Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jan 11.
Published in final edited form as: Dev Biol. 2005 Nov 28;289(2):482–493. doi: 10.1016/j.ydbio.2005.10.040

Fog1 is required for cardiac looping in zebrafish

R Zaak Walton c, Ashley EE Bruce a, Harold E Olivey c, Khalid Najib c, Vanitha Johnson c, Judy U Earley c, Robert K Ho b, Eric C Svensson c,*
PMCID: PMC2804444  NIHMSID: NIHMS164630  PMID: 16316643

Abstract

To further our understanding of FOG gene function during cardiac development, we utilized zebrafish to examine FOG’s role in the early steps of heart morphogenesis. We identified fragments of three fog genes in the zebrafish genomic database and isolated full-length coding sequences for each of these genes by using a combination of RT-PCR and 5′-RACE. One gene was similar to murine FOG-1 (fog1), while the remaining two were similar to murine FOG-2 (fog2a and fog2b). All Fog proteins were able to physically interact with GATA4 and function as transcriptional co-repressors. Whole-mount in situ hybridization revealed fog1 expression in the heart, the hematopoietic system, and the brain, while fog2a and fog2b expression was restricted to the brain. Injection of zebrafish embryos with a morpholino directed against fog1 resulted in embryos with a large pericardial effusion and an unlooped heart tube. This looping defect could be rescued by co-injection of mRNA encoding murine FOG-1, but not by mRNA encoding FOG-1 lacking the FOG repression motif. Taken together, these results demonstrate the importance of FOG proteins for zebrafish cardiac development and suggest a previously unappreciated role for FOG proteins in heart looping that is dependent on the FOG repression motif.

Keywords: Transcription, Repression, GATA, FOG, Zfpm2, Zfpm1, Heart, Cardiogenesis, Development, Danio rerio

Introduction

The GATA family of transcriptional activators contains 6 members, three of which are expressed predominantly in cells of the hematopoietic system (GATA1, 2, and 3) and three that are expressed predominantly in heart, gut, and lung (GATA4, 5, and 6) (Crispino, 2005; Heicklen-Klein et al., 2005; Molkentin, 2000; Pikkarainen et al., 2004; Sorrentino et al., 2005). There are several reports of mutations within these genes leading to human disease. Mutations in GATA1, for example, lead to familial dyserythropoietic anemia and thrombocytopenia (Mehaffey et al., 2001; Nichols et al., 2000), while mutations in GATA3 lead to HDR (hypoparathyroidism, sensorineural deafness, renal anomaly) syndrome (Nesbit et al., 2004; Van Esch et al., 2000). Some of the reported mutations result in a GATA protein that is unable to bind DNA, but other mutations result in GATA factors with intact DNA binding but impaired binding to their co-factors, the friend of GATA (FOG) proteins (Mehaffey et al., 2001; Nesbit et al., 2004; Nichols et al., 2000). These observations highlight the importance of FOG-GATA interactions for the development of specific organ systems and suggest that FOG proteins themselves may be important in human disease.

GATA factors are also known to be important for cardiac development. Cardiac development is a tightly regulated process requiring the combinatorial interaction of multiple transcription factors in a temporally and spatially restricted fashion (Brand, 2003; Bruneau, 2002; Cripps and Olson, 2002; Fishman and Chien, 1997). Work in flies, fish, and mice has demonstrated that GATA factors are required for proper heart formation and can physically interact with many other transcriptional regulators of cardiac development including Nkx2.5, SRF, MEF2, NFATc, Tbx5, and FOG proteins (Belaguli et al., 2000; Durocher et al., 1997; Garg et al., 2003; Molkentin et al., 1998; Morin et al., 2000; Svensson et al., 1999; Tevosian et al., 1999). This work has provided the foundation for understanding the molecular basis of human congenital heart disease. As with GATA1 and GATA3, mutations in GATA4 have been described in humans (Garg et al., 2003). These mutations disrupt GATA4’s ability to bind to DNA and interact with the transcription factor Tbx5. Patients with such mutations have defects in cardiac morphogenesis characterized predominantly by atrial septal defects.

Like the GATA family, members of the FOG family of transcriptional co-factors are expressed in the heart during development and are required for proper heart formation across species from fruit flies to mice (Cantor and Orkin, 2005). All FOG proteins are multi-type zinc finger proteins that are characterized by their ability to bind to GATA factors and co-activate or co-repress transcription of target genes (Holmes et al., 1999; Lu et al., 1999; Svensson et al., 1999; Tevosian et al., 1999; Tsang et al., 1997). In mice and humans, there are two FOG genes, FOG-1 and FOG-2. Mice with a targeted disruption of FOG-1 die at embryonic day (ED) 11.5 of severe anemia secondary to a block in the differentiation of erythrocytes, making it difficult to ascertain the role of FOG-1 in cardiovascular development (Tsang et al., 1998). However, an endothelial lineage-specific disruption of the FOG-1 gene results in mice that die at ED 14.5 of congenital heart defects that include double outlet right ventricle, a common AV valve, and ventricular and atrial septal defects, demonstrating the importance of FOG-1 for cardiac development (Katz et al., 2003). Mice with a targeted disruption in the FOG-2 gene also die in mid-gestation of congenital heart malformations that include defects similar to those seen in the FOG-1 endothelial-specific disruption (double outlet right ventricle, a common AV valve, ventricular, and atrial septal defects) as well as left ventricular wall hypoplasia, and the failure to form coronary arteries (Svensson et al., 2000b; Tevosian et al., 2000). Together, these results suggest the importance of both FOG-1 and FOG-2 for murine cardiac development.

Although mutations in the FOG genes might be predicted to cause congenital heart disease, there is only one report to date of congenital heart disease associated with sequence variations in human FOG genes (Pizzuti et al., 2003). Interpretation of this work is hampered in part by incomplete knowledge of the important functional domains of FOG proteins. Such functionally important domains should be evolutionally conserved in species as diverse as mice and zebrafish. To identify such domains, and to provide a better foundation for understanding the molecular basis of congenital heart disease, we sought to identify and characterize fog genes in the Danio rerio genome. One of these genes, fog1, is similar to murine FOG-1 and expressed in the developing heart, intermediate cell mass (ICM), and nervous system of zebrafish embryos. The other two genes, fog2a and fog2b, are similar to murine FOG-2, and both are expressed in the developing brain. All zebrafish Fog proteins can bind to GATA4 via highly conserved zinc finger motifs and repress GATA-mediated transactivation of a cardiac-restricted promoter. Zebrafish depleted of Fog1 using an antisense morpholino develop congenital heart disease, with the developing heart tube failing to undergo cardiac looping. This phenotype could be rescued by overexpression of murine FOG-1 but not by a mutant version of FOG-1 lacking another conserved domain, the FOG repression motif, demonstrating the importance of this domain for Fog function in vivo.

Materials and methods

Zebrafish strains and care

The zebrafish strain used in this work was *AB. Zebrafish were cared for in accordance with the policies of the animal resources center at the University of Chicago. Zebrafish embryos were staged as described (Kimmel et al., 1995).

Isolation of fog cDNAs

Partial sequences encoding the C-terminus of three fog genes in zebrafish were obtained by a BLAST search of the zebrafish genomic database using the murine FOG-1 and FOG-2 protein sequences. To isolate the 5′ end of each fog cDNA, we first isolated total RNA from 96 h post-fertilization (hpf) zebrafish embryos using Trizol (Invitrogen, Carlsbad, CA). Next, rapid amplification of cDNA ends (RACE) was performed using a commercially available kit (CLONTECH, Palo Alto, CA) to isolate cDNA from the 5′ end of each fog gene. RACE products were subcloned into pGEM-T Easy (Promega, Madison, WI) and ten RACE clones per fog gene were sequenced to identify the longest transcripts. The full-length coding sequence for each of these transcripts was deposited into Genbank with accession numbers DQ015975 for fog1, DQ015976 for fog2a, and DQ015977 for fog2b. Expression vectors for each of the fog cDNAs were constructed by using the RT-PCR and primers (fog1, 5′-CGGGATCCTCAGGGTTCTCGTGTTTACTGTGG and 5′-CGGAATTCCTAAACTGTGGGAATAGGTCAGCG; fog2a, 5′-CGGGATCCAGATACAGATACACACACGCGTGC and 5′-CCGCTCGAGAAGTGCTCCAGTAGCTAATGTCGG; fog2b, 5′-CGGAATTCAGTTGTGCTGCTGCAGCTCTACGG and 5′-ATTTGCGGCCGCTGCAGTTGTCAAGGGTGGACAACG) to amplify the entire coding region of each fog gene. These fragments were then inserted into the BamHI/EcoRI, BamHI/XhoI, or EcoRI/NotI sites of pcDNA3, respectively. All constructs were verified by sequencing.

In vitro binding reactions

The BL21 strain of E. coli was transformed with an expression construct encoding glutathione-S-transferase (GST) fused to the zinc fingers of murine GATA4 as described previously (Svensson et al., 1999). Fusion protein was purified using glutathione sepharose beads and incubated with in vitro translated, 35S-labeled Fog proteins in binding buffer (150 mM NaCl, 50 mM Tris, pH7.5, 0.1% NP-40, 1 mM βME, 10 mM ZnSO4, 0.25% BSA) as described previously (Svensson et al., 1999). Resultant complexes were washed extensively, resolved by SDS-PAGE, and visualized by autoradiography.

Transfections

NIH 3T3 fibroblasts were transfected using Superfect reagent (Qiagen, Valencia, CA) following the manufacturer’s protocol. Briefly, 1.5 × 105 cells were plated onto 12-well plates 18 h prior to transfection. On the day of transfection, 1.5 μg of plasmid DNA was incubated with 3 μg of Superfect reagent in 75 μl of OptiMEM for 10 min, and then 400 μl growth media was added, and the entire mixture was applied to the washed cells for 3 h at 37°C, 5% CO2. Following this incubation, cells were washed with PBS, and 1 ml of growth media was applied. Forty-eight hours after transfection, cells and media were harvested. Cell lysate was assayed for protein concentration (BioRad, Hercules, CA) and for β-galactosidase activity (Promega) using commercially available reagents. Corrected β-galactosidase activity was calculated by dividing the measured β-galactosidase activity by the protein concentration of the lysate. Human growth hormone concentration in the cell media was determined using an ELISA (Roche, Indianapolis, IN). Relative promoter activity was calculated by dividing the growth hormone concentration by the corrected β-galactosidase activity. In each experiment, transfections were performed in triplicate. Each experiment was repeated 4 times.

In situ hybridization

Fragments of fog1 (925– 2602 bp), fog2a (2976–3708 bp), fog2b (2443–3089 bp), or pitx2 (452– 1471 bp) were amplified by the PCR and inserted into pGEM-T Easy (Promega). Cmlc2 in pGEM-T was obtained from Dr. Deborah Yelon. In situ probes for tbx5 and tbx20 have been described previously (Ahn et al., 2000, 2002). Antisense digoxigenin-labeled riboprobes were prepared using these constructs and a commercially available kit (Promega) supplemented with digoxigenin-UTP (Roche). Whole-mount in situ hybridizations were performed as follows. Zebrafish embryos were grown in the presence of 0.003% 1-phenyl-2-thiourea (PTU) for 24 to 72 hpf to reduce pigment formation, fixed in 4% paraformaldehyde at 4°C for 24 to 48 h, washed with phosphate-buffered saline (PBS) and PBST (PBS + 0.1% Tween-20) and then dehydrated in a graded methanol series. Embryos were then re-hydrated in PBST and digested with 10 μg/ml of proteinase K at room temperature for 3 to 40 min, depending on the age of the embryo. Following digestion, embryos were re-fixed in 4% paraformaldehyde for 30 min at room temperature and then washed four times with PBST. Embryos were then pre-hybridized in Hyb mix (5 × SSC, 65% formamide, 50 μg/ml heparin, 0.1% Tween-20, 0.5 mg/ml tRNA) for 3 h at 70°C followed by hybridization with the digoxigenin-labeled riboprobe for 16 h at 70°C. Subsequently, embryos were washed with a graded series of Hyb mix/2 × SSC buffers followed by two 30-min washes in 0.05 × SSC, all at 70°C. Embryos were then washed with a graded series of 0.05 × SSC/PBST buffers at room temperature and then transferred to incubation buffer (PBST + 2% sheep serum + 2 mg/ml BSA) for 1 h at room temperature. An alkaline phosphatase conjugated sheep anti-digoxigenin Fab fragment (Roche) was added (1:5000 dilution) and incubated for 16 h at 4°C. Following this incubation, embryos were washed 10 times with PBST for 15 min each at room temperature and then 3 times for 5 min each with AP buffer (100 mM Tris pH 9.5, 50 mM MgCl2, 100 mM NaCl, 0.1% Tween-20). Next, nitroblue tetrazolium (NBT) was added to a final concentration of 0.44 mg/ml and 5-bromo, 4-chloro, 3-indolylphosphate (BCIP) was added to a final concentration of 0.165 mg/ml and embryos incubated at room temperature until staining was observed. Color development was stopped by serial washes with PBST and the addition of 5 mM EDTA. Embryos were cleared with an overnight incubation in glycerol and photographed using a Nikon Eclipse E600 microscope.

In vitro translations

One microgram of pcDNAfog1, pcDNAfog2a, or pcDNAfog2b was in vitro transcribed and translated in the presence of [35S]methionine using a commercially available kit (Promega) in the absence or presence of 20 ng/μl morpholino. Reactions were subsequently resolved by SDS-PAGE and subjected to autoradiography.

Morpholino injections

Morpholinos specific to the 5′ untranslated region of fog1 (5′-GATCCGTCCTCCGAGGCGACTAGCA), fog2a (5′-AATGAGAGGTTATTATGGATCATCC), fog2b (5′-TTCATCCAAACACAGATAAACGCTC) and a 5-base mismatch control (5′-TTAATCGAAAGACAGATTAACGGTC) were synthesized by Gene Tools, LLC (Philomath, OR). Morpholinos were also designed to target the exon 4/intron 4 splice donor site of fog1 (CCTTCATGTCCCCCTTACCTCACTG) or fog2a (TTAAACGAGATGGACTGTACCTGTG) or the exon 5/intron 5 splice donor site of fog2b (AGACAAAGCAATCTCACCTTTACTG). Morpholinos were resuspended in dH2O at a concentration of 3 mM and stored at −20°C. Immediately prior to use, the morpholinos were diluted to 0.1 mM to 0.5 mM in 0.2 M KCl and 0.2 mg/ml Fast Green as described previously (Oates and Ho, 2002). One-cell embryos were injected with approximately 3.8 nl of this solution (0.4–1.9 pmol morpholino) into the streaming yolk, and successful injections were confirmed by observation of Fast Green in the yolk. For rescue experiments, mRNA was transcribed from templates encoding murine FOG-1 (pcDNA FOG-1) or an N-terminal truncation of FOG-1 (pcDNA FOG-1231 – 995) using a commercially available kit (Message Machine, Ambion, Austin, TX) (Svensson et al., 2000a). This RNA was diluted to 80 ng/μl in a solution containing 0.5 mM fog1 morpholino, 0.2 M KCl, and 0.2 mg/ml Fast Green and used to inject one-cell embryos as above.

Histology

Zebrafish embryos were dehydrated in a graded ethanol series and embedded in Durcupan resin (Sigma-Aldrich, St. Louis, MO). Five-micrometer sections were obtained using a Reichert-Jung ultramicrotome and stained with 0.27% Basic Fuchsin. Sections were photographed using a Zeiss Axiophot microscope.

Results

Isolation of fog cDNAs from zebrafish

In both the mouse FOG-1 and FOG-2 genes, the final exon is large (>2 kb) and encodes a majority of the protein. This same genomic structure is also conserved in the human and chicken FOG genes (E.C.S., unpublished observations). We reasoned that this might also be true in the zebrafish genome. As an initial step in identifying FOG genes in zebrafish, we performed a translated BLAST search of the zebrafish genome (version 5, Sanger Institute) using the murine FOG-2 amino acid sequence. We identified 3 loci located on chromosomes 16, 18, and 19 that had a large open reading frame that encoded a protein that was homologous to the C-terminus of FOG-2 and appeared to be the final exon of three distinct zebrafish fog genes. To isolate the 5′ end of the corresponding cDNA for each of these genes, we used 5′ rapid amplification of cDNA ends (5′-RACE). This allowed us to identify a complete open reading frame and primary amino acid sequence by conceptual translation for each of the fog genes. A comparison of the amino acid sequence encoded by each of the zebrafish fog genes to the murine FOG-1 and FOG-2 sequences revealed that the gene located on chromosome 18 was most similar to murine FOG-1 and thus designated fog1. The predicted primary amino acid sequence revealed a polypeptide of 1191 amino acids that was 42% identical to murine FOG-1 and contained 10 conserved zinc finger motifs (blue shading, Fig. 1). While murine FOG-1 has only 9 zinc fingers, a previously identified partial cDNA for a FOG protein from Xenopus (most likely a FOG-1 orthologue) was also found to have 10 zinc fingers and shared 38% amino acid identity with zebrafish fog1 (Deconinck et al., 2000). In addition, the previously identified C-terminal binding protein (CtBP) interaction motif and nuclear localization signal are conserved between mouse, frog, and zebrafish fog1 genes (orange and green shading, Fig. 1). Finally, the recently described N-terminal FOG repression motif was also conserved in zebrafish fog1 (red shading, Fig. 1), suggesting that fog1 may function as a transcriptional co-repressor (Lin et al., 2004).

Fig. 1.

Fig. 1

Open in a new tab

Fog1 is the zebrafish orthologue of murine FOG-1. Shown is a ClustalW alignment of the primary amino acid sequence obtained through conceptual translation of the murine FOG-1 and zebrafish fog1 cDNAs. Gray boxes indicate amino acid identities. Blue shading indicates the positions of the zinc finger motifs. Red shading indicates the position of the FOG repression motif, green shading indicates the potential nuclear localization signal, orange shading indicates the CtBP interaction motif, and yellow shading indicates the position of other regions of high sequence conservation among FOG family members.

The gene on chromosome 16 was most similar to FOG-2 and named fog2a, while the third fog gene located on chromosome 19 was more similar to FOG-2 than FOG-1 and thus named fog2b. Zebrafish Fog2a was 63% identical at the amino acid level to murine FOG-2, while zebrafish Fog2b was 43% identical to murine FOG-2. As with FOG-1, an alignment of the FOG-2 proteins from mice and zebrafish reveals the highest degree of conservation of the proteins lies in the zinc finger motifs and specifically fingers 1, 5, 6, 7 and 8 (Fig. 2). In addition, the FOG repression motif, CtBP binding site, and nuclear localization motif are also conserved. Finally, there are two regions that are conserved across all FOG proteins from all species examined to date: a domain N-terminal to the first zinc finger and a domain N-terminal to the fifth zinc finger (yellow shading, Figs. 1 and 2). The functional significance of these domains is currently unclear.

Fig. 2.

Fig. 2

Open in a new tab

Fog2a and fog2b are zebrafish homologues of murine FOG-2. Shown is a ClustalW alignment of the primary amino acid sequence obtained through conceptual translation of the murine FOG-2 and zebrafish fog2a and fog2b cDNAs. Gray shading indicates amino acid identities. Blue shading indicates the positions of the zinc finger motifs. Red shading indicates the position of the FOG repression motif, green shading indicates the potential nuclear localization signal, orange shading indicates the CtBP interaction motif, and yellow shading indicates the position of other regions of high sequence conservation among FOG family members.

Fog proteins physically interact with and repress GATA factors

One of the properties common to all FOG proteins is the ability to interact with GATA factors. To test if the zebrafish Fog proteins can also bind to GATA factors, we used an in vitro binding assay as described previously (Svensson et al., 2000a). As can be seen in Fig. 3A, zebrafish Fog1, Fog2a, and Fog2b bind to a protein containing the N- and C-terminal zinc fingers of GATA4 fused to GST but not to GST alone (compare columns 2 and 3), demonstrating that all of the zebrafish Fog proteins are capable of binding to the zinc fingers of murine GATA4, as has been reported for other FOG proteins (Fox et al., 1999; Lu et al., 1999; Svensson et al., 1999; Tevosian et al., 1999). To test the functional significance of the interaction of the Fog proteins with GATA4, we transiently transfected NIH 3T3 fibroblasts with an expression plasmid for GATA4 and a reporter plasmid containing 638 bp of the ANF promoter driving expression of human growth hormone. We have previously shown that GATA4 strongly transactivates this promoter, and the addition of either murine FOG-1 or FOG-2 represses this transactivation (Lin et al., 2004; Svensson et al., 2000a). Like murine FOG proteins, all of the zebrafish Fog proteins can also repress GATA4 in this cell and promoter context (Fig. 3B). Fog1 blocked GATA4-mediated activation of the ANF promoter by 87 ± 5%, while Fog2a and Fog2b inhibited GATA4 mediated activation by 48 ± 9% and 42 ± 9%, respectively (Fig. 3B, columns 3, 4, and 5). In all cases, the repression observed was statistically significant (P < 0.0001, P = 0.0002, and P = 0.001, respectively). Taken together, these observations suggest that the three genes identified here are the zebrafish homologues of the murine FOG genes.

Fig. 3.

Fig. 3

Open in a new tab

Zebrafish Fog proteins bind and repress GATA4. Zebrafish Fog proteins can physically interact with GATA4. In panel A, in vitro translated, 35S-labeled Fog1, Fog2a, or Fog2b proteins (column 1) were incubated with bacterially produced GST (column 2) or GST-GATA4 (column 3) fusion proteins and purified using glutathione sepharose beads. The resultant complexes were resolved by 7% SDS-PAGE and detected by autoradiography. A physical interaction of GATA4 and Fog proteins is indicated by the presence of 35S-labeled protein in column 3. Zebrafish Fog proteins can repress GATA4 mediated transcriptional activation. In panel B, NIH 3T3 fibroblasts were transfected with a reporter plasmid containing 638 bp of the ANF promoter driving expression of human growth hormone (hGH). In addition, expression plasmids for murine GATA4 (columns 2– 5) and zebrafish fog1 (column 3), fog2a (column 4), or fog2b (column 5) were included. Forty-eight hours post-transfection, cells were harvested and assayed for hGH. Results are reported as the mean ± SEM (n = 12).

Expression of the fog genes in the developing zebrafish embryo

Murine FOG-1 is expressed in the adult mouse in the spleen, liver, gonads, and at lower levels in the heart, brain, and lungs (Katz et al., 2002; Tsang et al., 1997). Within the developing heart, murine FOG-1 is expressed in the endocardial cushions of the outflow tract and atrioventricular canal at embryonic day 12.5. Murine FOG-2 is expressed in the adult heart, brain, and gonads as well as at low levels in the lung and liver (Lu et al., 1999; Svensson et al., 1999; Tevosian et al., 1999). In early mouse development, murine FOG-2 is first expressed in the looped heart tube at embryonic day 8.5 as well as the septum transversum. To determine the pattern of expression of each of the zebrafish fog genes, we used whole-mount in situ hybridization as shown in Fig. 4. Like murine FOG-1, zebrafish fog1 is expressed in the developing heart starting at 24 h post-fertilization (hpf) and continuing through 72 hpf (arrows, Fig. 4). Expression of fog1 was also detected in the developing brain (arrowheads, Fig. 4), along the developing spinal cord, and in the site of blood production in the early zebrafish embryo, the intermediate cell mass (asterisk, Fig. 4). Zebrafish fog2a and fog2b are expressed in the mid-brain, but in contrast to the expression pattern of murine FOG-2, expression of fog2a or fog2b could not be detected in the zebrafish heart at 24 or 48 hpf (Fig. 4). Thus, of the three fog genes in the zebrafish genome, only one, fog1, is expressed in the heart during early cardiac development and might therefore be expected to play a role in early heart morphogenesis.

Fig. 4.

Fig. 4

Open in a new tab

Expression of Fog genes during zebrafish development. Whole-mount in situ hybridization using digoxigenin-labeled antisense cRNA fog1, fog2a, and fog2b probes on zebrafish embryos from 19 hpf to 72 hpf. An asterisk in the top left panel indicates intermediate cell mass expression of fog1. In all panels, arrows indicate heart staining; arrowheads indicate brain staining.

Morpholinos against fog1 inhibit cardiac looping

As discussed above, the FOG genes in mice are critical for normal hematopoiesis and cardiac development. To ascertain if the fog genes in zebrafish are also important for cardiac development, we used antisense morpholinos to reduce Fog protein levels during early zebrafish development. We designed morpholinos against the translation initiation site in each fog mRNA and tested their effectiveness using an in vitro translation reaction for each fog message in the absence or presence of morpholino (Fig. 5A). As can be seen, for each message, the specific morpholino effectively inhibited protein production, while the morpholinos to the other fog mRNAs or a 5-base mismatch control had no effect. These results demonstrate that these morpholinos are specific and effective at blocking Fog protein expression in vitro. We also designed morpholinos specific to each fog message to block their proper splicing. These morpholinos were designed to the splice donor site of exon 4 (fog1 and fog2a) or the splice donor site of exon 5 (fog2b) such that they would produce aberrant splicing of the primary transcript resulting in the deletion of the targeted exon. Such a deletion would be predicted to lead to a frame shift in the resulting message, producing a truncated Fog protein lacking all of its zinc fingers. To test the effectiveness of these morpholinos, we used the RT-PCR with primers located in flanking exons (exons 3 and 5 for fog1 and fog2a, exons 4 and 6 for fog2b) on RNA derived from zebrafish embryos injected with these morpholinos. The results shown in Fig. 5B indicate that all three morpholinos were effective in disrupting splicing of their target message.

Fig. 5.

Fig. 5

Open in a new tab

Fog1 is required for cardiac looping. Anti-fog morpholinos inhibit translation or splicing of fog mRNA. In panel A, in vitro transcription and translation of Fog1 (top panel), Fog2a (middle panel), or Fog2b (bottom panel) in the absence (column 1) or presence of gene-specific morpholino (columns 2– 4) or mismatch control (column 5). In panel B, RT-PCR of RNA from 48 hpf zebrafish embryos uninjected (−) or injected (+) with morpholinos directed against the exon 4 splice donor site of fog1 (left panel), fog2a (middle panel), or the exon 5 splice donor site of fog2b (right panel) using primers from flanking exons. Arrowheads indicate the correctly spliced product; asterisks indicate aberrantly spliced products. Developmental defects in morpholino injected embryos. In panel C, morpholinos directed against fog1 (a and b), fog2a (c and d), fog2b (e and f) or a mismatch control (g and h) were injected into single-cell zebrafish embryos and embryos photographed 48 h post-fertilization (a, c, e, g). Arrows indicate a pericardial effusion and blood pooling in the atrium. Panels on the right (b, d, f, h) are in situ hybridizations using the cmlc2 probe on 48 hpf morphants.

To determine the role of Fog proteins in zebrafish development, we injected each morpholino into one-cell stage zebrafish embryos and allowed these embryos to develop for 48 h. Embryos injected with the control morpholino or a morpholino directed against the translation initiation site of fog2a or fog2b, the exon 4 splice donor site of fog2a, or the splice donor site of exon 5 of fog2b showed no apparent phenotype (n > 100). In contrast, by 48 h post-injection, 75% (n = 260) of the embryos injected with the morpholino against the fog1 translation initiation site showed a pericardial effusion and blood pooling just below the atrium (arrow, Fig. 5C). We also observed a decrease in the number of circulating erythrocytes within these morphants, suggesting a defect in erythropoiesis. Similar results were obtained with a morpholino directed against the splice donor site of exon 4 for fog1 (data not shown). To characterize the cardiac defect further in the fog1 morphants, we used whole-mount in situ hybridization with a probe against cardiac myosin light chain (cmlc2) to visualize the developing atrium and ventricle (Fig. 5C). At this stage in development, the heart has undergone looping in greater than 94% of uninjected embryos (n = 55) or embryos injected with a 5-base mismatch control morpholino (n = 51). The same was seen in morphants of fog2a and fog2b. However, in 75% (n = 70) of embryos injected with the anti-fog1 morpholino, looping did not occur. Instead, the heart remained as a linear tube (Fig. 5C). This tube was able to beat and drive the circulation but not as effectively as a wild-type heart as evidenced by the blood pooling seen in these embryos. These results demonstrate that fog1 is required for normal cardiac looping during zebrafish cardiac development.

Although heart looping was perturbed, morphants were able to survive for at least 7 days post-fertilization. At 4.5 days post-fertilization, an extensive pericardial effusion was readily apparent (Fig. 6, compare panels a and d). By 7 days post-fertilization, these embryos had impressive edema (Fig. 6, compare panels b and e), consistent with cardiac insufficiency. Histologic sections through the heart revealed a dilated, thin-walled ventricle and a dilated atrium (Fig. 6, compare panels c and f). Unlike mice deficient in FOG-2, in fog1 morphant embryos, hyperplastic atrioventricular or outflow tract valves were not present. This analysis suggests that the edema seen in these embryos was due to poor cardiac output from a ventricle with hypoplastic walls.

Fig. 6.

Fig. 6

Open in a new tab

Fog1 morphants have a hypoplastic ventricular wall. Gross morphology of a 4.5 days post-fertilization (a and d) or 7 days post-fertilization (b and e) embryo uninjected (a, b) or injected with an anti-fog1 morpholino at the single-cell stage (d, e). Note the extensive pericardial effusion in the Fog1 morphant. Below, longitudinal sections through the heart of an uninjected embryo (c) or a fog1 morphant (f) at 7 days post-fertilization. The ventricle is indicated by “v”, the atrium by “a”. Scale bar is 50 μm.

Several zebrafish genes have also been shown to be required for cardiac looping. The heartstrings mutation in the transcription factor tbx5 generates a fish with a heart tube that fails to loop (Garrity et al., 2002). Further, morpholinos have been used to reduce Tbx5 levels during development and have produced morphants with a linear heart tube (Ahn et al., 2002; Garrity et al., 2002). Similar work targeting tbx20 has also resulted in the inhibition of cardiac looping. In addition, tbx5 is down-regulated in the heart tube of the tbx20 morphant, suggesting that both of these factors lie in the same transcriptional pathway (Szeto et al., 2002). To determine if other genes known to be involved in cardiac looping were altered in the fog1 morphants, we performed whole-mount in situ hybridization of wild-type and fog1 morphants using probes against tbx5 and tbx20 (Fig. 7). Our results indicate no significant difference in expression patterns of these genes. This result suggests that either fog1 is a downstream target of these genes, or that fog1 may regulate cardiac looping in zebrafish through an alternative pathway to those of tbx5 and tbx20.

Fig. 7.

Fig. 7

Open in a new tab

Gene expression in fog1 morphants. Whole-mount in situ hybridizations were performed using probes specific for tbx5 (left column) or tbx20 (right column) on 48 hpf wild-type embryos (rows 1 and 3) or fog1 morphants (rows 2 and 4). Arrows indicate heart expression of each of these genes.

The FOG repression motif is required to rescue cardiac looping in fog1 morphants

Since there is significant sequence divergence between murine and zebrafish fog1 at the morpholino target site, the fog1 translation initiation site morpholino should not be able to block translation of murine FOG-1 mRNA. To determine if murine FOG-1 could rescue the phenotype seen in the fog1 morphant, we co-injected the fog1 translation initiation site morpholino with mRNA encoding murine FOG-1 into zebra-fish embryos (Fig. 8). As before, a majority of the embryos (71%, n = 142) injected with the fog1 morpholino developed a pericardial effusion. Co-injection of mRNA encoding murine FOG-1 resulted in a rescue of this phenotype, with only 26% (n = 151) of the co-injected embryos developing pericardial edema and failing to undergo cardiac looping. These results provide further evidence that the phenotype seen in the fog1 morphants is caused by the depletion of the Fog1 protein in these embryos.

Fig. 8.

Fig. 8

Open in a new tab

Expression of murine FOG-1 rescues the fog1 morphant phenotype. Shown above are 48hpf zebrafish embryos uninjected (a), injected with an anti-fog1 morpholino (b), injected with an anti-fog1 morpholino and mRNA encoding murine FOG-1 (c), or injected with an anti-fog1 morpholino and mRNA encoding an N-terminal truncation of murine FOG-1 (ΔFOG-1) (d). Atrial and yolk sac blood pooling is indicated by the arrows.

Our previous work on the important functional domains of FOG proteins has demonstrated that the N-termini of both FOG-1 and FOG-2 contain a conserved domain that mediates transcriptional repression, the FOG repression motif (Lin et al., 2004). Transient transfections into murine fibroblasts have demonstrated that FOG proteins with deletions of this domain are unable to repress GATA4-mediated promoter activation. As indicated in Figs. 1 and 2, this domain is also present in all of the zebrafish Fog proteins, providing further evidence to support the importance of this domain. To test the functional significance of this domain for the regulation of cardiac looping in zebrafish, we co-injected mRNA encoding murine FOG-1 lacking its N-terminal repression domain (Fig. 8, ΔFOG-1). This mRNA was almost completely unable to rescue the fog1 morphant phenotype, with 61% (n = 57) of the injected embryos developing a pericardial effusion. Taken together, these results demonstrate the importance of the FOG repression motif for proper cardiac development and suggest that the mechanism by which Fog proteins mediate proper cardiac looping in zebrafish is via transcriptional repression.

Discussion

To improve our understanding of Fog protein function and provide further insights into the molecular basis of congenital heart disease, we describe in this report the cloning and characterization of three fog genes from zebrafish. Given the evidence for a whole genome duplication in the evolution of teleost fish (Amores et al., 1998; Hoegg et al., 2004), it is not surprising that we identified two FOG-2 paralogues in zebrafish. On the other hand, only one gene homologous to murine FOG-1 was identified in the zebrafish genome, suggesting that either the second fog1 paralogue was lost during evolution, or that it lies in a region of the genome where sequencing is not yet complete.

A comparison of the primary amino acid sequences of the Fog proteins from zebrafish and mice identified a number of domains that show a high degree of sequence conservation. One such domain is the CtBP interaction motif (Figs. 1 and 2, orange shading). Conservation of this sequence suggests that Fog1, Fog2a, and Fog2b are likely able to bind to CtBP as has been shown for their murine homologues (Deconinck et al., 2000; Holmes et al., 1999; Svensson et al., 2000a; Turner and Crossley, 1998). The Fog repression motif is also present in all zebrafish Fog proteins (Figs. 1 and 2, red shading). As shown in this report, zebrafish Fog proteins function as transcriptional co-repressors, as all three repressed GATA4 mediated transactivation of the ANF promoter in vitro (Fig. 3B). This repression is likely mediated at least in part by the FOG repression motif, as has been shown for murine FOG-1 and FOG-2 (Lin et al., 2004; Svensson et al., 2000a). Murine FOG proteins have also been shown to function as transcriptional co-activators in certain cell and promoter contexts (Jia and Takimoto, 2003; Letting et al., 2004; Tsang et al., 1997), so it is possible that zebrafish Fog proteins may also function as transcriptional co-activators in specific cell and promoter contexts. In addition to these conserved domains, there are also two other regions of high similarity between murine FOG proteins and their zebrafish homologues, one located N-terminal to zinc finger 1 and the other N-terminal to zinc finger 5 (Figs. 1 and 2, yellow shading). While the functional significance of these regions is currently unclear, their high degree of conservation suggests that they might be important for Fog function. The elucidation of the functional significance of these domains is an ongoing area of investigation within the laboratory.

The most striking phenotype seen in the fog1 morphants was the extensive pericardial edema most likely secondary to a hypoplastic ventricular wall and an inhibition of cardiac looping. This phenotype could be rescued by overexpression of murine FOG-1 but not by a truncated version of FOG-1 lacking the FOG repression motif. This observation is the first in vivo demonstration of the functional significance of the FOG repression motif and highlights the importance of this domain for the function of FOG proteins during cardiogenesis.

The ventricular wall hypoplasia in the fog1 morphants is similar to what has been seen in FOG-2-deficient mice, suggesting that FOG proteins are required for myocardial proliferation in both species. In contrast, the complete looping defect seen in fog1 morphants has not been previously appreciated in FOG-1 or FOG-2-deficient mice. FOG-2-deficient mice are characterized by a mis-alignment of their cardiac inflow and outflow tracts, having a double outlet right ventricle and a common AV valve (Svensson et al., 2000b; Tevosian et al., 2000). Disruption of the murine FOG-1 gene in endothelium results in a similar phenotype (Katz et al., 2003). Both of these cardiac phenotypes can be thought of as a partial looping defect, as cardiac looping is clearly initiated, but is incomplete due to a failure to properly align the inflow and outflow tracts with the developing ventricles. In contrast to mice, the results in this report demonstrate that zebrafish hearts only express one fog family member, fog1, and the knockdown of Fog1 results in a complete looping defect, as the heart tube remains as a linear structure. Since both FOG-1 and FOG-2 are expressed in the murine heart tube during looping (Katz et al., 2003; Svensson et al., 1999), it is possible that murine FOG proteins serve a redundant role in initiating looping but are unable to compensate for each other at later stages of looping, resulting in partial looping in FOG-1 or FOG-2-deficient murine hearts. In the zebrafish system, there is no redundancy in fog expression, and as a result, looping can be completely inhibited by knockdown of Fog1. Alternatively, the differences in FOG’s role in cardiac development in these two systems may represent a true divergence of FOG function in vertebrate heart morphogenesis.

Acknowledgments

The authors would like to thank Dae-gwon Ahn and Deborah Yelon for their technical expertise and insightful discussions. This work was supported by NIH HL071063, AHA 0230395 and a grant from the Schweppe Foundation.

References

  1. Ahn DG, Ruvinsky I, Oates AC, Silver LM, Ho RK. tbx20, a new vertebrate T-box gene expressed in the cranial motor neurons and developing cardiovascular structures in zebrafish. Mech Dev. 2000;95:253–258. doi: 10.1016/s0925-4773(00)00346-4. [DOI] [PubMed] [Google Scholar]
  2. Ahn DG, Kourakis MJ, Rohde LA, Silver LM, Ho RK. T-box gene tbx5 is essential for formation of the pectoral limb bud. Nature. 2002;417:754–758. doi: 10.1038/nature00814. [DOI] [PubMed] [Google Scholar]
  3. Amores A, Force A, Yan YL, Joly L, Amemiya C, Fritz A, Ho RK, Langeland J, Prince V, Wang YL, Westerfield M, Ekker M, Postlethwait JH. Zebrafish hox clusters and vertebrate genome evolution. Science. 1998;282:1711–1714. doi: 10.1126/science.282.5394.1711. [DOI] [PubMed] [Google Scholar]
  4. Belaguli NS, Sepulveda JL, Nigam V, Charron F, Nemer M, Schwartz RJ. Cardiac tissue enriched factors serum response factor and GATA-4 are mutual coregulators. Mol Cell Biol. 2000;20:7550–7558. doi: 10.1128/mcb.20.20.7550-7558.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brand T. Heart development: molecular insights into cardiac specification and early morphogenesis. Dev Biol. 2003;258:1–19. doi: 10.1016/s0012-1606(03)00112-x. [DOI] [PubMed] [Google Scholar]
  6. Bruneau BG. Transcriptional regulation of vertebrate cardiac morphogenesis. Circ Res. 2002;90:509–519. doi: 10.1161/01.res.0000013072.51957.b7. [DOI] [PubMed] [Google Scholar]
  7. Cantor AB, Orkin SH. Coregulation of GATA factors by the Friend of GATA (FOG) family of multitype zinc finger proteins. Semin Cell Dev Biol. 2005;16:117–128. doi: 10.1016/j.semcdb.2004.10.006. [DOI] [PubMed] [Google Scholar]
  8. Cripps RM, Olson EN. Control of cardiac development by an evolutionarily conserved transcriptional network. Dev Biol. 2002;246:14–28. doi: 10.1006/dbio.2002.0666. [DOI] [PubMed] [Google Scholar]
  9. Crispino JD. GATA1 in normal and malignant hematopoiesis. Semin Cell Dev Biol. 2005;16:137–147. doi: 10.1016/j.semcdb.2004.11.002. [DOI] [PubMed] [Google Scholar]
  10. Deconinck AE, Mead PE, Tevosian SG, Crispino JD, Katz SG, Zon LI, Orkin SH. FOG acts as a repressor of red blood cell development in Xenopus. Development. 2000;127:2031–2040. doi: 10.1242/dev.127.10.2031. [DOI] [PubMed] [Google Scholar]
  11. Durocher D, Charron F, Warren R, Schwartz RJ, Nemer M. The cardiac transcription factors Nkx2-5 and GATA-4 are mutual cofactors. EMBO J. 1997;16:5687–5696. doi: 10.1093/emboj/16.18.5687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fishman MC, Chien KR. Fashioning the vertebrate heart: earliest embryonic decisions. Development. 1997;124:2099–2117. doi: 10.1242/dev.124.11.2099. [DOI] [PubMed] [Google Scholar]
  13. Fox AH, Liew C, Holmes M, Kowalski K, Mackay J, Crossley M. Transcriptional cofactors of the FOG family interact with GATA proteins by means of multiple zinc fingers. EMBO J. 1999;18:2812–2822. doi: 10.1093/emboj/18.10.2812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Garg V, Kathiriya IS, Barnes R, Schluterman MK, King IN, Butler CA, Rothrock CR, Eapen RS, Hirayama-Yamada K, Joo K, Matsuoka R, Cohen JC, Srivastava D. GATA4 mutations cause human congenital heart defects and reveal an interaction with TBX5. Nature. 2003;424:443–447. doi: 10.1038/nature01827. [DOI] [PubMed] [Google Scholar]
  15. Garrity DM, Childs S, Fishman MC. The heartstrings mutation in zebrafish causes heart/fin Tbx5 deficiency syndrome. Development. 2002;129:4635–4645. doi: 10.1242/dev.129.19.4635. [DOI] [PubMed] [Google Scholar]
  16. Heicklen-Klein A, McReynolds LJ, Evans T. Using the zebrafish model to study GATA transcription factors. Semin Cell Dev Biol. 2005;16:95–106. doi: 10.1016/j.semcdb.2004.10.004. [DOI] [PubMed] [Google Scholar]
  17. Hoegg S, Brinkmann H, Taylor JS, Meyer A. Phylogenetic timing of the fish-specific genome duplication correlates with the diversification of teleost fish. J Mol Evol. 2004;59:190–203. doi: 10.1007/s00239-004-2613-z. [DOI] [PubMed] [Google Scholar]
  18. Holmes M, Turner J, Fox A, Chisholm O, Crossley M, Chong B. hFOG-2, a novel zinc finger protein, binds the co-repressor mCtBP2 and modulates GATA-mediated activation. J Biol Chem. 1999;274:23491–23498. doi: 10.1074/jbc.274.33.23491. [DOI] [PubMed] [Google Scholar]
  19. Jia Y, Takimoto K. GATA and FOG2 transcription factors differentially regulate the promoter for Kv4.2 K(+) channel gene in cardiac myocytes and PC12 cells. Cardiovasc Res. 2003;60:278–287. doi: 10.1016/s0008-6363(03)00528-5. [DOI] [PubMed] [Google Scholar]
  20. Katz SG, Cantor AB, Orkin SH. Interaction between FOG-1 and the corepressor C-terminal binding protein is dispensable for normal erythropoiesis in vivo. Mol Cell Biol. 2002;22:3121–3128. doi: 10.1128/MCB.22.9.3121-3128.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Katz SG, Williams A, Yang J, Fujiwara Y, Tsang AP, Epstein JA, Orkin SH. Endothelial lineage-mediated loss of the GATA cofactor Friend of GATA 1 impairs cardiac development. Proc Natl Acad Sci U S A. 2003;100:14030–14035. doi: 10.1073/pnas.1936250100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn. 1995;203:253–310. doi: 10.1002/aja.1002030302. [DOI] [PubMed] [Google Scholar]
  23. Letting DL, Chen YY, Rakowski C, Reedy S, Blobel GA. Context-dependent regulation of GATA-1 by friend of GATA-1. Proc Natl Acad Sci U S A. 2004;101:476–481. doi: 10.1073/pnas.0306315101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lin AC, Roche AE, Wilk J, Svensson EC. The N-termini of FOG proteins define a novel transcriptional repression motif and a superfamily of transcriptional repressors. J Biol Chem. 2004;279:55017–55023. doi: 10.1074/jbc.M411240200. [DOI] [PubMed] [Google Scholar]
  25. Lu JR, McKinsey TA, Xu H, Wang DZ, Richardson JA, Olson EN. FOG-2, a heart- and brain-enriched cofactor for GATA transcription factors. Mol Cell Biol. 1999;19:4495–4502. doi: 10.1128/mcb.19.6.4495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Mehaffey MG, Newton AL, Gandhi MJ, Crossley M, Drachman JG. X-linked thrombocytopenia caused by a novel mutation of GATA-1. Blood. 2001;98:2681–2688. doi: 10.1182/blood.v98.9.2681. [DOI] [PubMed] [Google Scholar]
  27. Molkentin JD. The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression. J Biol Chem. 2000;275:38949–38952. doi: 10.1074/jbc.R000029200. [DOI] [PubMed] [Google Scholar]
  28. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson EN. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 1998;93:215–228. doi: 10.1016/s0092-8674(00)81573-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Morin S, Charron F, Robitaille L, Nemer M. GATA-dependent recruitment of MEF2 proteins to target promoters. EMBO J. 2000;19:2046–2055. doi: 10.1093/emboj/19.9.2046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nesbit MA, Bowl MR, Harding B, Ali A, Ayala A, Crowe C, Dobbie A, Hampson G, Holdaway I, Levine MA, McWilliams R, Rigden S, Sampson J, Williams AJ, Thakker RV. Characterization of GATA3 mutations in the hypoparathyroidism, deafness, and renal dysplasia (HDR) syndrome. J Biol Chem. 2004;279:22624–22634. doi: 10.1074/jbc.M401797200. [DOI] [PubMed] [Google Scholar]
  31. Nichols KE, Crispino JD, Poncz M, White JG, Orkin SH, Maris JM, Weiss MJ. Familial dyserythropoietic anaemia and thrombocytopenia due to an inherited mutation in GATA1. Nat Genet. 2000;24:266–270. doi: 10.1038/73480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Oates AC, Ho RK. Hairy/E(spl)-related (Her) genes are central components of the segmentation oscillator and display redundancy with the Delta/Notch signaling pathway in the formation of anterior segmental boundaries in the zebrafish. Development. 2002;129:2929–2946. doi: 10.1242/dev.129.12.2929. [DOI] [PubMed] [Google Scholar]
  33. Pikkarainen S, Tokola H, Kerkela R, Ruskoaho H. GATA transcription factors in the developing and adult heart. Cardiovasc Res. 2004;63:196–207. doi: 10.1016/j.cardiores.2004.03.025. [DOI] [PubMed] [Google Scholar]
  34. Pizzuti A, Sarkozy A, Newton AL, Conti E, Flex E, Digilio MC, Amati F, Gianni D, Tandoi C, Marino B, Crossley M, Dallapiccola B. Mutations of ZFPM2/FOG2 gene in sporadic cases of tetralogy of Fallot. Hum Mutat. 2003;22:372–377. doi: 10.1002/humu.10261. [DOI] [PubMed] [Google Scholar]
  35. Sorrentino RP, Gajewski KM, Schulz RA. GATA factors in Drosophila heart and blood cell development. Semin Cell Dev Biol. 2005;16:107–116. doi: 10.1016/j.semcdb.2004.10.005. [DOI] [PubMed] [Google Scholar]
  36. Svensson EC, Tufts RL, Polk CE, Leiden JM. Molecular cloning of FOG-2: a modulator of transcription factor GATA-4 in cardiomyocytes. Proc Natl Acad Sci U S A. 1999;96:956–961. doi: 10.1073/pnas.96.3.956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Svensson EC, Huggins GS, Dardik FB, Polk CE, Leiden JM. A functionally conserved N-terminal domain of the friend of GATA-2 (FOG-2) protein represses GATA4-dependent transcription. J Biol Chem. 2000a;275:20762–20769. doi: 10.1074/jbc.M001522200. [DOI] [PubMed] [Google Scholar]
  38. Svensson EC, Huggins GS, Lin H, Clendenin C, Jiang F, Tufts R, Dardik FB, Leiden JM. A syndrome of tricuspid atresia in mice with a targeted mutation of the gene encoding Fog-2. Nat Genet. 2000b;25:353–356. doi: 10.1038/77146. [DOI] [PubMed] [Google Scholar]
  39. Szeto DP, Griffin KJ, Kimelman D. HrT is required for cardiovascular development in zebrafish. Development. 2002;129:5093–5101. doi: 10.1242/dev.129.21.5093. [DOI] [PubMed] [Google Scholar]
  40. Tevosian SG, Deconinck AE, Cantor AB, Rieff HI, Fujiwara Y, Corfas G, Orkin SH. FOG-2: A novel GATA-family cofactor related to multitype zinc-finger proteins Friend of GATA-1 and U-shaped. Proc Natl Acad Sci U S A. 1999;96:950–955. doi: 10.1073/pnas.96.3.950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tevosian SG, Deconinck AE, Tanaka M, Schinke M, Litovsky SH, Izumo S, Fujiwara Y, Orkin SH. FOG-2, a cofactor for GATA transcription factors, is essential for heart morphogenesis and development of coronary vessels from epicardium. Cell. 2000;101:729–739. doi: 10.1016/s0092-8674(00)80885-5. [DOI] [PubMed] [Google Scholar]
  42. Tsang AP, Visvader JE, Turner CA, Fujiwara Y, Yu C, Weiss MJ, Crossley M, Orkin SH. FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell. 1997;90:109–119. doi: 10.1016/s0092-8674(00)80318-9. [DOI] [PubMed] [Google Scholar]
  43. Tsang AP, Fujiwara Y, Hom DB, Orkin SH. Failure of megakaryopoiesis and arrested erythropoiesis in mice lacking the GATA-1 transcriptional cofactor FOG. Genes Dev. 1998;12:1176–1188. doi: 10.1101/gad.12.8.1176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Turner J, Crossley M. Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. EMBO J. 1998;17:5129–5140. doi: 10.1093/emboj/17.17.5129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Van Esch H, Groenen P, Nesbit MA, Schuffenhauer S, Lichtner P, Vanderlinden G, Harding B, Beetz R, Bilous RW, Holdaway I, Shaw NJ, Fryns JP, Van de Ven W, Thakker RV, Devriendt K. GATA3 haplo-insufficiency causes human HDR syndrome. Nature. 2000;406:419–422. doi: 10.1038/35019088. [DOI] [PubMed] [Google Scholar]

RESOURCES