Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2009 Dec 17;9:262. doi: 10.1186/1471-2180-9-262

Molecular and biochemical characterization of urease and survival of Yersinia enterocolitica biovar 1A in acidic pH in vitro

Neeru Bhagat 1, Jugsharan S Virdi 1,✉
PMCID: PMC2806259  PMID: 20017936

Abstract

Background

Yersinia enterocolitica, an important food- and water-borne enteric pathogen is represented by six biovars viz. 1A, 1B, 2, 3, 4 and 5. Despite the lack of recognized virulence determinants, some biovar 1A strains have been reported to produce disease symptoms resembling that produced by known pathogenic biovars (1B, 2-5). It is therefore imperative to identify determinants that might contribute to the pathogenicity of Y. enterocolitica biovar 1A strains. Y. enterocolitica invariably produces urease and the role of this enzyme in the virulence of biovar 1B and biovar 4 strains has been reported recently. The objective of this work was to study genetic organization of the urease (ure) gene complex of Y. enterocolitica biovar 1A, biochemical characterization of the urease, and the survival of these strains under acidic conditions in vitro.

Results

The ure gene complex (ureABCEFGD) of Y. enterocolitica biovar 1A included three structural and four accessory genes, which were contiguous and was flanked by a urea transport (yut) gene on the 3' side. Differences were identified in ure gene complex of biovar 1A strain compared to biovar 1B and 4 strains. This included a smaller ureB gene and larger intergenic regions between the structural genes. The crude urease preparation exhibited optimal pH and temperature of 5.5 and 65°C respectively, and Michaelis-Menten kinetics with a Km of 1.7 ± 0.4 mM urea and Vmax of 7.29 ± 0.42 μmol of ammonia released/min/mg protein. The urease activity was dependent on growth temperature and growth phase of Y. enterocolitica biovar 1A, and the presence of nickel in the medium. The molecular mass of the enzyme was > 545 kDa and an isoelectric point of 5.2. The number of viable Y. enterocolitica biovar 1A decreased significantly when incubated at pH 2.5 for 2 h. However, no such decrease was observed at this pH in the presence of urea.

Conclusions

The ure gene cluster of biovar 1A strains though similar to biovar 1B and 4 strains, exhibited important differences. The study also showed the ability of biovar 1A strains of Y. enterocolitica to survive at highly acidic pH in vitro in the presence of urea.

Background

Yersinia enterocolitica, an important food- and water-borne human enteropathogen is known to cause a variety of gastrointestinal problems. Most commonly, it causes acute diarrhea, terminal ileitis and mesenteric lymphadenitis [1]. Long-term sequelae following infection include reactive arthritis and erythema nodosum [1]. Blood transfusion associated septicemia due to Y. enterocolitica has been reported to have high mortality [2]. Currently, Y. enterocolitica is represented by six biovars (1A, 1B, 2, 3, 4 and 5) and more than 30 distinct serovars. The virulence of known pathogenic biovars namely 1B and 2-5 is attributed to pYV (plasmid for Yersinia virulence) plasmid [3] and chromosomally borne virulence factors [4].

The biovar 1A strains however lack pYV plasmid and have generally been regarded as avirulent. But several clinical, epidemiological and experimental evidences indicate their potential pathogenicity [5]. Some biovar 1A strains have been reported to produce disease symptoms resembling that produced by pathogenic biovars [6,7]. These have been implicated in nosocomial [8] and food-borne [9] outbreaks and isolated from extra-intestinal sites [10]. The biovar 1A strains also invade epithelial cells [11,12], resist killing by macrophages [13] and carry virulence-associated genes such as ystB (enterotoxin), inv (invasin), myfA (fimbriae), hreP (subtilisin/kexin-like protease) and tccC (insecticidal-toxin like complex) [5,14]. In the past, enterotoxin has been thought to be the only major virulence factor produced by biovar 1A strains. Recently insecticidal-toxin complex [15] and flagella [16] have been identified as virulence factors of Y. enterocolitica biovar 1A strains. However the exact mechanisms underlying the pathogenesis by biovar 1A strains remains unclear and there is need to investigate the role of other putative virulence factors.

Urease (urea amidohydrolase; EC 3.5.1.5) has been implicated to play a role in the pathogenesis of many bacteria such as Helicobacter pylori, Proteus mirabilis and Brucella abortus [17-19]. Y. enterocolitica invariably produces urease which has been reported to enable biovar 1B and biovar 4 strains to survive in the acidic environment of the stomach [20,21]. However, the role of urease in the survival of biovar 1A strains has not been investigated. The objective of this study was to determine the genetic organization of urease (ure) gene cluster, factors affecting urease activity, and the survival of biovar 1A strain of Y. enterocolitica in acidic pH in vitro.

Methods

Bacterial strains and growth conditions

Y. enterocolitica biovar 1A (serovar O:6,30) isolated from the stools of a diarrheic patient and deposited with Yersinia National Reference Laboratory and WHO Collaborating Center, Pasteur Institute (Paris) under reference number IP27403 was used to characterize ure gene complex and the enzyme urease. The details of other Y. enterocolitica strains used in this study namely serovars, source of isolation, country of origin, reference laboratory accession numbers and clonal groups have been reported previously [22]. Y. enterocolitica 8081 (bioserovar 1B/O:8) was obtained from M. Skurnik (Haartman Institute, Helsinki, Finland). Y. enterocolitica IP26329 (bioserovar 2/O:9), IP26249 (bioserovar 2/O:5,27), and IP134 (bioserovar 4/O:3) were obtained from E. Carniel (Yersinia National Reference Laboratory and WHO Collaborating Center, Pasteur Institute, France). All strains were grown overnight at 28°C in Luria broth (HiMedia, Mumbai, India).

DNA extraction, primers and Polymerase Chain Reaction

Genomic DNA was isolated from overnight grown cultures using DNeasy tissue kit (Qiagen GmbH) as reported earlier [14].

Urease gene sequences of Y. enterocolitica biovar 1B and biovar 4 with GenBank accession numbers L24101[23] and Z18865[24] respectively were used to design primers U1 and U2 using PrimerSelect 5.03 software (DNASTAR Inc., Madison, USA) such that the structural genes (ureA, ureB, ureC) may be amplified as one amplicon. As these primers failed to consistently amplify the ureABC region of biovar 1A strains, primers for amplification of each of the structural genes separately were designed from the following sequences in the database (accession numbers are given in parentheses): Y. enterocolitica biovar 1B (L24101, AM286415), Y. enterocolitica biovar 4 (Z18865), Y. aldovae (AY363680), Y. bercovieri (AY363681), Y. frederiksenii (AY363682), Y. intermedia (AY363683), Y. kristensenii (AY363684), Y. mollaretii (AY363685), Y. rohdei (AY363686), Y. pestis (AE017042, AL590842, AE009952, AF095636) and Y. pseudotuberculosis (U40842, BX936398). These sequences were also used to design primers for ure accessory (ureE, ureF, ureG, ureD) and urea transport (yut) genes. The most conserved regions for each of the genes were identified using MegAlign (DNASTAR) or ClustalW version 1.83 (accessible at http://www.ebi.ac.uk/tools/clustalW).

Primer pairs - ureA1-ureA2 (for ureA), ureB1-ureB2 (for ureB), ureC1-ureC2 (for ureC), ureCE1-ureCE2 (for ureC-ureE and ureE), ureF1-ureF2 (for ureF), ureG1-ureG2 (for ureG), ureD1-ureD2 (for ureD) and yut1-yut2 (for yut) were designed from the conserved regions (Fig. 1) with PrimerSelect software. The sequences of the amplicons thus obtained (with strain IP27403) were used subsequently to design primers for the intergenic regions and a remaining part of the ureC gene. The intergenic regions between ureA-ureB, ureB-ureC, ureE-ureF, ureF-ureG and ureD-yut were amplified using primer pairs - ureAB1-ureAB2, ureBC1-ureBC2, ureE1-ureE2, ureFG1-ureFG2 and ureD3-ureD4 respectively and part of ureC gene by ureC3-ureC4. As ureD could not be amplified in biovar 1A strain with ureD1-ureD2, another primer pair ureG1-ureD2 was used for amplification of the ureG-ureD intergenic region and ureD gene. The primers were synthesized from Microsynth or Sigma Genosys. The details of the PCR primers and the target genes are given in Table 1.

Figure 1.

Figure 1

Organization of ure gene cluster of Y. enterocolitica biovar 1A. Primers used for amplification of structural and accessory genes, and the intergenic regions thereof are indicated.

Table 1.

PCR amplification of urease structural (ureA, ureB, ureC) and the accessory (ureE, ureF, ureG, ureD) genes and the intergenic regions thereof, in Y. enterocolitica biovar 1A strain.

Primer Sequence (5' - 3') Target Accession no. Region amplified Amplicon length (bp) PCR conditions (°C, s)*

Den Ann Ext
U1
U2
GCAGCCGTTTGGTCACGG
CTATGCCACGCATCCCGACC
ureA-ureC DQ350880
AM286415
Z18865
275...2896
1075847...1078426
325...2907
2622
2580
2582
94, 60 62.0, 110 72, 110
ureA1
ureA2
GGAGGGCTTATGCAGCTCACCCCAAG
TTGCCATCTCTGGCCCCTTCCA
ureA DQ350880
AM286415
Z18865
1...161
1075573...1075733
51...211
161
161
161
94, 60 61.4, 60 72, 60
ureAB1
ureAB2
CAATGGAAGGGGCCAGAGATGG
GTAAGCCGCAGCACGGTCAAACTC
ureA-ureB DQ350880
AM286415
Z18865
137...579
1075709...1076210
187...688
443
502
502
94, 60 60.3, 60 72, 60
ureAB3
ureAB4
GCAGCTCACCCCAAGAGAAGTTGA
AATTTGAGGCATCTGTCGCTCCTT
ureA-ureB DQ350880
AM286415
Z18865
12...1015
1075584...1076608
62...1086
1004
1025
1025
95, 60 56.9, 110 72, 60
ureB1
ureB2
ATTGCAGAGGATTAAAGCATGAGC
AGCGGAACTTCGGTTTCATCACC
ureB DQ350880
AM286415
Z18865
349...650
1075920...1076281
398...759
302
362
362
94, 60 60.0, 60 72, 60
ureBC1
ureBC2
TGCGGCTTACGGAAAAAGGCTGAATA
GCCGAGAAATTTGAGGCATCTGTCG
ureB-ureC DQ350880
AM286415
Z18865
570...1022
1076201...1076615
679...1093
453
415
415
94, 60 60.3, 60 72, 60
ureC1
ureC2
AAAGGAGCGACAGATGCCTCAAA
GAAACCTGAATATCCATTTCATCCGCCAT
ureC DQ350880
AM286415
Z18865
991...1749
1076584...1077342
1062...1823
759
759
762
94, 60 63.2, 60 72, 60
ureC3
ureC4
GGCTATAAAGTTCACGAAGACTG
CAAAGAAATAGCGCTGGTTCA
ureC DQ350880
AM286415
Z18865
1661...2717
1077254...1078310
1735...2791
1057
1057
1057
94, 60 52.9, 60 72, 60
ureC1
ureC4
AAAGGAGCGACAGATGCCTCAAA
CAAAGAAATAGCGCTGGTTCA
ureC DQ350880
AM286415
Z18865
991...2717
1076584...1078310
1062...2791
1727
1727
1730
94, 60 50.0, 60 72, 120
ureCE1
ureCE2
GCGCTGGATGACGGTGTGAAAGAG
ATGTAAGCCGGAGCCATGAGGTTC
ureC-ureE, ureE DQ350880
AM286415
2504...3552
1078097...1079082
1019
986
94, 60 61.0, 60 72, 60
ureE1
ureE2
ACCATGATGGATTCCGTGATGAGA
GTGAAGGCCCCGACCGGCAGTACG
ureE-ureF DQ350880
AM286415
3364...3734
1078894...1079270
371
377
95, 60 58.7, 60 72, 60
ureF1
ureF2
TGAATGCATCAGATCTGATTCGTA
ACATCCACAATAGGGACATAAGA
ureF DQ350880
AM286415
3668...4304
1079204...1079840
637
637
95, 60 50.0, 60 72, 60
ureFG1
ureFG2
CAATATGGCGTGGCGATGACAAT
CCACCGGGCCACCAATACCAA
ureF-ureG DQ350880
AM286415
4132...4535
1079668...1080070
403
401
95, 60 55.7, 60 72, 60
ureG1
ureG2
GAATAGCCATTCAACCGATAAAC
CGCATAATCATATCCACCAAC
ureG DQ350880
AM286415
4474...5091
1080009...1080626
618
618
95, 60 51.3, 60 72, 60
ureG1
ureD2
GAATAGCCATTCAACCGATAAAC
TTCCGGCAATGTCACACCGAGAAT
ureG-ureD, ureD DQ350880
AM286415
4474...6099
1080009...1081634
1626
1626
95, 60 50.4, 60 72, 120
ureD1
ureD2
AGCCAGAATATCGTGGAAACTCCT
TTCCGGCAATGTCACACCGAGAAT
ureD DQ350880
AM286415
5146...6099
1080681...1081634
954
954
95, 60 50.0, 60 72, 60
ureD3
ureD4
TTGTTAACCCCCAAAGAGCATCAT
CTGCCGGATTCCCTTCGCCATAG
ureD-yut DQ350880
AM286415
5884...6416
1081419...1081950
533
532
95, 60 58.0, 60 72, 60
Yut1
Yut2
CGCGGCTGTGCTCAAGTC
GTGCTGGCATCACATCTTTATTAGG
yut AM286415 1081851...1082745 895 95, 60 50.0, 60 72, 60

The primer details and the PCR conditions used are given.

DQ350880:Y. enterocolitica IP27403 (bioserovar 1A/O:6,30); AM286415: Y. enterocolitica 8081 (bioserovar 1B/O:8); Z18865: Y. enterocolitica 6471/76 (bioserovar 4/O:3)

Nucleotides sequences in bold are different in biovar 1A strain (DQ350880)

*PCRs were performed with initial denaturation step of 94°C for 10 min, 30 cycles each of denaturation (Den), annealing (Ann) and extension (Ext) as indicated and a final extension of 10 min at 72°C

PCRs for ure structural and accessory genes, intergenic regions and the yut gene were performed using a thermal cycler (MyCycler, Bio-Rad). The 25 μl PCR reaction mixture contained 100 ng of genomic DNA, 2.5 μl of 10 × Taq buffer containing 1.5 mM MgCl2, 2.5 μl of 2 mM dNTP, 25 pmol of each primer, and 2 U of Taq DNA polymerase (New England BioLabs). The details of the conditions used for amplification are given in Table 1. After amplification, 10 μl of the PCR product was resolved in 2% agarose gel in 1 × Tris-acetate-ethylenediaminetetraacetic acid (TAE) buffer (40 mM Tris-HCl, 20 mM acetic acid, 1 mM EDTA, pH 8.0) at 70 V for 2 h. The gels were stained with ethidium bromide (0.5 μg/ml) and photographed under UV-transillumination in a gel documentation system (Bio-Rad, CA). The 1 kb and 100 bp DNA ladders (New England BioLabs) served as molecular size markers.

Sequencing of PCR amplicons, ORF analysis and phylogenetic relationships

The PCR amplicons obtained above using the genomic DNA of Y. enterocolitica biovar 1A (strain IP27403) were extracted, purified using QIAquick Gel extraction kit (Qiagen) and sequenced directly in one or both directions (Microsynth, Balgach, Switzerland or LabIndia, Gurgaon, India). The sequences were analyzed, edited and compiled using Editseq and MegAlign of DNASTAR. Homology searches for nucleotide and deduced amino acid sequences were carried out by BLASTN and BLASTP respectively. The multiple nucleotide and protein sequence alignments were performed by MegAlign or ClustalW. The percent identity and similarity were calculated using MatGAT 2.02 [25]. The theoretical molecular weight and isoelectric point (pI) of urease structural and accessory proteins were determined by EditSeq (DNASTAR).

The open reading frames (ORFs) in the compiled ure gene cluster were identified using GeneMark [26], GeneMark.hmm [27], FGENESB [28] and the NCBI ORF finder [29] programs. All ORFs were checked further for homology to known protein sequences using BLASTX.

The relationship of urease structural and accessory protein sequences of biovar 1A strain of Y. enterocolitica to sequences available in GenBank were determined by constructing phylogenetic trees with the program MEGA 4.0 using the neighbor-joining algorithm. Bootstrap value for each node of the tree was calculated over 1,000 replicate trees.

PCR-Restriction fragment length polymorphism (PCR-RFLP) of urease genes

Primer pairs ureAB3-ureAB4 and ureC1-ureC4 were designed to amplify the 1,004 bp and 1,727 bp of ureAB and ureC genes respectively (Fig. 1). The biovar 1A strains were chosen such that each belonged to a different serovar, country, source of isolation, REP/ERIC-type [22] and VNTR01-type [30]. The PCR amplicon of ureAB was digested with HaeIII and Sau96I while that of ureC was digested with RsaI and Sau96I. The choice of the restriction enzymes was based on in silico restriction of the expected amplicons such that DNA fragments were amenable to separation by gel electrophoresis. Restriction enzymes were from New England BioLabs (RsaI and HaeIII) or Bangalore Genei (Sau96I). Ten microlitre of amplified DNA was digested with 2.5 U (HaeIII and Sau96I) or 5 U (RsaI) of restriction enzyme using appropriate buffer recommended by the manufacturer, in a total volume of 25 μl at 37°C overnight. The digested products were separated by electrophoresis in 2.5% agarose gel at 50 V for 5 h in TAE buffer. 100 bp ladder (New England BioLabs) was used as the molecular size standard. The gel was stained with ethidium bromide and examined under UV transillumination.

Growth and preparation of cell free extract

Y. enterocolitica strain IP27403 was grown overnight at 28°C in 20 ml LB medium with shaking at 200 rpm. Cells were collected by centrifugation (9,000 × g, 10 min, 4°C), washed twice, and resuspended to 1.5 × 108 CFU/ml equivalent to 0.5 McFarland standard (A600 = 0.1). These were diluted to 1.0 × 106 CFU/ml and 50 μl of this suspension was inoculated into 50 ml of fresh LB medium, and incubated further (28°C, shaking at 200 rpm). Samples were withdrawn at different time intervals up to 78 h and diluted in 20 mM sodium phosphate buffer (pH 7.0). 0.1 ml of the appropriate dilution was plated, in triplicate, on Luria agar and incubated overnight at 28°C. The number of viable bacteria was recorded at different intervals and CFU/ml was calculated. The log10CFU/ml was plotted against incubation time (in h).

For preparing lysate, cells grown in 50 ml LB medium were harvested by centrifugation, washed twice and resuspended in 2.5 ml of 20 mM sodium phosphate buffer (pH 7.0). Cells were disrupted by sonication with three cycles (2 s "pulse on" and 2 s "pulse off" for 2 min) at 25% intensity with Vibra-Cell (Sonics). The cell lysate was centrifuged at 18,000 × g for 30 min at 4°C to obtain cell-free extract. The supernatant was transferred to pre-chilled microcentrifuge tubes and used immediately for determination of urease activity. Protein concentration was estimated by Bradford [31] method using bovine serum albumin (Sigma) as standard.

Urease assay

Urease activity in the cell extract was assayed by measuring release of ammonia from urea in the phenol-hypochlorite assay [32]. Briefly, extract containing 2 μg of protein was added to 100 mM citrate buffer (pH 5.5) containing 50 mM urea in 200 μl of final volume. The mixture was incubated at 37°C for 15 min. A similar volume of the extract boiled for 10 min served as negative control. The reaction was terminated by the addition of 1.5 ml of solution containing 1% phenol and 0.005% sodium nitroprusside; this was followed by the addition of 1.5 ml solution containing 0.5% (w/v) NaOH and 0.044% (v/v) NaClO, and the contents were mixed well. Following incubation at 37°C for 30 min, the absorbance was measured at 625 nm using a spectrophotometer (UV-1700 Pharmaspec; Shimadzu Scientific Instruments Inc., Columbia, Md.). Assays were carried out in triplicate and the amount of the ammonia released per minute was determined. The quantity of ammonia (in nmol) released was calculated from the calibration curve obtained from appropriate dilutions of freshly prepared NH4Cl solution, which was determined to be linear between 20-500 nmol. Data are presented as specific activity of urease, defined as μmol of NH3/min/mg of protein. Stated values are the mean ± standard deviation of triplicate determinations.

Biochemical characterization

The optimum pH for urease was determined by measuring activity at pH 1.5 to 7.5. The assays were carried out in 20 mM sodium phosphate (for pH 1.5, 2.5, 5.5, 6.0, 6.5, 7.0 and 7.5) and 100 mM citrate (for pH 3.0, 3.5, 4.0 and 5.5) buffers. The optimum temperature for urease was determined by incubating the extract containing enzyme with substrate at different temperatures (18-75°C) in the phenol-hypochlorite assay described above. The kinetic data (Km and Vmax) of urease were calculated from Lineweaver-Burk plot of the initial rate of hydrolysis of urea in citrate buffer (100 mM, pH 5.5). To determine the effect of growth temperature and growth phase on urease activity, extracts were prepared from cells grown in shaking at 28°C and 37°C in LB medium for different time intervals. To determine the effect of urea and nickel on production of urease, medium was supplemented with urea (16.7 mM) or NiCl2 (up to 200 μM).

Native and SDS PAGE

Cell-free extracts from different biovars of Y. enterocolitica were electrophoresed on non-denaturing polyacrylamide gel [33]. Briefly, extract containing ca. 100 μg of protein was mixed with 1× tracking dye and loaded on 5% resolving gel in 380 mM Tris-HCl (pH 8.8) with 4% stacking gel in 63 mM Tris-HCl (pH 6.8) in a mini-Protein III apparatus (Bio-Rad). Samples were electrophoresed with Tris-Glycine (pH 8.4) as the running buffer at 70 V for 2 h at 4°C. The gel was removed and equilibrated with 5-10 changes of solution containing 0.02% cresol red and 0.1% EDTA until the entire gel turned yellow. After draining the solution, gel was flooded with 1.5% (w/v) solution of urea. The pink bands of urease were recorded by scanning (UMAX Astra 3600). Urease from jack bean (Sigma) was used as the marker.

SDS-PAGE was performed as per standard protocol [34]. Briefly, extract containing 25 μg of protein was boiled in reducing Laemmli sample buffer and separated on 12% polyacrylamide gel.

Isoelectric focusing (IEF)

IEF of the cell extract was carried out in 6% polyacrylamide gel containing 2% ampholyte of pH 3-10 (Biolyte Ampholyte, Bio-Rad). 3-5 μl of extract containing ca. 20-25 μg of protein was loaded on the gel and focused at 4°C using a Mini IEF cell (Bio-Rad) according to the manufacturer's instructions. After focusing, the gel was equilibrated with a solution containing 0.02% cresol red and 0.1% EDTA. Urease bands were visualized by superimposing the gel with Whatman No. 1 filter paper presaturated with cresol red-EDTA solution containing 1.5% urea. Urease appeared as pink band against a yellow background. Broad range IEF standard with pI 4.45-9.6 (Bio-Rad) was used as the pI marker to determine the isoelectric point of the urease.

Survival of Y. enterocolitica in acidic pH in vitro

The in vitro survival of Y. enterocolitica was performed by slight modification of the method reported earlier [35]. Briefly, ten microlitre of the bacterial suspension was added to 1 ml of 20 mM sodium phosphate (for pH 2.5 and 7.0) or 100 mM citrate (for pH 4.0) buffer with or without 3.4 mM urea in 0.6% NaCl, and prewarmed to 37°C to give an initial count of ca. 7.0 log10CFU/ml. The contents were mixed and incubated with shaking at 37°C for 2 h. At the end of the incubation, samples were removed and diluted serially in 20 mM sodium phosphate buffer (pH 7.0). 0.1 ml of an appropriate dilution was plated on LB agar to determine CFU/ml. At conclusion of each assay, the pH of the buffer was recorded. All assays were repeated at least thrice on separate occasions.

Statistical analysis

The mean and the standard deviation for each data set were calculated using Microsoft Excel 2003 software (Microsoft Corporation, Redmond, Wash.). Statistical significance was calculated using unpaired t test (Sigma Stat version 3.5). p value < 0.05 was considered significant.

Nucleotide sequence accession number

The nucleotide sequence data of ure gene complex and the yut gene reported in this paper have been deposited in GenBank database under accession numbers DQ350880 and EU527335 respectively.

Results

Characterization of urease genes

Primers U1 and U2 were designed to amplify the ure structural (ureA, ureB, ureC) genes of Y. enterocolitica. Although amplification was obtained with biovar 1B, 2 and 4 strains, these primers did not consistently amplify the ure structural genes of biovar 1A strains. Thus, new primers were designed to amplify each of the ure structural and accessory (ureE, ureF, ureG, ureD) genes separately, and the intergenic regions so as to encompass the entire urease gene cluster of biovar 1A strain. Amplicons of expected sizes were obtained for all genes except ureB and the intergenic regions namely ureA-ureB, ureB-ureC and ureC-ureE (Table 1). The sequences thus obtained were analyzed for homology with sequences available in databases, edited and combined to obtain 7,180 bp sequence of ure gene cluster of biovar 1A strain (See Additional file 1 for ure gene cluster sequence).

Seven ORFs were identified in the ure gene cluster of Y. enterocolitica biovar 1A strain and designated as ureA, ureB, ureC, ureE, ureF, ureG and ureD (Fig. 1) as in the ure gene complex of Y. enterocolitica 8081 (biovar 1B, accession number AM286415). As with Y. enterocolitica 8081, yut gene which encodes a urea transport protein was present downstream of the ure gene cluster. All ORFs had ATG as the start codon except ureG where the start codon was GTG. These ORFs were preceded by ribosome-binding consensus sequence. Although ure gene cluster of biovar 1A strain was broadly similar to that of biovar 1B and biovar 4 strains, differences were identified. These were - smaller ureB gene and ureA-ureB intergenic region and larger ureB-ureC and ureC-ureE intergenic regions in biovar 1A strain (Table 2). The size of ureB gene of Y. enterocolitica biovar 1A was identical to ureB of Y. aldovae, Y. bercovieri, Y. intermedia, Y. mollaretii and exhibited higher nucleotide sequence identity to these species than to Y. enterocolitica biovar 1B or 4. The stop codon of ureG overlapped with the start codon of ureD gene. The G + C content of the urease gene cluster was 49.76% which was typical of Y. enterocolitica with G + C content of 47.27%.

Table 2.

Urease structural and accessory genes and the intergenic regions thereof, in Y. enterocolitica biovar 1A.

Gene/Intergene Ye1A Size (in bp) and % identity

YeO8 YeO3 Yers Yps Ype Pl Ei Ka
Structural
ureA 303 303
98
303
98
303
89-96
303
91
303
91
303
77
303
76
303
63
ureB 435 495
83
495
83
435-495*
78-89
435/477
74-82
435/477/528
67-81
390
63
423
62
321
48
ureC 1719 1719
96
1722
94
1719
87-91
1719
86
1719
82-86
1716
75
1719
76
1704
61
Accessory
ureE 687 792/693
85/97
NA 681-720
83-91
696
82
696/705
80-82
597
59
678
58
477
44
ureF 687 687
98
NA 687
85-90
687
85-86
687
86
687
66
705
65
675
48
ureG 666 666/606
99/90
NA 666
88-92
663
84
663
85
636
78
630
73
618
59
ureD 984 978/984
96/97
NA 966-984
84-90
966
81
834/964/967
71-82
966
64
963
62
-
Intergenic region
ureAB 54 53 53 53-65 10/52 0/10/52 91 46 9
ureBC 202 164 164 87-97/201-202* 89 89 67 42 0
ureCE 236 74/173 NA 133-204 294/295 286/295 74 57 9
ureEF 21 21 NA 20-24 21 21 0 0 1
ureFG 117 117/177 NA 58-102 125/126 126 52 14 8
ureGD 0 1/0 NA 0 0 0 0 6 -

Comparison with different Yersinia spp. and other bacteria.

The abbreviations correspond to following species with accession number(s) in parentheses. Ye1A: Y. enterocolitica bioserovar 1A/O:6,30 (DQ350880); YeO8: Y. enterocolitica bioserovar 1B/O:8 (L24101, AM286415); YeO3: Y. enterocolitica bioserovar 4/O:3 (Z18865); Yers included Y. aldovae (AY363680), Y. bercovieri (AY363681), Y. frederiksenii (AY363682), Y. intermedia (AY363683), Y. kristensenii (AY363684), Y. mollaretii (AY363685), Y. rohdei (AY363686); Yps: Y. pseudotuberculosis (U40842; CP000720; CP000950; BX936398); Ype: Y. pestis (CP000901, CP000308, AL590842, AE017042, CP000305, CP000668, AF095636); Pl: Photorhabdus luminescens (BX571866); Ei: Edwardsiella ictaluri (AY607844); Ka: Klebsiella aerogenes (M36068)

% identity is indicated in bold

0 indicates that the intergenic region had overlapping stop and start codons

*ureB gene size was 435 bp (Y. aldovae, Y. bercovieri, Y. intermedia, and Y. mollaretii), 441 bp (Y. rohdei), 468 bp (Y. frederiksenii) and 495 bp (Y. kristensenii); ureBC intergenic region of 201-202 bp was present in Y. aldovae and Y. intermedia

The comparison of Y. enterocolitica biovar 1A ure genes and the deduced amino acid sequences with that of Yersinia spp. and other bacteria are given in Tables 2 and 3 respectively. Besides Yersinia species, the homologies of ure genes (upto 76% identity) and their deduced amino acid sequences (upto 86% identity and 95% similarity) were significant with ureases from Photorhabdus luminescens and Edwardsiella ictaluri. The UreA, UreC and UreG proteins were most conserved among Yersinia spp. The estimated molecular weights, in Da, of the protein subunits were 11,048 (UreA), 15,854 (UreB), 61,026 (UreC), 25,507 (UreE), 25,040 (UreF), 24,181 (UreG) and 36,592 (UreD) (Table 3).

Table 3.

Urease structural and accessory proteins of Y. enterocolitica biovar 1A (Ye 1A).

Gene Gene product (aa) Mol. mass (Da)* pI* % identity/% similarity

YeO8 YeO3 Yers Yps Ype Pl Ei Ka
Structural subunits
UreA ureA 100 11,048 5.29 99-100 100 97-100/100 100 100 79/95 86/95 60/82
UreB ureB 144 15,854 9.06 84-85/85-86 85/86 84-99/85-99 86-94/88-97 78-94/79-97 60/72 61/73 36/47
UreC ureC 572 61,026 5.64 99/100 95/97 97-99/99-100 97/99 93-97/95-99 83/91 86/94 58/73
Accessory proteins
UreE ureE 228 25,507 6.35 86-99 NA 91-95/95-97 94/97 92-93/96-97 55/69 50/70 27/39
UreF ureF 228 25,040 6.41 100 NA 96-99/97-100 98/99 97-98/99 67/76 65/83 22/43
UreG ureG 221 24,181 4.94 91-100 NA 98-100/99-100 96/97 96/97 86/91 86/91 54/71
UreD ureD 327 36,592 6.61 93-98/95-99 NA 91-98/95-99 93/96 FS 64/77 59/71 -

Comparison with different Yersinia spp. and other bacteria.

The abbreviations correspond to following species with protein accession numbers for UreA, UreB, UreC, UreE, UreF, UreG and UreD in parentheses: Ye1A: Y. enterocolitica biovar 1A (ABC74582-ABC74585; ACA51855-ACA51857); YeO8: Y. enterocolitica O8 biovar 1B (AAA50994-AAA51000, CAL11049-CAL11055); YeO3: Y. enterocolitica O3 biovar 4 (CAA79314-AA79320); Yers included Y. aldovae (AAR15084-AAR15090); Y. bercovieri (AAR15092-AAR15098); Y. frederiksenii (AAR15100-AAR15106); Y. intermedia (AAR15108-AAR15114); Y. kristensenii (AAR15117-AAR15123); Y. mollaretii (AAR15126-AAR15132); Y. rohdei (AAR15135-AAR15141); Yps: Y. pseudotuberculosis (CAH22182-CAH22176, AAA87852-AAA87858, ACA67429-ACA67435); Ype: Y. pestis (ABG14357-ABG14363; CAL21284-CAL21289; AAS62666-AAS62671; AAM84812-AAM84817; ABG17479-ABG17485; ABP39996-ABP39990; AAC78632-AAC78638); Pl: Photorhabdus luminescens (CAE14464-CAE14470); Ei: Edwardsiella ictaluri (ABD93708-ABD93706, AAT42448-AAT42445); Ka: Klebsiella aerogenes (AAA25149-AAA25154); NA: Not available; FS: frameshift mutation

* Theoretical molecular mass and pI were determined with DNASTAR

Phylogenetic analysis of urease structural and accessory proteins of Y. enterocolitica biovar 1A showed clustering with members of gamma-proteobacteria such as P. luminescens and E. ictaluri along with Yersinia spp. (See Additional files 2 and 3). These protein sequences were also related closely to members of alpha-proteobacteria like Methylobacterium chloromethanicum, M. extorquens, M. populi and Brucella spp. but were related distantly to other members of gamma-proteobacteria like Klebsiella aerogenes, P. mirabilis and Escherichia coli.

PCR-RFLP of ure genes

The regions constituting the structural genes namely ureAB and ureC were amplified in several Y. enterocolitica biovar 1A strains using primer pairs AB3-AB4 and C1-C4 respectively. Restriction digestion of ureAB region with HaeIII and Sau96I resulted in almost identical patterns among all biovar 1A strains (See Additional file 4). But, differences were clearly evident in restriction profiles of ureC digested with RsaI and Sau96I (Fig. 2). With RsaI, strains belonging to clonal group A exhibited profile different from that of clonal group B strains. Thus, it may be inferred that sequence of urease gene in clonal group A strains is different from that of clonal group B strains.

Figure 2.

Figure 2

PCR-RFLP of ureC. PCR-RFLP of ureC of Y. enterocolitica biovar 1A strains amplified with primers ureC1-ureC4, and restriction digested using (A) RsaI and (B) Sau96I enzymes. Lanes 1: IP27360, 2: IP27362, 3: IP27364, 4: IP27365, 5: IP26310, 6: IP26311, 7: IP26312, 8: IP26315, 9: IP27403, 10: IP27407, 11: IP27429, 12: IP27433, 13: IP27434, 14: IP26261, 15: IP26305, 16: E1281580, 17: IP26316, 18: E1281550, 19: IP26152, 20: P346, 21: P354, 22: P386, 23: P472, 24: IP27404, 25: IP27406, 26: IP27430, 27: IP27432, 28: IP27484, 29: IP26147, 30: IP26148, 31: E1281600, 32: IP27385, 33: IP27386, 34: IP27388, 35: IP27485, 36: STM 126, 37: 8660/90 STM 484, 38: 0310/90, 39: ST5 NF-O, 40: IP27879, 41: IP27873, 42: IP27950, 43: IP27985, 44: IP24121, 45: IP27648, 46: IP27210, 47: IP27149, M: Molecular mass marker (100 bp ladder, New England BioLabs). * Strains belonging to clonal group B are shown in lanes 10, 14, 15, 19, 21, 22, 28, 29, 31, 45, 46 and 47. Clonal group A strains are in other lanes. For clonal groups refer to [22].

The HaeIII and Sau96I restriction profiles of ureAB of biovar 1B, 2 and 4 strains were distinct from that of biovar 1A strains (See Additional file 4). As with ureAB, restriction patterns of ureC for these biovars were also quite distinct from biovar 1A strains (data not shown).

Biochemical characterization

The crude extract of urease of Y. enterocolitica biovar 1A strain was active over a pH range of 4.0-7.0. The maximum activity was observed at pH 5.5 (Fig. 3a). The enzyme was quite heat-stable as urease activity was recorded up to 65°C but decreased progressively at higher temperature (Fig. 3b). The optimum temperature for urease activity was 65°C (Fig. 3b). The urease exhibited Michaelis-Menten kinetics with Km and Vmax of 1.74 ± 0.4 mM urea and 7.29 ± 0.42 μmol of ammonia released/min/mg of protein respectively (data not shown).

Figure 3.

Figure 3

Biochemical characterization of Y. enterocolitica biovar 1A urease. (a) optimal pH for urease activity (b) effect of temperature on urease activity and (c) effect of growth phase and growth temperature on urease production; growth curve of biovar 1A strain grown at 28°C is also shown. Data points represent mean of triplicate determinations. The error bars indicate standard deviation.

Y. enterocolitica biovar 1A grown at 28°C (optimum temperature for growth) exhibited higher urease activity than that grown at 37°C (Fig. 3c). Irrespective of the growth temperature, stationary phase cells showed higher activity (Fig. 3c). The supplementation of growth medium (Luria broth) with 16.7 mM urea did not show significant difference in urease activity. However, supplementation with nickel chloride resulted in ca. 10-fold increase in the activity. 1 μM NiCl2 was sufficient to induce urease activity as no significant increase in the activity was observed with further increase in concentration up to 200 μM (See Additional file 5).

On native PAGE, urease was observed as two bands with the major band having molecular weight > 545 kDa and a slowly-developing band above it (Fig. 4). The electrophoretic mobility of urease of Y. enterocolitica biovar 1A strain was shown to be different from that of biovar 1B, 2 and 4 strains though similar to the Y. intermedia urease. The isoelectric point of the crude extract urease was 5.2.

Figure 4.

Figure 4

Non-denaturing PAGE showing urease activity of Yersinia spp. Lane 1: Y. enterocolitica IP27403 (1A/O:6,30); lane 2: Y. enterocolitica IP134 (4/O:3); lane 3: Y. enterocolitica IP26329 (2/O:9); lane 4: Y. enterocolitica IP26249 (2/O:5,27); lane 5: Y. enterocolitica 8081 (1B/O:8); lane 6: Y. intermedia IP27478 (serotype O:7,8-8); M: Jack bean urease [272 kDa (trimer) and 545 kDa (hexamer); BV: Biovar.

Survival of Y. enterocolitica in vitro

The ability of Y. enterocolitica biovar 1A strain to survive at pH 2.5, 4.0 and 7.0 in vitro was investigated. Strains belonging to other biovars were also studied concurrently. The biovar 1A strain survived at pH 4.0 and 7.0 for 2 h without significant differences in their viable counts (Fig. 5). However, no viable cells were recovered after 2 h at pH 2.5. In fact, the decrease in the viable counts at this pH was evident even within 5 min of incubation. The addition of 3.4 mM urea at pH 2.5 was sufficient to increase the survival of Y. enterocolitica biovar 1A equivalent to that observed at pH 4.0 and 7.0. Similar results were observed for other biovars also. The pH of the assay medium at the end of experiment was same as that at the start, suggesting that increased survival of Y. enterocolitica was not due to any significant change in the pH.

Figure 5.

Figure 5

Survival of Y. enterocolitica in vitro at different pH. Number of bacterial cells (log10CFU/ml) of Y. enterocolitica after incubation for 2 h at pH 2.5, 4.0 and 7.0 in the absence and presence (U) of 3.4 mM urea. The values are mean of three independent observations. The error bars indicate standard deviation.

Discussion

The ure gene cluster of Y. enterocolitica biovar 1A strain included three structural (ureA, ureB, ureC) and four (ureE, ureF, ureG, ureD) accessory genes. The yut gene, which is required for transport of urea was present downstream of this cluster. Thus, the organization (ureABCEFGD) of ure gene cluster in Y. enterocolitica biovar 1A strain was similar to that reported for Y. enterocolitica biovar 1B, P. luminescens and E. ictaluri [23,36,37]. Similar organization has been reported for other species such as Streptococcus salivarius, Synechococcus sp. WH7805, and B. abortus ure-2 operon [19,38,39]. However, important differences were observed compared to urease genes of Y. enterocolitica biovar 1B and biovar 4 strains. These included differences in the size of ureB gene and the intergenic regions. Also, the restriction profiles of ure structural genes of biovar 1A strains were different from that of biovars 1B, 2 and 4. These observations indicated that RFLP of urease genes may be used to study the epidemiology of Y. enterocolitica.

The amino acid residues in the urease structural proteins namely UreA (γ subunit), UreB (β subunit) and UreC (α subunit) that are reported to have functional significance in K. aerogenes urease [40] were also conserved in Y. enterocolitica biovar 1A. The crystallographic [41] and genetic [40] analysis of K. aerogenes urease has shown that four histidine residues (His-134, -136, -246 and -272), an aspartate (Asp-360) and a carbamylated lysine (Lys-217) of UreC are involved in nickel metallocenter binding. All these amino acids were conserved at positions His-139, -141, -251, -277; Asp-365 and Lys-222 in UreC of Y. enterocolitica biovar 1A. Histidine residues in the α-subunit of K. aerogenes shown to be important for substrate binding (His-219) and catalysis (His-320) are present at positions 224 and 325 in α-subunit of biovar 1A [40]. The urease active-site consensus sequence (MVCHHLD) [42] deviated by two residues (MVCHNLN) in biovar 1A strain. Amino acid residues with functional significance including His-97 (UreA) and His-39, -41 (UreB) [40] were also conserved in relative positions in Y. enterocolitica biovar 1A. The conservation of amino acids in Y. enterocolitica biovar 1A urease involved in coordination of nickel at active site, substrate binding and catalysis as seen in K. aerogenes urease, suggested similar quaternary structure of the two enzymes. UreE consisted of histidine-rich motif at carboxy terminus as in UreE of K. aerogenes, B. abortus, Actinobacillus pleuropneumoniae, E. ictaluri and Synechococcus [19,36,39,43,44]. A P-loop motif (GPVGSGKT), which contains ATP and GTP binding sites [45] and probably provides energy for Ni activation [46] was present at the amino terminus (positions 19-26) of UreG.

A pH optimum in the acidic range for urease produced by a neutrophile like Y. enterocolitica biovar 1A was similar to that reported for Y. enterocolitica biovars 1B and 4, and Morganella morganii [35,47]. Ureases with optima in the acidic range reportedly carried a phenylalanine seven residues towards N-terminus, and an asparagine one residue toward the C-terminus, from the catalytic site [35]. Both these residues are also present at respective positions in UreC of Y. enterocolitica biovar 1A. The maximal activity of urease at 65°C by Y. enterocolitica biovar 1A has also been reported for other bacteria [44]. A low Km of Y. enterocolitica biovar 1A urease as in biovar 4 strains [47], indicated its high affinity for urea. This suggested that the enzyme might function quite normally in the gut despite low concentrations (1.7-3.4 mM) of the urea available there. Also, consistent with our observation, organisms which produce urease with low Km have been reported to possess urea transport (yut) gene as seen in S. salivarius, Lactobacillus fermentum, Bacillus sp. strain TB-90 and B. suis [48].

The cultural conditions which affected production of urease by Y. enterocolitica biovar 1A included growth phase, growth temperature and availability of nickel ions. The expression of bacterial ureases is known to be either constitutive or induced by factors like low nitrogen, urea or pH [49]. The maximal urease activity during stationary phase of the growth and at 28°C as observed for Y. enterocolitica biovar 1A strain was consistent with that of biovar 4 strains [47]. In Y. enterocolitica, several other virulence factors such as invasin, Myf fibrillae and enterotoxin have also been reported to be regulated by growth phase and the growth temperature [50]. A 10-fold increase in urease activity following supplementation of growth medium with nickel was not accompanied by increase in the expression of urease structural proteins suggesting that increased activity was probably due to the activation of pre-existing apoenzyme. Nickel has been reported to regulate both expression and activity of urease in H. pylori [51]. In silico analysis of whole genome of Y. enterocolitica 8081 (biovar 1B) revealed two systems (ureH and ynt) for transport of nickel. It would be interesting to determine the role of multiple nickel transport genes in urease activity and its regulation in Y. enterocolitica.

The Mw of Y. enterocolitica biovar 1A urease as assessed from native PAGE was > 545 kDa. The molecular mass of urease is known to vary from as low as 130 kDa in B. suis [52] to as high as 620 kDa in Providencia rettgeri or > 700 kDa in M. morganii [53]. The difference in the molecular mass of urease of Y. enterocolitica biovar 1A vis-à-vis Y. enterocolitica biovar 1B and biovar 4 seems to be due to difference in the size of UreB (β-subunit), which is smaller in the former and thus may account for its lower molecular mass. The isoelectric point (pI) of 5.2 of biovar 1A urease was close to that reported for Proteus penneri (pI = 5.1) and H. pylori (pI = 5.9) urease [33,54]. No data on molecular mass and isoelectric point of ureases produced by Y. enterocolitica strains belonging to other biovars has been reported.

The ability of Y. enterocolitica biovar 1A strains to survive at pH 2.5 in vitro in the presence of 3.4 mM urea implicated urease in their survival. This suggested the possible role urease might play in the survival of Y. enterocolitica biovar 1A under acidic conditions in the gut. However, this needs to be confirmed by comparison of wild type strain with an isogenic urease mutant. The role of urease in survival during transit through gut has been reported for B. suis, B. abortus, H. pylori and E. ictaluri [18,19,36,55,56]. Interestingly, the biovar 1A strains have also been reported to resist killing, and survive within macrophages [13]. It would therefore be worthwhile to determine the role urease may play in the survival of Y. enterocolitica biovar 1A strains in the acidic environment of phagolysosomes.

Conclusions

The ure gene cluster of Y. enterocolitica biovar 1A though broadly similar to that of biovar 1B and biovar 4 strains showed differences in structural (ureB) genes and the intergenic regions thereof. The kinetic data indicated that urease produced by Y. enterocolitica biovar 1A strain would be active at low concentration of urea typically present in the gut. The ability of biovar 1A strain to survive at acidic pH in the presence of urea suggested that urease might play role in their survival in the gut. This however needs to be corroborated using ure isogenic mutants.

Authors' contributions

NB carried out the experimental part of the study. JSV conceived and supervised the work. Both authors participated in interpretation of data and preparation of the final manuscript.

Supplementary Material

Additional file 1

Nucleotide and deduced amino acid sequences of ure gene cluster of Y. enterocolitica biovar 1A. The nucleotide sequence of the ure gene cluster of Y. enterocolitica biovar 1A and the deduced amino acid sequences of the structural (A, B, and C) and accessory (E, F, G and D) proteins are shown. Putative ribosome binding site consensus sequences upstream of ureA, ureB, ureC, ureF and ureG are in bold face. Stop codons are indicated by an asterisk.

Click here for file (100.2KB, PDF)
Additional file 2

Phylogenetic relationships of urease structural (UreA, UreB and UreC) proteins. Dendrograms showing phylogenetic relationships of Yersinia spp. including Y. enterocolitica biovar 1A and other bacterial species based on amino acid sequence of urease structural proteins (UreA, UreB and UreC). The trees were constructed by the neighbor joining method in MEGA 4.0 package. The bootstrap values presented at corresponding branches were evaluated from 1,000 replications. GenBank accession numbers are indicated for strains used in creating the dendrogram. The bar scale shows substitutions per site.

Click here for file (106.3KB, PDF)
Additional file 3

Phylogenetic relationships of urease accessory (UreE, UreF UreG and UreD) proteins. Dendrograms showing phylogenetic relationships of Yersinia spp. including Y. enterocolitica biovar 1A and other bacterial species based on amino acid sequence of urease accessory proteins (UreE, UreF, UreG and UreD). The trees were constructed by the neighbor joining method in MEGA 4.0 package. The bootstrap values presented at corresponding branches were evaluated from 1,000 replications. GenBank accession numbers are indicated for strains used in creating the dendrogram. The bar scale shows substitutions per site.

Click here for file (110.9KB, PDF)
Additional file 4

PCR-RFLP of ureAB of Y. enterocolitica. DNA was amplified with primers ureAB3-ureAB4 and restriction digested using (A) HaeIII and (B) Sau96I enzymes. Lanes 1: IP27403, 2: IP26305, 3: E1281550, 4: P346, 5: P472, 6: IP27387, 7: STM 126, 8: 0310/90, 9: IP27938, 10: IP27879, 11: IP27873, 12: IP24121, 13: IP134, 14: IP26329, 15: IP26249, 16: 8081. M: Molecular mass marker (100 bp ladder, New England BioLabs); BV: biovar.

Click here for file (50.7KB, PDF)
Additional file 5

Effect of urea/nickel chloride on activity (A) and expression (B) of urease of Y. enterocolitica. Strain IP27403 was grown in Luria Broth (LB) or in LB supplemented with 16.7 mM urea (LB-urea) or NiCl2 at 1 μM (Ni-1), 10 μM (Ni-10), 100 μM (Ni-100) and 200 μM (Ni-200) concentration. M: Medium range protein ladder (Bangalore Genei). Data points represent mean of triplicate determinations; error bars denote standard deviation.

Click here for file (64.3KB, PDF)

Contributor Information

Neeru Bhagat, Email: neeru_bhagat@yahoo.com.

Jugsharan S Virdi, Email: virdi_dusc@rediffmail.com.

Acknowledgements

This work was supported by research grants to JSV from Indian Council of Medical Research (ICMR) and Defence Research and Development Organization (DRDO) and Senior Research Fellowship to NB from Indian Council of Medical Research (ICMR), New Delhi. The financial assistance from University of Delhi to strengthen R & D doctoral research programme is also acknowledged gratefully.

References

  1. Bottone EJ. Yersinia enterocolitica: overview and epidemiologic correlates. Microbes Infect. 1999;1:323–333. doi: 10.1016/S1286-4579(99)80028-8. [DOI] [PubMed] [Google Scholar]
  2. Leclercq A, Martin L, Vergnes ML, Ounnoughene N, Laran JF, Giraud P, Carniel E. Fatal Yersinia enterocolitica biotype 4 serovar O:3 sepsis after red blood cell transfusion. Transfusion. 2005;45:814–818. doi: 10.1111/j.1537-2995.2005.04363.x. [DOI] [PubMed] [Google Scholar]
  3. Cornelis GR, Boland A, Boyd AP, Geuijen C, Iriarte M, Neyt C, Sory MP, Stainier I. The virulence plasmid of Yersinia, an antihost genome. Microbiol Mol Biol Rev. 1998;62:1315–1352. doi: 10.1128/mmbr.62.4.1315-1352.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Revell PA, Miller VL. Yersinia virulence: more than a plasmid. FEMS Microbiol Lett. 2001;205:159–164. doi: 10.1111/j.1574-6968.2001.tb10941.x. [DOI] [PubMed] [Google Scholar]
  5. Tennant SM, Grant TH, Robins-Browne RM. Pathogenicity of Yersinia enterocolitica biotype 1A. FEMS Immunol Med Microbiol. 2003;38:127–137. doi: 10.1016/S0928-8244(03)00180-9. [DOI] [PubMed] [Google Scholar]
  6. Morris JG Jr, Prado V, Ferreccio C, Robins-Browne RM, Bordun AM, Cayazzo M, Kay BA, Levine MM. Yersinia enterocolitica isolated from two cohorts of young children in Santiago, Chile: incidence of and lack of correlation between illness and proposed virulence factors. J Clin Microbiol. 1991;29:2784–2788. doi: 10.1128/jcm.29.12.2784-2788.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Burnens AP, Frey A, Nicolet J. Association between clinical presentation, biogroups and virulence attributes of Yersinia enterocolitica strains in human diarrhoeal disease. Epidemiol Infect. 1996;116:27–34. doi: 10.1017/S0950268800058921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ratnam S, Mercer E, Picco B, Parsons S, Butler R. A nosocomial outbreak of diarrheal disease due to Yersinia enterocolitica serotype O:5, biotype 1. J Infect Dis. 1982;145:242–247. doi: 10.1093/infdis/145.2.242. [DOI] [PubMed] [Google Scholar]
  9. Greenwood MH, Hooper WL. Excretion of Yersinia spp. associated with consumption of pasteurized milk. Epidemiol Infect. 1990;104:345–350. doi: 10.1017/S0950268800047361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bissett ML, Powers C, Abbott SL, Janda JM. Epidemiologic investigations of Yersinia enterocolitica and related species: sources, frequency, and serogroup distribution. J Clin Microbiol. 1990;28:910–912. doi: 10.1128/jcm.28.5.910-912.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Grant T, Bennett-Wood V, Robins-Browne RM. Identification of virulence-associated characteristics in clinical isolates of Yersinia enterocolitica lacking classical virulence markers. Infect Immun. 1998;66:1113–1120. doi: 10.1128/iai.66.3.1113-1120.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Singh I, Virdi JS. Interaction of Yersinia enterocolitica biotype 1A strains of diverse origin with cultured cells in vitro. Jpn J Infect Dis. 2005;58:31–33. [PubMed] [Google Scholar]
  13. Grant T, Bennett-Wood V, Robins-Browne RM. Characterization of the interaction between Yersinia enterocolitica biotype 1A and phagocytes and epithelial cells in vitro. Infect Immun. 1999;67:4367–4375. doi: 10.1128/iai.67.9.4367-4375.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Bhagat N, Virdi JS. Distribution of virulence-associated genes in Yersinia enterocolitica biovar 1A correlates with clonal groups and not the source of isolation. FEMS Microbiol Lett. 2007;266:177–183. doi: 10.1111/j.1574-6968.2006.00524.x. [DOI] [PubMed] [Google Scholar]
  15. Tennant SM, Skinner NA, Joe A, Robins-Browne RM. Homologues of insecticidal toxin complex genes in Yersinia enterocolitica biotype 1A and their contribution to virulence. Infect Immun. 2005;73:6860–6867. doi: 10.1128/IAI.73.10.6860-6867.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. McNally A, La Ragione RM, Best A, Manning G, Newell DG. An aflagellate mutant Yersinia enterocolitica biotype 1A strain displays altered invasion of epithelial cells, persistence in macrophages, and cytokine secretion profiles in vitro. Microbiology. 2007;153:1339–1349. doi: 10.1099/mic.0.2006/000919-0. [DOI] [PubMed] [Google Scholar]
  17. Jones BD, Lockatell CV, Johnson DE, Warren JW, Mobley HL. Construction of a urease-negative mutant of Proteus mirabilis: analysis of virulence in a mouse model of ascending urinary tract infection. Infect Immun. 1990;58:1120–1123. doi: 10.1128/iai.58.4.1120-1123.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Marshall BJ, Barrett LJ, Prakash C, McCallum RW, Guerrant RL. Urea protects Helicobacter (Campylobacter) pylori from the bactericidal effect of acid. Gastroenterology. 1990;99:697–702. doi: 10.1016/0016-5085(90)90957-3. [DOI] [PubMed] [Google Scholar]
  19. Sangari FJ, Seoane A, Rodríguez MC, Agüero J, García Lobo JM. Characterization of the urease operon of Brucella abortus and assessment of its role in virulence of the bacterium. Infect Immun. 2007;75:774–780. doi: 10.1128/IAI.01244-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. de Koning-Ward TF, Robins-Browne RM. Contribution of urease to acid tolerance in Yersinia enterocolitica. Infect Immun. 1995;63:3790–3795. doi: 10.1128/iai.63.10.3790-3795.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gripenberg-Lerche C, Zhang L, Ahtonen P, Toivanen P, Skurnik M. Construction of urease-negative mutants of Yersinia enterocolitica serotypes O:3 and O:8: role of urease in virulence and arthritogenicity. Infect Immun. 2000;68:942–947. doi: 10.1128/IAI.68.2.942-947.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sachdeva P, Virdi JS. Repetitive elements sequence (REP/ERIC)-PCR based genotyping of clinical and environmental strains of Yersinia enterocolitica biotype 1A reveal existence of limited number of clonal groups. FEMS Microbiol Lett. 2004;240:193–201. doi: 10.1016/j.femsle.2004.09.029. [DOI] [PubMed] [Google Scholar]
  23. de Koning-Ward TF, Ward AC, Robins-Browne RM. Characterisation of the urease-encoding gene complex of Yersinia enterocolitica. Gene. 1994;145:25–32. doi: 10.1016/0378-1119(94)90318-2. [DOI] [PubMed] [Google Scholar]
  24. Skurnik M, Batsford S, Mertz A, Schiltz E, Toivanen P. The putative arthritogenic cationic 19-kilodalton antigen of Yersinia enterocolitica is a urease β-subunit. Infect Immun. 1993;61:2498–2504. doi: 10.1128/iai.61.6.2498-2504.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Campanella JJ, Bitincka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinformatics. 2003;4:29. doi: 10.1186/1471-2105-4-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. GeneMark. http://exon.biology.gatech.edu/genemark_prok_gms_plus.cgi
  27. GeneMark.hmm. http://exon.gatech.edu/gmhmm2_prok.cgi
  28. FGENESB. http://www.softberry.com/berry.phtml
  29. NCBI ORF finder. http://www.ncbi.nlm.nih.gov/gorf/gorf.html
  30. Gulati P, Varshney RK, Virdi JS. Multilocus variable number tandem repeat analysis as a tool to discern genetic relationships among strains of Yersinia enterocolitica biovar 1A. J Appl Microbiol. 2009;107:875–884. doi: 10.1111/j.1365-2672.2009.04267.x. [DOI] [PubMed] [Google Scholar]
  31. Bradford M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  32. McGee DJ, May CA, Garner RM, Himpsl JM, Mobley HL. Isolation of Helicobacter pylori genes that modulate urease activity. J Bacteriol. 1999;181:2477–2484. doi: 10.1128/jb.181.8.2477-2484.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mobley HL, Jones BD, Penner JL. Urease activity of Proteus penneri. J Clin Microbiol. 1987;25:2302–2305. doi: 10.1128/jcm.25.12.2302-2305.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press C.S.H., New York; 1989. [Google Scholar]
  35. Young GM, Amid D, Miller VL. A bifunctional urease enhances survival of pathogenic Yersinia enterocolitica and Morganella morganii at low pH. J Bacteriol. 1996;178:6487–6495. doi: 10.1128/jb.178.22.6487-6495.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Booth NJ. Ph.D thesis. Louisiana State University, Department of Pathobiological Sciences, Baton Rouge; 2005. The role of urease in the pathogenesis of Edwardsiella ictaluri. [Google Scholar]
  37. Heermann R, Fuchs TM. Comparative analysis of the Photorhabdus luminescens and the Yersinia enterocolitica genomes: uncovering candidate genes involved in insect pathogenicity. BMC Genomics. 2008;9:40. doi: 10.1186/1471-2164-9-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Chen YY, Clancy KA, Burne RA. Streptococcus salivarius urease: genetic and biochemical characterization and expression in a dental plaque streptococcus. Infect Immun. 1996;64:585–592. doi: 10.1128/iai.64.2.585-592.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Collier JL, Brahamsha B, Palenik B. The marine cyanobacterium Synechococcus sp. WH7805 requires urease (urea amidohydrolase, EC 3.5.1.5) to utilize urea as a nitrogen source: molecular-genetic and biochemical analysis of the enzyme. Microbiology. 1999;145:447–459. doi: 10.1099/13500872-145-2-447. [DOI] [PubMed] [Google Scholar]
  40. Park IS, Hausinger RP. Site-directed mutagenesis of Klebsiella aerogenes urease: identification of histidine residues that appear to function in nickel ligation, substrate binding, and catalysis. Protein Sci. 1993;2:1034–1041. doi: 10.1002/pro.5560020616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Jabri E, Carr MB, Hausinger RP, Karplus PA. The crystal structure of urease from Klebsiella aerogenes. Science. 1995;268:998–1004. doi: 10.1126/science.7754395. [DOI] [PubMed] [Google Scholar]
  42. Todd MJ, Hausinger RP. Identification of the essential cysteine residue in Klebsiella aerogenes urease. J Biol Chem. 1991;266:24327–24331. [PubMed] [Google Scholar]
  43. Mulrooney SB, Hausinger RP. Sequence of the Klebsiella aerogenes urease genes and evidence for accessory proteins facilitating nickel incorporation. J Bacteriol. 1990;172:5837–5843. doi: 10.1128/jb.172.10.5837-5843.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Bossé JT, MacInnes JI. Genetic and biochemical analyses of Actinobacillus pleuropneumoniae urease. Infect Immun. 1997;65:4389–4394. doi: 10.1128/iai.65.11.4389-4394.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Saraste M, Sibbald PR, Wittinghofer A. The P-loop: a common motif in ATP- and GTP-binding proteins. Trends Biochem Sci. 1990;15:430–434. doi: 10.1016/0968-0004(90)90281-F. [DOI] [PubMed] [Google Scholar]
  46. Moncrief MB, Hausinger RP. Characterization of UreG, identification of a UreD-UreF-UreG complex, and evidence suggesting that a nucleotide-binding site in UreG is required for in vivo metallocenter assembly of Klebsiella aerogenes urease. J Bacteriol. 1997;179:4081–4086. doi: 10.1128/jb.179.13.4081-4086.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. de Koning-Ward TF, Robins-Browne RM. A novel mechanism of urease regulation in Yersinia enterocolitica. FEMS Microbiol Lett. 1997;147:221–226. doi: 10.1016/S0378-1097(96)00528-9. [DOI] [PubMed] [Google Scholar]
  48. Sebbane F, Bury-Moné S, Cailliau K, Browaeys-Poly E, De Reuse H, Simonet M. The Yersinia pseudotuberculosis Yut protein, a new type of urea transporter homologous to eukaryotic channels and functionally interchangeable in vitro with the Helicobacter pylori UreI protein. Mol Microbiol. 2002;45:1165–1174. doi: 10.1046/j.1365-2958.2002.03096.x. [DOI] [PubMed] [Google Scholar]
  49. Mobley HL, Island MD, Hausinger RP. Molecular biology of microbial ureases. Microbiol Rev. 1995;59:451–480. doi: 10.1128/mr.59.3.451-480.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Straley SC, Perry RD. Environmental modulation of gene expression and pathogenesis in Yersinia. Trends Microbiol. 1995;3:310–317. doi: 10.1016/S0966-842X(00)88960-X. [DOI] [PubMed] [Google Scholar]
  51. van Vliet AH, Kuipers EJ, Waidner B, Davies BJ, de Vries N, Penn CW, Vandenbroucke-Grauls CM, Kist M, Bereswill S, Kusters JG. Nickel-responsive induction of urease expression in Helicobacter pylori is mediated at the transcriptional level. Infect Immun. 2001;69:4891–4897. doi: 10.1128/IAI.69.8.4891-4897.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Contreras-Rodriguez A, Quiroz-Limon J, Martins AM, Peralta H, Avila-Calderon E, Sriranganathan N, Boyle SM, Lopez-Merino A. Enzymatic, immunological and phylogenetic characterization of Brucella suis urease. BMC Microbiol. 2008;8:121. doi: 10.1186/1471-2180-8-121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Jones BD, Mobley HL. Genetic and biochemical diversity of ureases of Proteus, Providencia, and Morganella species isolated from urinary tract infection. Infect Immun. 1987;55:2198–2203. doi: 10.1128/iai.55.9.2198-2203.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Mobley HL, Cortesia MJ, Rosenthal LE, Jones BD. Characterization of urease from Campylobacter pylori. J Clin Microbiol. 1988;26:831–836. doi: 10.1128/jcm.26.5.831-836.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Bandara AB, Contreras A, Contreras-Rodriguez A, Martins AM, Dobrean V, Poff-Reichow S, Rajasekaran P, Sriranganathan N, Schurig GG, Boyle SM. Brucella suis urease encoded by ure1 but not ure2 is necessary for intestinal infection of BALB/c mice. BMC Microbiol. 2007;7:57. doi: 10.1186/1471-2180-7-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Thune RL, Fernandez DH, Benoit JL, Kelly-Smith M, Rogge ML, Booth NJ, Landry CA, Bologna RA. Signature-tagged mutagenesis of Edwardsiella ictaluri identifies virulence-related genes, including a salmonella pathogenicity island 2 class of type III secretion systems. Appl Environ Microbiol. 2007;73:7934–7946. doi: 10.1128/AEM.01115-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1

Nucleotide and deduced amino acid sequences of ure gene cluster of Y. enterocolitica biovar 1A. The nucleotide sequence of the ure gene cluster of Y. enterocolitica biovar 1A and the deduced amino acid sequences of the structural (A, B, and C) and accessory (E, F, G and D) proteins are shown. Putative ribosome binding site consensus sequences upstream of ureA, ureB, ureC, ureF and ureG are in bold face. Stop codons are indicated by an asterisk.

Click here for file (100.2KB, PDF)
Additional file 2

Phylogenetic relationships of urease structural (UreA, UreB and UreC) proteins. Dendrograms showing phylogenetic relationships of Yersinia spp. including Y. enterocolitica biovar 1A and other bacterial species based on amino acid sequence of urease structural proteins (UreA, UreB and UreC). The trees were constructed by the neighbor joining method in MEGA 4.0 package. The bootstrap values presented at corresponding branches were evaluated from 1,000 replications. GenBank accession numbers are indicated for strains used in creating the dendrogram. The bar scale shows substitutions per site.

Click here for file (106.3KB, PDF)
Additional file 3

Phylogenetic relationships of urease accessory (UreE, UreF UreG and UreD) proteins. Dendrograms showing phylogenetic relationships of Yersinia spp. including Y. enterocolitica biovar 1A and other bacterial species based on amino acid sequence of urease accessory proteins (UreE, UreF, UreG and UreD). The trees were constructed by the neighbor joining method in MEGA 4.0 package. The bootstrap values presented at corresponding branches were evaluated from 1,000 replications. GenBank accession numbers are indicated for strains used in creating the dendrogram. The bar scale shows substitutions per site.

Click here for file (110.9KB, PDF)
Additional file 4

PCR-RFLP of ureAB of Y. enterocolitica. DNA was amplified with primers ureAB3-ureAB4 and restriction digested using (A) HaeIII and (B) Sau96I enzymes. Lanes 1: IP27403, 2: IP26305, 3: E1281550, 4: P346, 5: P472, 6: IP27387, 7: STM 126, 8: 0310/90, 9: IP27938, 10: IP27879, 11: IP27873, 12: IP24121, 13: IP134, 14: IP26329, 15: IP26249, 16: 8081. M: Molecular mass marker (100 bp ladder, New England BioLabs); BV: biovar.

Click here for file (50.7KB, PDF)
Additional file 5

Effect of urea/nickel chloride on activity (A) and expression (B) of urease of Y. enterocolitica. Strain IP27403 was grown in Luria Broth (LB) or in LB supplemented with 16.7 mM urea (LB-urea) or NiCl2 at 1 μM (Ni-1), 10 μM (Ni-10), 100 μM (Ni-100) and 200 μM (Ni-200) concentration. M: Medium range protein ladder (Bangalore Genei). Data points represent mean of triplicate determinations; error bars denote standard deviation.

Click here for file (64.3KB, PDF)

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES