane H+-ATPase they could also be involved in the iron mobilization. The present results showed that under iron deficiency stress, TFT7, but not the other members of the 14-3-3 family, was up-regulated in the young tomato roots, about a 4-fold increase of gene expression after 12 h treatment (see Fig. 3 for details). Again, this is an indication that this particular 14-3-3 protein plays a role in the iron deficiency signalling pathway of young tomato roots.

Expression profile of 14-3-3 gene family members in young tomato roots is not strictly related to the position of the corresponding proteins within the phylogenetic tree

Knowing the exhaustive expression pattern of a gene family using real-time RT–PCR opens up the additional investigation branch of molecular and functional evolution (Gachon et al., 2004). Recently, several studies have shown that the expression patterns of gene family members are not completely in agreement with the phylogenetic relationships of the gene family (Orsel et al., 2002; Panchuk et al., 2002; Mladek et al., 2003). The present results also showed that the expression profile of 14-3-3 gene family members in response to salt stress and potassium and iron deficiencies in young tomato roots is not strictly related to the position of the corresponding proteins within the phylogenetic tree (Figs 1 and 3 and Table 3). In one case, the pair with the highest percentage of similarity (the TFT5 and TFT6 proteins were 93·7 % similar) had identical expression patterns in response to salt stress, and deficiencies in potassium and iron. However, TFT4 and TFT11, with 91·9 % protein sequence similarity, exhibited different expression patterns in response to salt stress and potassium deficiency in young roots. This suggested that the gene expression of 14-3-3 proteins had undergone a different molecular evolutionary mechanisms compared with those influencing protein sequences in the young tomato roots.

Gene-specific expression patterns indicate that isoform-specificity may exist in the 14-3-3 gene family of young tomato roots

14-3-3 proteins possess a highly conserved target-binding domain, which is able to recognize several short consensus amino acid sequence motifs containing phosphoserine or phosphothreonine (Fu et al., 2000). However, data that suggest that individual 14-3-3 isoforms do have a specific function in higher plants are accumulating in the literature (Testerink et al., 1999; Sehnke et al., 2002; Comparot et al., 2003; Alsterfjord et al., 2004; Paul et al., 2005; Sinnige et al., 2005). The present results also supported the notion that isoform specificity may exist in the 14-3-3 gene family in plants (Fig. 3 and Table 3). In this study, it was found that the 14-3-3 proteins exhibit diverse patterns of gene expression in response to salt stress and potassium and iron deficiencies in the young tomato roots. For example, by comparing the abundance of individual 14-3-3 gene transcripts under normal growth conditions in the tomato roots, it was found that there were also significant differences in the relative levels of 14-3-3 gene expression: TFT1, TFT5 and TFT10 appeared to be high, TFT4, TFT6 and TFT7 moderate, and TFT2, TFT3, TFT9 and TFT11 very low. Additionally, the expression of TFT8 and TFT12 were not detected in tomato roots (Fig. 3 and Table 3). On the other hand, some changes in 14-3-3 expression levels in the tomato roots in response to soil abiotic stress (salinity and potassium and iron deficiencies) had been observed in the present experiment. In the tomato roots, potassium deficiency greatly increased the expression of most of the 14-3-3 gene family members except for TFT1, TFT11 and TFT10 and iron deficiency only increased the expression of one member of 14-3-3 gene family (TFT7). Steady-state transcript levels of most of the 14-3-3 gene family members appear relatively unchanged, but significant up-regulation of four genes, TFT1, TFT4, TFT7 and TFT10, was observed repeatedly under salt stress conditions in young roots (Fig. 3 and Table 3). This tends to suggest specific functions for particular 14-3-3 genes in the tomato roots. There are several reasons for the fact that isoform-specificity may exist in the 14-3-3 gene family in young tomato roots. Firstly, although the 14-3-3 protein sequences are highly conserved, variation does exist within N- and C-terminal domain. It has been suggested that the N- and C-termini have functions in isoform specificity of the 14-3-3 gene family (Jones et al., 1995; Liu et al., 1995; Testerink et al., 2002; Börnke, 2005). Secondly, there is increasing evidence that promoter is associated with gene-specific expression pattern in higher plants (Venter and Botha, 2004). In the potato, the 14-3-3 gene expression specificity in response to stress is promoter-dependent (Aksamit et al., 2005). Thirdly, many published studies indicate that in plants, tissue- and cell-specific expression has been observed for the 14-3-3 gene family. For example, in Arabidopsis thaliana, 14-3-3 gene expression exhibits cell- and tissue-specific localization rivalling that observed for 14-3-3 proteins within the mammalian brain (Daugherty et al., 1996; Paul et al., 2005).

14-3-3 proteins (TFT7) might mediate cross-talk between the salt stress and potassium and iron deficiency signalling pathways in young tomato roots

Plants have stress-specific adaptive responses as well as responses which protect the plants from more than one abiotic stress. There are multiple stress perception and signalling pathways in plants, some of which are specific, but others may cross-talk at various steps. It is becoming clear that there are a number of examples of cross-talk between different stresses (Chinnusamy et al., 2004). Recently, it has been found in higher plants that 14-3-3 proteins may play a role in the cross-talk between abiotic stresses (Roberts et al., 2002; Ferl, 2004). The results of Wang et al. (2002) indicate that under mineral nutrient deficiencies, TFT7 (one of the 14-3-3 genes) may play a role in cross-talk and root/rhizosphere-mediated signals in tomato roots. The response of TFT7 to salt stress and potassium and iron deficiencies shown here suggests that it might mediate cross-talk between the systems sensing changes in the status of salt, potassium and iron (Fig. 3 and Table 3).

In conclusion, by using real-time RT–PCR, detailed analyses of the expression patterns of the entire set of genes in the 14-3-3 family in response to salt stress and potassium and iron deficiencies in the young tomato roots have been described. The actual roles and complexity of interactions of 14-3-3 proteins are challenging goals for future research.

Acknowledgments

We sincerely thank Dr Andre Jagendorf (Cornell University) for a critical review on the manuscript. This investigation was supported financially by a grant from CAS (Chinese Academy of Sciences) Research Program on Soil Biosystems and Agro-Product Safety (No. CXTD-Z2005-4).

LITERATURE CITED

  1. Aksamit A, Korobczak A, Skala J, Lukaszewicz M, Szopa J. (2005) The 14-3-3 gene expression specificity in response to stress is promoter-dependent. Plant Cell Physiology 461635–1645. [DOI] [PubMed] [Google Scholar]
  2. Alsterfjord M, Sehnke PC, Arkell A, Larsson H, Svennelid F, Rosenquist M, et al. (2004) Plasma membrane H+-ATPase and 14-3-3 isoforms of Arabidopsis leaves: evidence for isoform specificity in the 14-3-3/H+-ATPase interaction. Plant Cell Physiology 451202–1210. [DOI] [PubMed] [Google Scholar]
  3. Börnke F. (2005) The variable C-terminus of 14-3-3 proteins mediates isoform-specific interaction with sucrose-phosphate synthase in the yeast two-hybrid system. Journal of Plant Physiology 162161–168. [DOI] [PubMed] [Google Scholar]
  4. Bridges D and Moorhead GBG. (2004) 14-3-3 proteins: a number of functions for a numbered protein. Science's STKE 2421–8. [DOI] [PubMed] [Google Scholar]
  5. Bunney TD, Wijngaard PWJ, Boer AH. (2002) 14-3-3 protein regulation of proton pumps and ion channels. Plant Molecular Biology 501041–1051. [DOI] [PubMed] [Google Scholar]
  6. Chen Z, Fu H, Liu D, Chang PFL, Narasimhan M, Ferl R, et al. (1994) A NaCl-regulated plant gene encoding a brain protein homolog that activates ADP ribosyltransferase and inhibits protein kinase C. The Plant Journal 6729–740. [DOI] [PubMed] [Google Scholar]
  7. Chérel I. (2004) Regulation of K+ channel activities in plants: from physiological to molecular aspects. Journal of Experimental Botany 55337–351. [DOI] [PubMed] [Google Scholar]
  8. Chinnusamy V, Schumaker K, Zhu JK. (2004) Molecular genetic perspectives on cross-talk and specificity in abiotic stress signalling in plants. Journal of Experimental Botany 55225–236. [DOI] [PubMed] [Google Scholar]
  9. Chung HJ, Sehnke PC, Ferl RJ. (1999) The 14-3-3 proteins: cellular regulators of plant metabolism. Trends in Plant Science 4367–371. [DOI] [PubMed] [Google Scholar]
  10. Coker JS and Davies E. (2003) Selection of candidate housekeeping controls in tomato plants using EST data. Short Technical Reports No. 35: 740 Bio Techniques–748 Bio Techniques. [DOI] [PubMed]
  11. Comparot S, Lingiah G, Martin T. (2003) Function and specificity of 14-3-3 proteins in the regulation of carbohydrate and nitrogen metabolism. Journal of Experimental Botany 54595–604. [DOI] [PubMed] [Google Scholar]
  12. Curie C and Briat JF. (2003) Iron transport and signaling in plants. Annual Review of Plant Biology 54183–206. [DOI] [PubMed] [Google Scholar]
  13. Daugherty CJ, Rooney MF, Miller PW, Ferl RJ. (1996) Molecular organization and tissue-specific expression of an Arabidopsis 14-3-3 gene. The Plant Cell 81239–1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fei Z, Tang X, Alba R, Giovannoni J. (2006) Tomato expression database (TED): a suite of data presentation and analysis tools. Nucleic Acids Research 34D766–D770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ferl RJ. (2004) 14-3-3 proteins: regulation of signal-induced events. Physiologia Plantarum 120173–178. [DOI] [PubMed] [Google Scholar]
  16. Finkelstein RR, Gampala SSL, Rock CD. (2002) Abscisic acid signaling in seeds and seedlings. The Plant Cell 14S15–S45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fu H, Subramanian RR, Masters SC. (2000) 14-3-3 proteins: structure, function and regulation. Annual Review of Pharmacology and Toxicology 40617–647. [DOI] [PubMed] [Google Scholar]
  18. Gachon C, Mingam A, Charrier B. (2004) Real-time PCR: what relevance to plant studies? Journal of Experimental Botany 551445–1454. [DOI] [PubMed] [Google Scholar]
  19. Jones DH, Ley S, Aitken A. (1995) Isoforms of 14-3-3 protein can form homo- and heterodimers in vivo and in vitro: implications for function as adapter proteins. FEBS Letters 36855–58. [DOI] [PubMed] [Google Scholar]
  20. Kerkeb L, Venema K, Donaire JP, Rosales MPR. (2002) Enhanced H+/ATP coupling ratio of H+-ATPase and increased 14-3-3 protein content in plasma membrane of tomato cells upon osmotic shock. Physiologia Plantarum 11637–41. [DOI] [PubMed] [Google Scholar]
  21. Kochian LV. (2000) Molecular physiology of mineral nutrient acquisition, transport, and utilization. In Buchanan BB, Gruissem W, Jones RJ (Eds.). Biochemistry and molecular biology of plants(American Society of Plant Physiologists, Rockville, MD) pp. 1204–1249.
  22. Liu D, Bienkowska J, Petosa C, Collier RJ, Fu H, Liddington R. (1995) Crystal structure of the zeta isoform of the 14-3-3 protein. Nature 376191–194. [DOI] [PubMed] [Google Scholar]
  23. Lukaszewicz M, Kata IM, Aksamit A, Oszmianhski J, Szopa J. (2002) 14-3-3 protein regulation of the antioxidant capacity of transgenic potato tubers. Plant Science 163125–130. [Google Scholar]
  24. Maathuis FJM, Filatov V, Herzyk P, Krijger GC, Axelsen KB, Chen S, et al. (2003) Transcriptome analysis of root transporters reveals participation of multiple gene families in the response to cation stress. The Plant Journal 35675–692. [DOI] [PubMed] [Google Scholar]
  25. Mladek C, Guger K, Hauser MT. (2003) Identification and characterization of the ARIADNE gene family in Arabidopsis: a group of putative E3 ligases. Plant Physiology 13127–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Orsel M, Krapp A, Vedele FD. (2002) Analysis of the NRT2 nitrate transporter family in Arabidopsis: structure and gene expression. Plant Physiology 129886–896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Palmgren MG. (2001) Plant plasma membrane H+-ATPases: powerhouses for nutrient uptake. Annual Review of Plant Physiology and Plant Molecular Biology 52817–845. [DOI] [PubMed] [Google Scholar]
  28. Panchuk II, Volkov RA, Schöffl F. (2002) Heat stress- and heat shock transcription factor-dependent expression and activity of ascorbate peroxidase in Arabidopsis. Plant Physiology 129838–853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Paul AL, Sehnke PC, Ferl RJ. (2005) Isoform-specific subcellular localization among 14-3-3 proteins in Arabidopsis seems to be driven by client interactions. Molecular Biology of the Cell 161735–1743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Roberts MR. (2003) 14-3-3 proteins find new partners in plant cell signaling. Trends in Plant Science 8218–223. [DOI] [PubMed] [Google Scholar]
  31. Roberts MR and Bowles DJ. (1999) Fusicoccin, 14-3-3 proteins, and defense responses in tomato plants. Plant Physiology 1191243–1250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Roberts MR, Salinas J, Collinge DB. (2002) 14-3-3 proteins and response to abiotic and biotic stress. Plant Molecular Biology 10311031–1039. [DOI] [PubMed] [Google Scholar]
  33. Sanders D and Bethke P. (2000) Membrane transport. In Buchanan BB, Gruissem W, Jones RJ (Eds.). Biochemistry and molecular biology of plants(American Society of Plant Physiologists, Rockville, MD) pp. 110–158.
  34. Schmidt W. (2003) Iron solutions: acquisition strategies and signaling pathways in plants. Trends in Plant Science 8188–193. [DOI] [PubMed] [Google Scholar]
  35. Sehnke PC, Rosenquist M, Alsterfjord M, Delille J, Sommarin M, Larsson C, et al. (2002) Evolution and isoform specificity of plant 14-3-3 proteins. Plant Molecular Biology 501011–1018. [DOI] [PubMed] [Google Scholar]
  36. Shanko AV, Mesenko MM, Klychnikov OI, Nosov AV, Ivanov VB. (2003) Proton pumping in growing part of maize root: its correlation with 14-3-3 protein content and changes in response to osmotic stress. Biochemistry (Moscow) 681320–1326. [DOI] [PubMed] [Google Scholar]
  37. Shen H, He LF, Sasaki T, Yamamoto Y, Zheng SJ, Ligaba A, et al. (2005) Citrate secretion coupled with the modulation of soybean root tip under aluminum stress: up-regulation of transcription, translation, and threonine-oriented phosphorylation of plasma membrane H+-ATPase. Plant Physiology 138287–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sinnige MP, Roobeek L, Bunney TD, Visser AJWG, Mol JNM, Boer AH. (2005) Single amino acids variation in barley 14-3-3 proteins leads to functional isoform specificity in the regulation of nitrate reductase. The Plant Journal 441001–1009. [DOI] [PubMed] [Google Scholar]
  39. Tester M and Davenport R. (2003) Na+ tolerance and Na+ transport in higher plants. Annals of Botany 91503–527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Testerink C, Meulen RM, Oppedijk BJ, Boer AH, Dijkstra SH, Kijne JW, Wang M. (1999) Differences in spatial expression between 14-3-3 isoforms in germinating barley embryos. Plant Physiology 12181–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Testerink C, Zeijl MJ, Drumm K, Palmgren MG, Collinge DB, Kijne JW, et al. (2002) Post-translational modification of barley 14-3-3A is isoform-specific and involves removal of the hypervariable C-terminus. Plant Molecular Biology 50535–542. [DOI] [PubMed] [Google Scholar]
  42. Venter M and Botha FC. (2004) Promoter analysis and transcription profiling: integration of genetic data enhances understanding of gene expression. Physiologia Plantarum 12074–83. [DOI] [PubMed] [Google Scholar]
  43. Vert GA, Briat JF, Curie C. (2003) Dual regulation of the Arabidopsis high-affinity root iron uptake system by local and long-distance signals. Plant Physiology 132796–804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Véry AA and Sentenac H. (2003) Molecular mechanisms and regulation of K+ transport in higher plants. Annual Review of Plant Biology 54575–603. [DOI] [PubMed] [Google Scholar]
  45. Wang YH, Garvin DF, Kochian LV. (2001) Nitrate-induced genes in tomato roots: array analysis reveals novel genes that may play a role in nitrogen nutrition. Plant Physiology 127345–359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wang YH, Garvin DF, Kochian LV. (2002) Rapid induction of regulatory and transporter genes in response to phosphorus, potassium, and iron deficiencies in tomato roots: evidence for cross-talk and root/rhizosphere-mediated signals. Plant Physiology 1301361–1370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wei JZ, Tirajoh A, Effendy J, Plant AL. (2000) Characterization of salt-induced changes in gene expression in tomato (Lycopersicon esculentum) roots and the role played by abscisic acid. Plant Science 159135–148. [DOI] [PubMed] [Google Scholar]
  48. Wijngaard PWJ, Sinnige MP, Roobeek L, Reumer A, Schoonheim PJ, Mol JNM, et al. (2005) Abscisic acid and 14-3-3 proteins control K+ channel activity in barley embryonic root. The Plant Journal 4143–55. [DOI] [PubMed] [Google Scholar]
  49. Yan J, He C, Wang J, Mao Z, Holaday SA, Allen RD, Zhang H. (2004) Overexpression of the Arabidopsis 14-3-3 protein GF14λ in cotton leads to a ‘stay-green’ phenotype and improves stress tolerance under moderate drought conditions. Plant Cell Physiology 451007–1014. [DOI] [PubMed] [Google Scholar]
  50. Zhang H, Wang J, Nickel U, Allen RD, Goodman HM. (1997) Cloning and expression of an Arabidopsis gene encoding a putative peroxisomal ascorbate peroxidase. Plant Molecular Biology 34967–971. [DOI] [PubMed] [Google Scholar]
  51. Zhu JK. (2001) Plant salt tolerance. Trends in Plant Science 666–71. [DOI] [PubMed] [Google Scholar]
  52. Zhu JK. (2003) Regulation of ion homeostasis under salt stress. Current Opinion in Plant Biology 6441–445. [DOI] [PubMed] [Google Scholar]

Articles from Annals of Botany are provided here courtesy of Oxford University Press

RESOURCES