Abstract
Protein tyrosine phosphatase non-receptor type 22 (PTPN22) is the third major locus affecting risk of type I diabetes (T1D), after HLA-DR/DQ and INS. The most associated single-nucleotide polymorphism (SNP), rs2476601, has a C->T variant and results in an arginine (R) to tryptophan (W) amino acid change at position 620. To assess whether this, or other specific variants, are responsible for T1D risk, the Type I Diabetes Genetics Consortium analyzed 28 PTPN22 SNPs in 2295 affected sib-pair (ASP) families. Transmission Disequilibrium Test analyses of haplotypes revealed that all three haplotypes with a T allele at rs2476601 were overtransmitted to affected children, and two of these three haplotypes showed statistically significant overtransmission (P=0.003 to P=5.9E-12). Another haplotype had decreased transmission to affected children (P=3.5E-05). All haplotypes containing the rs2476601 T allele were identical for all SNPs across PTPN22 and only varied at centromeric SNPs. When considering rs2476601 ‘C’ founder chromosomes, a second haplotype (AGGGGC) centromeric of PTPN22 in the C1orf178 region was associated with protection from T1D (odds ratio=0.81, P=0.0005). This novel finding requires replication in independent populations. We conclude the major association of PTPN22 with T1D is likely due to the recognized non-synonymous SNP rs2476601 (R620W).
Keywords: PTPN22, haplotypes, type I diabetes, T1DGC
Introduction
Protein tyrosine phosphatase non-receptor type 22 (PTPN22) is the third major locus recognized to affect type I diabetes (T1D) risk, after HLA-DR/DQ and the insulin gene (INS).1,2 The lymphoid-specific phosphatase (LYP) encoded by the PTPN22 gene on chromosome 1p13 is an excellent candidate for T1D because it is involved in down-regulating T-cell activation.3 A single-nucleotide polymorphism (SNP, rs2476601, C→T) results in a substitution of arginine (R) by tryptophan (W) residue at LYP codon 620 (R620W) with the tryptophan variant showing greater inhibition of T-cell receptor signaling.1,4 Of note, this ‘gain of function’ tryptophan variant is associated with T1D risk.
Although the minor allele frequency (MAF) of rs2476601 varies widely across ethnic groups, the association of R620W with T1D has been confirmed in several populations.5-9 In a haplotype-based analysis of the PTPN22 locus, the 1858T risk allele (rs2476601) occurred on a single haplotype that was strongly associated with T1D.10,11 Although R620W is a functional variant, it also maps to an extended linkage disequilibrium (LD) block containing numerous polymorphisms, raising the possibility that other potential functional variants could be responsible for the association with T1D.8
The PTPN22 rs2476601 SNP is also known to be associated with risk of other autoimmune disorders, including Graves’ disease,5,12 rheumatoid arthritis,13 and systemic lupus erythematosus.14 The 1858T variant has recently been reported to affect the progression from preclinical to clinical diabetes in ICA+ individuals15 and to confer an additive effect on GAD positivity,16 further supporting an early and general function for this variant in autoimmunity.
The Type I Diabetes Genetics Consortium (T1DGC) genotyped 2295 affected sib-pair (ASP) families for 28 SNPs across the PTPN22 region on two genotyping platforms (Illumina and Sequenom). This collection of ASP families and genotyping provides a basis to assess which specific PTPN22 SNPs and haplotypes are associated with T1D risk.
Results
Transmission Disequilibrium Test (TDT) analyses showed that 17 out of the 26 Illumina-typed SNPs were significantly associated with T1D. The PTPN22 SNP rs2476601 had the most strong association with T1D, resulting in a relative risk of 1.55 (P=5.5E-17) (Figure 1a). TDT analyses using haplotypes of all 27 SNPs (26 Illumina SNPs and 1 Sequenom SNP not typed in Illumina) provided a total of 25 haplotypes with frequency >0.1% (Table 1). All three haplotypes with a T allele at rs2476601 were overtransmitted (57–85%, compared with the expected of 50%). Further, 2 of these 3 haplotypes were significantly overtransmitted to affected children (P=0.003 to P=5.9E-12). Another haplotype had decreased transmission to affected children (P=3.5E-05). All T-allele haplotypes were identical for all SNPs across the PTPN22 gene and only varied centromeric of PTPN22 in the C1orf178 (chromosome 1 open reading frame 178) region. Indeed, the LD plot of this region exhibits strong LD for multiple SNPs, with evidence for two haplotype blocks (Figure 1b). The first haplotype block includes the telomeric region with the RSBN1 (round spermatid basic protein 1) and PTPN22 genes and the second haplotype block includes the centromeric region with C1orf178. A chromosomal map of the 28 SNPs in and near PTPN22 gene is shown in Figure 1c.
Figure 1.
(a) TDT analyses of the 26 Illumina SNPs. Es2476601 is in black, all other SNPs are in grey. (b) LD plot showing strong LD across the complete region for multiple SNPs (Illumina SNPs). The arrow points to rs2476601 (SNP number 9). (c) Chromosomal map of the 28 SNPs in and near the PTPN22 gene. Arrow shows the PTPN22 gene. Rs2476601 is in bold. Squares denote exons and triangles show SNPs.
Table 1.
TDT of haplotypes with frequencies ≥0.1% (N=2280 families)
| Haplotype | Frequency | Transmission | % Transmission | Untransmission | % Untransmission | P-value |
|---|---|---|---|---|---|---|
| AAATCGTTCAGGGCGGGCGGCAGGGGC | 0.243 | 827 | 44.9 | 1015 | 55.1 | 3.50E-05 |
| AAATTGTCCGGGGTGGGCCGCATGAAT | 0.201 | 773 | 48.6 | 818 | 51.4 | 0.293 |
| GAGGTATTCAAAACTGCTCGCCGGAAC | 0.157 | 682 | 50.0 | 681 | 50.0 | 1 |
| AAGGTACTTAGGACGCCTCATCGAAAC | 0.1275 | 685 | 60.6 | 446 | 39.4 | 5.93E-12 |
| AAGGTACTCAGGACGCCTCATCGAAAC | 0.0525 | 244 | 49.2 | 252 | 50.8 | 0.750 |
| AAGGTACTCAGGACGCCTCATATGAAT | 0.0305 | 147 | 49.8 | 148 | 50.2 | 1 |
| AAGGTACTCAGGACGCCTCATAGGGGC | 0.029 | 145 | 48.0 | 157 | 52.0 | 0.523 |
| AGATTGTCCGGGGTGGGCCGCATGAAT | 0.0275 | 145 | 53.1 | 128 | 46.9 | 0.329 |
| AAGGTACTCAGGACGGCTCATCGAAAC | 0.02 | 92 | 49.5 | 94 | 50.5 | 0.941 |
| AAATTGTCCAGGGTGGGCCGCATGAAT | 0.0145 | 71 | 48.3 | 76 | 51.7 | 0.740 |
| AAGGTACTTAGGACGCCTCATCGGAAC | 0.014 | 76 | 57.1 | 57 | 42.9 | 0.117 |
| AAATCGTTCAGGGCGGGCGGCATGAAT | 0.011 | 58 | 49.2 | 60 | 50.8 | 0.926 |
| AAGGTACTCAGGACGGGCGGCAGGGGC | 0.0105 | 52 | 46.4 | 60 | 53.6 | 0.507 |
| GAGGTATTCAAAACTGCTCGCATGAAT | 0.007 | 34 | 47.9 | 37 | 52.1 | 0.812 |
| GAGGTATTCAAAACTGCTCGCAGGGGC | 0.007 | 29 | 43.9 | 37 | 56.1 | 0.388 |
| AAATCGTTCAGGGCGGGCGGCCGAAAC | 0.0065 | 29 | 50.9 | 28 | 49.1 | 1 |
| GAATCGTTCAGGGCGGGCGGCAGGGGC | 0.005 | 25 | 43.1 | 33 | 56.9 | 0.357 |
| AAATCGTTCAGGGCGGGCGGCCGGAAC | 0.004 | 24 | 53.3 | 21 | 46.7 | 0.766 |
| AAGGTATTCAAAACTGCTCGCCGGAAC | 0.004 | 17 | 45.9 | 20 | 54.1 | 0.743 |
| GAGGTATTCAAAATGGGCCGCATGAAT | 0.004 | 16 | 45.7 | 19 | 54.3 | 0.736 |
| AAATTGTCCGGGGTGGGCCGCCGAAAC | 0.003 | 17 | 48.6 | 18 | 51.4 | 1 |
| GAGGTATTCAAAACTGCTCGCCGAAAC | 0.002 | 11 | 39.3 | 17 | 60.7 | 0.345 |
| AAGGTACTTAGGACGCCTCATATGAAT | 0.002 | 17 | 85.0 | 3 | 15.0 | 0.003 |
| AAATTGTCCGGGGTGGGCCGCAGGGGC | 0.002 | 6 | 42.9 | 8 | 57.1 | 0.790 |
| GAGGTACTCAAAACTGCTCGCCGGAAC | 0.001 | 14 | 77.8 | 4 | 22.2 | 0.031 |
| ↑rs2476601 |
Abbreviations: SNP, single-nucleotide polymorphism; TDT, Transmission Disequilibrium Test.
The three haplotypes with a T allele at rs2476601 are highlighted in bold for the SNPs that are identical across the PTPN22 gene. The arrow points to rs2476601 (SNP number 9).
Allele frequencies of case and control founder chromosomes (N=8598) from the 26 Illumina SNPs are shown in Table 2. To explore the possibility of other PTPN22 SNPs in addition to rs2476601 having an association with T1D, stratified analyses by rs2476601were performed. Additional analyses included using all SNPs in a logistic regression model. Using only PTPN22 rs2476601 ‘C allele’ founder chromosomes (N=6095), the haplotype AGGGGC, centromeric of PTPN22 in the C1orf178 region, was significantly associated with protection from T1D (odds ratio (OR)=0.81, 95% confidence interval (CI)=0.72–0.91, P=0.0005). Another haplotype, CGAAAC in the C1orf178 region, was associated with susceptibility to T1D (OR=1.24, 95% CI=1.02–1.51, P=0.03) (Table 3). For PTPN22 rs2476601 ‘T allele’ founder chromosomes, the LD was almost complete, such that there was minimal effect of other SNPs. Logistic regression analyses in founder chromosomes revealed that only rs2476601 was associated with susceptibility to T1D (OR=1.27), 95% CI=1.15–1.41, P<0.0001 whereas three centromeric SNPs (rs7524200, rs1217423, and rs1539438) had evidence for protection (OR=0.11–0.30, 95% CI=0.01–0.95, P=0.03–0.04).
Table 2.
Allele frequencies of case and control chromosomes for the 26 Illumina SNPs (N=8598)
| SNP | Genotype | MA | CaseMA | CaseMAF | ControlMA | ControlMAF | OR | 95% CI | P-value |
|---|---|---|---|---|---|---|---|---|---|
| rs3827733 | AG | G | 1019 | 16.8 | 378 | 17.9 | 0.93 | 0.81–1.06 | 0.25 |
| rs3789602 | AG | G | 180 | 2.8 | 50 | 2.3 | 1.24 | 0.9–1.7 | 0.19 |
| rs1217379 | AG | G | 2876 | 49.3 | 869 | 42.5 | 1.32 | 1.19–1.46 | 1.31E-07 |
| rs6537798 | GT | G | 2884 | 49.3 | 873 | 42.5 | 1.32 | 1.19–1.46 | 1.21E-07 |
| rs3789607 | CT | C | 1434 | 23.9 | 642 | 30.8 | 0.71 | 0.63–0.79 | 1.14E-09 |
| rs2476600 | AG | A | 2887 | 49.2 | 875 | 42.5 | 1.31 | 1.19–1.45 | 1.43E-07 |
| rs1217395 | CT | C | 1682 | 29.4 | 467 | 23.6 | 1.35 | 1.2–1.52 | 1.00E-06 |
| rs1970559 | CT | C | 1442 | 23.7 | 530 | 25.1 | 0.93 | 0.83–1.04 | 0.21 |
| rs2476601 | CT | T | 910 | 14.7 | 195 | 9.1 | 1.74 | 1.47–2.04 | 5.72E-12 |
| rs1775759 | AG | G | 1265 | 21.6 | 459 | 23.0 | 0.92 | 0.82–1.04 | 0.20 |
| rs3765598 | AG | A | 1015 | 16.7 | 377 | 17.8 | 0.93 | 0.81–1.05 | 0.24 |
| rs1217418 | AG | A | 2894 | 49.4 | 877 | 42.6 | 1.31 | 1.19–1.45 | 1.25E-07 |
| rs1217414 | CT | T | 1452 | 23.9 | 537 | 25.4 | 0.92 | 0.82–1.03 | 0.17 |
| rs17510162 | GT | T | 1019 | 16.7 | 376 | 17.7 | 0.94 | 0.82–1.06 | 0.31 |
| rs2488457 | CG | C | 1523 | 25.5 | 423 | 20.1 | 1.36 | 1.21–1.54 | 4.60E-07 |
| rs1235005 | CG | C | 2802 | 47.8 | 851 | 41.4 | 1.3 | 1.17–1.44 | 4.67E-07 |
| rs6665194 | CT | T | 2803 | 47.9 | 849 | 41.4 | 1.3 | 1.17–1.44 | 3.96E-07 |
| rs1217384 | CG | G | 1515 | 25.1 | 665 | 31.5 | 0.73 | 0.65–0.81 | 1.77E-08 |
| rs12566340 | AG | A | 1659 | 27.9 | 467 | 22.3 | 1.35 | 1.2–1.52 | 3.96E-07 |
| rs7529353 | CT | T | 1670 | 28.1 | 469 | 22.4 | 1.36 | 1.21–1.53 | 2.62E-07 |
| rs7524200 | AC | C | 2428 | 41.1 | 722 | 34.7 | 1.31 | 1.18–1.45 | 3.58E-07 |
| rs1217423 | GT | T | 1716 | 28.5 | 623 | 29.6 | 0.95 | 0.85–1.06 | 0.37 |
| rs2358994 | AG | A | 1280 | 21.2 | 346 | 16.3 | 1.38 | 1.21–1.58 | 1.00E-06 |
| rs1539438 | AG | G | 1590 | 26.6 | 709 | 33.8 | 0.71 | 0.64–0.79 | 5.82E-10 |
| rs1217394 | AG | G | 1615 | 26.9 | 717 | 34.0 | 0.71 | 0.64–0.79 | 7.19E-10 |
| rs1217393 | CT | T | 1676 | 28.3 | 600 | 29.1 | 0.96 | 0.86–1.07 | 0.50 |
Abbreviations: MA, count of minor allele; MAF, minor allele frequency; OR, odds ratio; SNP, single-nucleotide polymorphism.
P-values <0.05 are indicated in bold.
Table 3.
rs2476601 ‘C’ founder chromosomes (N=6095): decreased risk from haplotype AGGGGC in block 2
| Haplotype |
Case (N=4399) |
Control (N=1696) |
P-value | OR | 95% CI |
|---|---|---|---|---|---|
| ATGAAT | 1557 (35.4%) | 568 (33.5%) | 0.17 | 1.09 | 0.97–1.23 |
| AGGGGC | 1486 (33.8%) | 654 (38.6%) | 0.0005 | 0.81 | 0.72–0.91 |
| CGAAAC | 455 (10.3%) | 144 (8.5%) | 0.03 | 1.24 | 1.02–1.51 |
| CGGAAC | 901 (20.5%) | 330 (19.4%) | 0.39 | 1.07 | 0.93–1.23 |
Stratified analyses by rs2476601 looking at only rs2476601 ‘C’ founder chromosomes (N=6095).
The order of the SNPs in the haplotypes is the following: rs7524200, rs1217423, rs2358994, rs1539438, rs1217394, rs1217393.
P-values <0.05 are indicated in bold.
The PTPN22 rs2488457 SNP has been earlier associated with T1D. Stratified analyses by rs2476601 did not show an independent association of rs2488457 with T1D risk. For rs2476601 ‘C allele’ founder chromosomes, the MAF (C allele) for rs2488457 was 12.3% in T1D cases and 12% in non-cases, whereas for rs2476601 ‘T-allele’ chromosomes, the MAF for rs2488457 was 98.9% in cases and 100% in non-cases.
Analyses performed only in probands indicated that the PTPN22 T/T and C/T genotypes occurred more frequently in cases without the HLA DR3/4-DQ8 genotype than in cases carrying the high-risk HLA DR3/4-DQ8 genotype. Frequencies for the T/T genotype were 3.6% in HLA non-DR3/4-DQ8 cases and 3.2% in HLA DR3/4-DQ8 cases. Similarly, the frequencies for the C/T genotype were 29.9% in HLA non-DR3/4-DQ8 cases and 22.5% in HLA DR3/4-DQ8 cases (P=0.001).
Discussion
Despite consistent association observed between the PTPN22 1858C/T polymorphism (R620W) and T1D risk in multiple populations, it is difficult to absolutely define the etiologic polymorphism because of strong LD. To address this question, the coding region of the PTPN22 gene has been sequenced and several novel variants identified.10 Haplotype analyses suggested that the 1858T risk allele is contained in only one haplotype, which was strongly associated with T1D. After controlling for this haplotype, two other haplotypes were weakly associated with T1D, suggesting that the 1858 SNP or a SNP in strong LD with the 1858 SNP may be responsible for the observed association.
In Asians, the 1858T allele has not been observed.6,17 Through extensive sequencing of the PTPN22 coding and regulatory regions, a number of other SNPs have been identified.11,17 A regulatory SNP (−1123G/C; rs2488457) was shown to be weakly associated with T1D in Japanese and Koreans,17 but it was not associated with disease in Sardinians.11 Recently, 46 SNPs were genotyped in the PTPN22 region in 3000 T1D cases and 2400 controls.18 In this population, it was concluded that no other PTPN22 SNP was associated with T1D independent of rs2476601. Thus, rs2476601 remains the best candidate as the causal variant in this chromosome region in European populations.
In this T1DGC dataset, we found that all three haplotypes having a T allele at rs2476601 were overtransmitted (57–85%) to affected children. Two of these haplotypes had significant overtransmission (P=0.003 to P=5.9E-12), whereas another haplotype (with ‘AGGGGC’ in the C1orf178 region) was protective. These data are consistent with the possibility that the observed association of PTPN22 with T1D risk may be due to the non-synonymous SNP, rs2476601, as haplotypes bearing the T allele at this SNP are overtransmitted. However, in this data set, all of these haplotypes have identical SNP genotypes across the PTPN22 gene (due to strong LD). Thus, it remains possible that other SNPs may be responsible for the association with T1D. Among chromosomes with the low risk 1858C allele, a second haplotype in the C1orf178 region centromeric of PTPN22 (AGGGGC) exhibits a strong association with T1D, with decreased transmission to patients. This finding requires replication in independent populations.
In these T1DGC ASP families, the PTPN22 rs2476601 T/T and C/T genotypes were significantly more frequent in T1D cases carrying lower risk HLA genotypes (that is without the HLA-DR3/4-DQ8 genotype), a finding that is consistent with a recent study.18 The PTPN22 rs2476601 SNP results in a missense mutation that changes an arginine (R) at position 620 to a tryptophan (W) and abrogates the ability of the molecule to bind to the signaling molecule Csk (c-Src tyrosine kinase).1,3 The lyp-Csk complex down-regulates T-cell receptor signaling, and the T1D-associated variant is reported to result in greater inhibition of T-cell receptor signaling.4,19,20 Consistent with an early and general effect on immune function is the finding that the minor tryptophan-encoding allele is associated with a series of autoimmune disorders, including rheumatoid arthritis, systemic lupus erythematosus, autoimmune thyroid disease (either Hashimoto thyroiditis or Graves’ disease), and T1D with an overall OR for the T allele between 1.5 and 1.9.21 Others have shown that rs2476601 regulates T1D-specific autoimmunity and strongly affects the progression from preclinical to clinical diabetes in ICA positive individuals.15
The association of PTPN22 with T1D is likely due to the non-synonymous SNP rs2476601. All haplotypes with a T allele at this SNP have identical alleles for all SNPs telomeric and across the PTPN22 gene. For haplotypes with the C allele at rs2476601, we provide initial evidence for an additional locus influencing T1D.
Materials and methods
Study population
The T1DGC has created a resource base of well-characterized families from multiple ethnic groups to facilitate the localization and characterization of T1D susceptibility genes (http://www.t1dgc.org). Genotyping for the Rapid Response project was performed on 2295 families in nine cohorts. SNPs in 21 candidate genes were genotyped on two platforms (Illumina and Sequenom). Details of the sample, quality control, and other aspects of the data can be found in this volume (Brown et al.22).
The families selected for these analyses consisted mainly of nuclear families with an ASP. This study reports the results for the 28 SNPs genotyped across the PTPN22 region in 9251 individuals, including 5580 children (4445 (80%) affected, 840 (15%) unaffected, 295 (5%) unknown status) and 3671 parents (157 (4%) affected, 2576 (70%) unaffected, 938 (26%) unknown status). There was no significant difference by sex (male/female=49.4%). The average age of onset of T1D for cases was 11.5 years (range, 0–71 years) with an average duration of disease of 13 years (range, 0–63 years). The families used in this study were collected from the following T1DGC networks and contributing sites: 9% Asia-Pacific, 29% European, 35% North American, and 27% UK/Sardinian. The majority of the subjects were Caucasian (81%) with 18% unknown ethnicity and 1% other (Asian, African American, Pacific Islander).
Genotyping
The T1DGC has genotyped 2295 ASP families for 28 SNPs across the PTPN22 region using both Illumina and Sequenom platforms. A total of 26 SNPs were genotyped by Illumina GoldenGate technology, whereas 25 SNPs were genotyped by Sequenom MALDI-TOF technology, for a total of 23 SNPs genotyped on both platforms. The call rate for all SNPs in both platforms was complete (>97% call rate except for 3 SNPs which had a slightly lower call rate of 93–96%) and concordant between the two platforms (>98% concordance except for 1 SNP which had a 96% concordance rate). All SNPs were in Hardy–Weinberg equilibrium except for one SNP (rs1746860) from the Sequenom platform, which was therefore excluded from all analyses. Of the 28 SNPs, 11 are in the PTPN22 gene, including the non-synonymous R620W SNP, and 9 are in known neighboring genes, including 4 in the RSBN1 gene and 5 in the C1orf178 which encodes Bfk, a B-cell lymphoma 2 (BCL2) family member (BFK) with some proapoptotic effects that is expressed in both spleen and thymus (Figure 1c).23
Statistical analysis
Data quality checks, using standard methods including the PedCheck program, and TDT for individual SNPs using the UNPHASED software (v 2.40). were performed by the Coordinating Center of the T1DGC. The LD plot and TDT analyses for the haplotypes were computed using Haploview software (http://www.broad.mit.edu/mpg/haploview).24 For the TDT haplotype analyses, we converted the families to trios, by including parents and one single, randomly chosen offspring. We repeated TDT analyses with the second affected offspring to account for the transmissions to the other affected sibling and combined both datasets for analyses.
Merlin software (http://www.sph.umich.edu/csg/abecasis/Merlin)25 was used to phase the SNP genotype data from families into haplotypes. AFBAC (affected family-based control) methodology was used to assign case or control status to chromosomes,26 using a VBA (Visual Basic for Applications) program developed in-house. SAS software version 9.1 (http://www.SAS.com) was used to perform logistic regression analysis. Results were considered significant at α<0.05 without adjustments for multiple comparisons.
Acknowledgements
This research uses resources provided by the Type I Diabetes Genetics Consortium, a collaborative clinical study sponsored by the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), National Institute of Allergy and Infectious Diseases (NIAID), National Human Genome Research Institute (NHGRI), National Institute of Child Health and Human Development (NICHD), and Juvenile Diabetes Research Foundation International (JDRF) and supported by U01 DK062418. Genotyping was performed at the Broad Institute Center for Genotyping and Analysis is supported by grant U54 RR020278 from the National Center for Research Resources. BOB was support by the German Research Foundation (DFG: SFB 518 & GrK 1041).
Footnotes
Conflict of interest
N Bottini is co-inventor on a patent application (PCT/US05/24862) entitled ‘Functional Variant of Lymphoid Tyrosine Phosphatase is Associated with Autoimmune Disorders’. The remaining authors declare no conflict of interest.
References
- 1.Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, Rostamkhani M, et al. A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes. Nat Genet. 2004;36:337–338. doi: 10.1038/ng1323. [DOI] [PubMed] [Google Scholar]
- 2.Wellcome Trust Case Control Consortium Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. 2007;447:661–678. doi: 10.1038/nature05911. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cloutier JF, Veillette A. Cooperative inhibition of T-cell antigen receptor signaling by a complex between a kinase and a phosphatase. J Exp Med. 1999;189:111–121. doi: 10.1084/jem.189.1.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Vang T, Congia M, Macis MD, Musumeci L, Orru V, Zavattari P, et al. Autoimmune-associated lymphoid tyrosine phosphatase is a gain-of-function variant. Nat Genet. 2005;37:1317–1319. doi: 10.1038/ng1673. [DOI] [PubMed] [Google Scholar]
- 5.Smyth D, Cooper JD, Collins JE, Heward JM, Franklyn JA, Howson JM, et al. Replication of an association between the lymphoid tyrosine phosphatase locus (LYP/PTPN22) with type 1 diabetes, and evidence for its role as a general autoimmunity locus. Diabetes. 2004;53:3020–3023. doi: 10.2337/diabetes.53.11.3020. [DOI] [PubMed] [Google Scholar]
- 6.Zheng W, She JX. Genetic association between a lymphoid tyrosine phosphatase (PTPN22) and type 1 diabetes. Diabetes. 2005;54:906–908. doi: 10.2337/diabetes.54.3.906. [DOI] [PubMed] [Google Scholar]
- 7.Ladner MB, Bottini N, Valdes AM, Noble JA. Association of the single nucleotide polymorphism C1858T of the PTPN22 gene with type 1 diabetes. Hum Immunol. 2005;66:60–64. doi: 10.1016/j.humimm.2004.09.016. [DOI] [PubMed] [Google Scholar]
- 8.Qu H, Tessier MC, Hudson TJ, Polychronakos C. Confirmation of the association of the R620W polymorphism in the protein tyrosine phosphatase PTPN22 with type 1 diabetes in a family based study. J Med Genet. 2005;42:266–270. doi: 10.1136/jmg.2004.026971. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Steck AK, Liu SY, McFann K, Barriga KJ, Babu SR, Eisenbarth GS, et al. Association of the PTPN22/LYP gene with type 1 diabetes. Pediatr Diabetes. 2006;7:274–278. doi: 10.1111/j.1399-5448.2006.00202.x. [DOI] [PubMed] [Google Scholar]
- 10.Onengut-Gumuscu S, Buckner JH, Concannon P. A haplotype-based analysis of the PTPN22 locus in type 1 diabetes. Diabetes. 2006;55:2883–2889. doi: 10.2337/db06-0225. [DOI] [PubMed] [Google Scholar]
- 11.Zoledziewska M, Perra C, Orru V, Moi L, Frongia P, Congia M, et al. Further evidence of a primary, causal association of the PTPN22 620W variant with type 1 diabetes. Diabetes. 2008;57:229–234. doi: 10.2337/db07-0289. [DOI] [PubMed] [Google Scholar]
- 12.Velaga MR, Wilson V, Jennings CE, Owen CJ, Herington S, Donaldson PT, et al. The codon 620 tryptophan allele of the lymphoid tyrosine phosphatase (LYP) gene is a major determinant of Graves’ disease. J Clin Endocrinol Metab. 2004;89:5862–5865. doi: 10.1210/jc.2004-1108. [DOI] [PubMed] [Google Scholar]
- 13.Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, Chokkalingam AP, Alexander HC, et al. A missense single-nucleotide polymorphism in a gene encoding a protein tyrosine phosphatase (PTPN22) is associated with rheumatoid arthritis. Am J Hum Genet. 2004;75:330–337. doi: 10.1086/422827. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kyogoku C, Langefeld CD, Ortmann WA, Lee A, Selby S, Carlton VE, et al. Genetic association of the R620W polymorphism of protein tyrosine phosphatase PTPN22 with human SLE. Am J Hum Genet. 2004;75:504–507. doi: 10.1086/423790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hermann R, Lipponen K, Kiviniemi M, Kakko T, Veijola R, Simell O, et al. Lymphoid tyrosine phosphatase (LYP/PTPN22) Arg620Trp variant regulates insulin autoimmunity and progression to type 1 diabetes. Diabetologia. 2006;49:1198–1208. doi: 10.1007/s00125-006-0225-4. [DOI] [PubMed] [Google Scholar]
- 16.Chelala C, Duchatelet S, Joffret ML, Bergholdt R, Dubois-LaForgue D, Ghandil P, et al. PTPN22 R620W functional variant in type 1 diabetes and autoimmunity related traits. Diabetes. 2007;56:522–526. doi: 10.2337/db06-0942. [DOI] [PubMed] [Google Scholar]
- 17.Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, et al. Systematic search for single nucleotide polymorphisms in a lymphoid tyrosine phosphatase gene (PTPN22): association between a promoter polymorphism and type 1 diabetes in Asian populations. Am J Med Genet. 2006;140:586–593. doi: 10.1002/ajmg.a.31124. [DOI] [PubMed] [Google Scholar]
- 18.Smyth DJ, Cooper JD, Howson JM, Walker NM, Plagnol V, Stevens H, et al. PTPN22 Trp620 explains the association of chromosome 1p13 with type 1 diabetes and shows a statistical interaction with HLA class II genotypes. Diabetes. 2008;57:1730–1737. doi: 10.2337/db07-1131. [DOI] [PubMed] [Google Scholar]
- 19.Rieck M, Arechiga A, Onengut-Gumuscu S, Greenbaum C, Concannon P, Buckner JH. Genetic variation in PTPN22 corresponds to altered function of T and B lymphocytes. J Immunol. 2007;179:4704–4710. doi: 10.4049/jimmunol.179.7.4704. [DOI] [PubMed] [Google Scholar]
- 20.Aarnisalo J, Treszl A, Svec P, Marttila J, Oling V, Simell O, et al. Reduced CD4(+)T cell activation in children with type 1 diabetes carrying the PTPN22/Lyp 620Trp variant. J Autoimmun. 2008;31:13–21. doi: 10.1016/j.jaut.2008.01.001. [DOI] [PubMed] [Google Scholar]
- 21.Criswell LA, Pfeiffer KA, Lum RF, Gonzales B, Novitzke J, Kern M, et al. Analysis of families in the multiple autoimmune disease genetics consortium (MADGC) collection: the PTPN22 620W allele associates with multiple autoimmune phenotypes. Am J Hum Genet. 2005;76:561–571. doi: 10.1086/429096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Brown WM, Pierce JJ, Hilner JE, Perdue LH, Lohman K, Lu L, et al. Type I Diabetes Genetics Consortium Overview of the Rapid Response data. Genes Immun. 2009;10(Suppl 1):S5–S15. doi: 10.1038/gene.2009.85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Coultas L, Pellegrini M, Visvader JE, Lindeman GJ, Chen L, Adams JM, et al. Bfk: a novel weakly proapoptotic member of the Bcl-2 protein family with a BH3 and a BH2 region. Cell Death Differ. 2003;10:185–192. doi: 10.1038/sj.cdd.4401204. [DOI] [PubMed] [Google Scholar]
- 24.Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21:263–265. doi: 10.1093/bioinformatics/bth457. [DOI] [PubMed] [Google Scholar]
- 25.Abecasis GR, Cherny SS, Cookson WO, Cardon LR. Merlin-rapid analysis of dense genetic maps using sparse gene flow trees. Nat Genet. 2002;30:97–101. doi: 10.1038/ng786. [DOI] [PubMed] [Google Scholar]
- 26.Thomson G. Mapping disease genes: family-based association studies. Am J Hum Genet. 1995;57:487–498. [PMC free article] [PubMed] [Google Scholar]