Abstract
The mouse spinal cord is an important site for autoimmune and injury models. Skull thinning surgery provides a minimally invasive window for microscopy of the mouse cerebral cortex, but there are no parallel methods for the spinal cord. We introduce a novel, facile and inexpensive method for two-photon laser scanning microscopy of the intact spinal cord in the mouse by taking advantage of the naturally accessible intervertebral space. These are powerful methods when combined with gene-targeted mice in which endogenous immune cells are labeled with green fluorescent protein (GFP). We first demonstrate that generation of the intervertebral window does not elicit a reaction of GFP+ microglial cells in CX3CR1gfp/+ mice. We next demonstrate a distinct rostro-caudal migration of GFP+ immune cells in the spinal cord of CXCR6gfp/+ mice during active experimental autoimmune encephalomyelitis (EAE). Interestingly, infiltration of the cerebral cortex by GFP+ cells in these mice required three conditions: EAE induction, cortical injury and expression of CXCR6 on immune cells.
Keywords: Rodent, EAE, cell trafficking, microscopy, chemokines
1. INTRODUCTION
1.1. Two photon laser scanning microscopy and CNS intravital surgeries
Two-photon laser scanning microscopy (TPLSM) has revolutionized the study of the nervous system and the immune system by providing dynamic views of sub-cellular structures and cells in a tissue context in vivo (Denk et al., 1994; Miller et al., 2003). These methods generally require surgical exposure of the tissue of interest with resulting potential for induction of inflammation, which may contaminate observations. Imaging of the intact CNS has been accomplished in vivo using thinned skull methods, in which imaging is performed through a thin plate of bone without the need for a craniotomy (Grutzendler et al., 2002; Xu et al., 2007). Microscopy of the living mouse spinal cord reported to date requires a laminectomy, the removal of the vertebral bone, with potential disturbance of the underlying dura and the surface of the spinal cord (Engelhardt et al., 2003; Odoardi et al., 2007; Davalos et al., 2008). The exposed spinal cord in this system is vulnerable to sterile injury and foreign materials that may contain innate immune activators such as endotoxin. Such injury has been reported in intravital microscopy observations through a craniotomy, but not with the thinned skull method (Xu et al., 2007). Induction of the microglial injury response is a sensitive measure of such damage (Davalos et al., 2005; Kim and Dustin, 2006). The underlying tissue is also potentially more vulnerable to additional inflammatory artifacts such as acute neutrophil recruitment (Kim and Dustin, 2006). These shortcomings of the existing methods prompted us to devise a method for microscopy of the living mouse spinal cord that does not require laminectomy, but leaves the dura fully intact by taking advantage of the natural intervertebral space as an imaging window.
We applied our intervertebral window to determine the dynamic behavior of immune cells in experimental autoimmune encephalomyelitis (EAE), a mouse model for inflammatory aspects of multiple sclerosis (MS) (Zamvil et al., 1985; Zamvil and Steinman, 1990). EAE is characterized by white matter inflammation with T cell infiltration in the optic nerves, the spinal cord and the cerebellum (Bettelli et al., 2003; Wensky et al., 2005) and evaluated based on an ascending paralysis, starting with tail weakness, progressing to hind-limb weakness and in most severe cases involving forelimb paralysis. Paralysis is associated with white matter inflammatory lesions in the spinal cord that include CD4+ T cells generally without substantial T cell accumulation in the gray matter. The dynamics of these cells in the intact spinal cord during EAE is not known.
1.2. Role of CXCR6 in EAE
Three chemokine receptors have been implicated in guidance of T cells into the central nervous system. In the steady state, a population of memory T cells enters the cerebrospinal fluid (CSF) via the choroid plexus (Kivisakk et al., 2003; Kivisakk et al., 2004). These cells are highly enriched for expression of CCR7 and active PSGL-1, which suggests these molecules are involved in CNS entry. Recent reports also indicate that the induction of EAE involves the CCR6 dependent entry of Th17 type CD4+ T cells through the choroid plexus (Reboldi et al., 2009). These cells then trigger the CCR6 independent recruitment of additional T cells and myeloid cells via parenchymal vessels. Antibodies to CXCL16 (ligand to CXCR6) reduce EAE severity (Fukumoto et al., 2004). Although CXCL16 also functions as a scavenger receptor referred to as the scavenger receptor that binds phosphatidylserine and oxidized lipoprotein (SR-PSOX) (Shimaoka et al., 2000), CXCR6 (also called BONZO, STRL33 and TYM-STR), the CXCL16 receptor (Matloubian et al., 2000; Shimaoka et al., 2000) could be important in T cell infiltration in EAE. CXCL16 is expressed on potential antigen-presenting cells including dendritic cells (Matloubian et al., 2000), macrophages (Shimaoka et al., 2003) and astrocytes (Ludwig et al., 2005) and, is a chemokine receptor that is expressed in activated CD4+ T cell subsets (Loetscher et al., 1997; Matloubian et al., 2000), NKT cells (Matloubian et al., 2000), and activated CD8+ T cells (Matloubian et al., 2000; Sato et al., 2005). CXCR6 is known to be associated with antigen specific interferon-γ producing cells in multiple sclerosis (MS) (Calabresi et al., 2002). Therefore, we have further examined the role of CXCR6 in EAE here.
We used mice in which the major coding exon of CXCR6 has been replaced with GFP in gene-targeted mice (Unutmaz et al., 2000) in which CXCR6 expressing cells can be tracked in vivo (Geissmann et al., 2005). The heterozygous mice (CXCR6gfp/+) have half the wild type levels of CXCR6 and express cytoplasmic GFP, while the homozygous mice (CXCR6gfp/gfp or CXCR6−/−) lack CXCR6 expression, but instead express only cytoplasmic GFP (Geissmann et al., 2005). We utilized this mouse strain on the B6 background to study the dynamics of GFP+ cells in the living mouse spinal cord and brain during EAE. CXCR6+ cells migrated rapidly in the spinal cord with a rostrocaudal bias in a CXCR6 independent manner. Unexpectedly, our studies also addressed the molecular basis of T cell infiltration into cortical injury sites in the context of EAE.
1.3. An inflammation model for initiating cortical MS lesions
MS is also characterized by cortical lesions with inflammation which may contribute to inducing direct damage to neurons and neurites (Bo et al., 2003; Geurts and Barkhof, 2008). Cortical demyelinating lesions can be either leukocortical, involving the cortex and the adjacent subcortical white matter, or subpial, involving the first three layers of cortex without associated white matter demyelination (Moll et al., 2008). In very late stage chronic progressive MS cortical lesions contain relatively few T cells. However, recent studies of sub-pial cortical lesions in relapsing-remitting MS show abundant T cell and macrophage inflammation in the affected gray matter (Moll, N., R.M.R., B. Kelley, J.E. Parisi, and C. Lucchinetti. personal communication). Gray matter lesions could precede cognitive deficits and increase the morbidity of MS (Geurts and Barkhof, 2008). Perry and colleagues developed a rodent model for cortical inflammation based on stereotactic injection of heat-killed bacillus Calmette-Guérin (BCG) in the parenchyma and subcutaneous inoculation with complete Freund’s adjuvant, which contains heat killed Mycobacterium tuberculosis (MTB) (Matyszak and Perry, 1998). Either stimulus alone was insufficient to induce demyelination (Matyszak and Perry, 1995). In mice, one can image sterile cortical injury through a thinned skull window (Grutzendler et al., 2002), but this appears to be a local reaction, much like that to injection of BCG into the parenchyma. Injury in the context of inflammation elsewhere in the tissue may lower the threshold of the blood brain barrier through effects of cytokines (Schnell et al., 1999; Sun et al., 2004).
Therefore, since classical EAE models in the mouse do not demonstrate cortical lesions, we examined recruitment of T cells in response to the combination of EAE and laser injury in layer 1 barrel cortex (Davalos et al., 2005).
2. MATERIALS AND METHODS
2.1. Transgenic mice
CXCR6+/gfp, CXCR6gfp/gfp and CX3CR1+/gfp, and LysMgfp/+ mice were a gift of D.R. Littman (NYU School of Medicine, New York, NY) (Jung et al., 2000; Geissmann et al., 2005) and Thomas Graf (AECOM, Bronx, NY)(Faust et al., 2000), respectively. All strains were backcrossed onto C57BL/6 for at least 12 generations and housed in specific pathogen-free conditions in accordance with Institutional Animal Care and Use Committee protocols of New York University School of Medicine.
2.2. Peptides
The Dana-Farber Cancer Institute Molecular Biology Core Facility (Boston, MA) synthesized peptides.
2.3. Quantitative PCR
We perfused anaesthetized mice with PBS containing 2 mM EDTA. We isolated brain and spinal cord and snap froze in liquid Nitrogen and stored in −80 °C until further processing. We isolated RNA from tissue with TRIzol (InVitrogen, Carlsbad, CA), and treated with DNase I from which we generated cDNA using Superscript III enzyme system (InVitrogen) and amplified with ABI 7900 cycler (Applied Biosystems, Foster City, CA). The primer and probe oligonucleotides used for CXCL16 were, cxcl16-forward, ggaagccaagaccagtgggt, cxcl16reverse, tttggtggtgaaaactcttccc and cxcl16 probe, [6-fam]ttgagcgcaaagagtgtggaactggtc[TAMRA]. We used HPRT and G6PD for internal control housekeeper genes, HPRT-forward, aggttgcaagcttgctggt, HPRT-reverse, tgaagtactcattatagtcaagggc, and HPRT probe, [5TET]tgttggatacaggccagactttgttggat[TAMRA], and G6PD-forward, tgaagctccctgatgcctat, G6PD-reverse, caatcttgtgcagcagtggt, and G6PD probe [5TET]gaagcctggcgtatcttccac[TAMRA]. Cycle temperatures were 50°C for 2 min, 95°C for 2 min, 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. We performed melting curve analyses at the genomics core facility of the NYU Cancer Institute.
2.4. Surgery and experimental procedures
2.4.1. EAE
We induced classical EAE with MOG peptide in CFA and pertussis toxin (Mendel et al., 1995). Briefly, we injected 100 μg MOG (35-55) peptide (MEVGWYRSPFSRVVHLYRNGK) emulsified in CFA with heat killed mycobacterium tuberculosis (4 mg/ml) at the base of the tail on day 0 and pertussis toxin (100 ng in sterile saline) into the tail vein on days 0 and 2. We scored mice for EAE as follows: 0, no disease; 1, tail paralysis; 2, hind limb weakness; 3, hind limb paralysis; 4, fore limb weakness; 5, moribund. We hydrated mice with scores >2 daily and sacrificed for score ≥ 4.
2.4.2. Thinned skull and laser injury
In all the intravital imaging described below, we maintained anesthetized mice on warming plates and the intravital window through an objective heater to maintain core temperature at 37°C. We performed thinned skull intravital window surgeries and laser ablation as previously described (Grutzendler et al., 2002; Davalos et al., 2005). The size of injury induced was typically ~15 μm in diameter. We defined vascular spaces by intravenous injection of 655 nm emitting quantum dots (R&D Systems, Minneapolis, MN).
2.4.3. Intravital spinal cord
(See Figure 1 and Results (3.1) for details of the method.) We anesthetized mice and exposed the thoracic spine by dissecting the overlying muscle and connective tissue. We bent a thin stainless steel plate with an open central slot to separate the inner edges of the plate to engage two adjacent vertebrae in a funnel clamp and then immobilized the plate by attaching it to two posts using screws. We then acquired Images through the thinned intervertebral connective tissue sealed above with 2% low melting agarose (Sigma, St. Louis, MO) and a cover glass over the area.
Figure 1. Intervertebral intravital window.
(A) 2-3 dulled razor blades are cemented together to produce a more stable steel plate. Inner wings of the blade are bent to serve as funnel clamps. (B) This bent plate is then inserted on either side of the thoracic spinal vertebral bone in an anaesthetized mouse after cutting the thoracic muscles on either side of the spine. (C) A second flat plate is glued perpendicularly to the first to immobilize the mouse to the magnetic posts on either side of the holding plate. (D) The resultant anatomy and intravital window imaged through the objective is illustrated in this schematic. The intervertebral space is dissected down to leave the dura layer of about 50 μm and 2% agarose in aCSF is overlayed to further dampen any organ movement without inducing pressure. A microscope coverglass then seals the intravital window for which water or oil immersion objectives can be used. (E) The anaesthetized mouse is placed under the objective on a 37°C surface with low flow oxygenation mask. The objective heater also provides a close temperature control to the intravital window. (F and G) The intervertebral space with the spinal cord and the posterior spinal vein are translucently visible under the coverglass.
2.5. Two photon microscopy
We tuned a mode locked Ti-Sapphire laser (Spectraphysics) connected to a Bio-Rad Radiance multiphoton microscope to 920 nm to excite GFP and quantum dots (Shakhar et al., 2005), and acquired stacks of images using step sizes of 1–3 μm to a depth of 200 μm bellow the skull using ×40 or ×60 water dipping objectives. We then generated time-lapse movies with 1- to 1.5-min intervals between 3D stacks.
2.6. Data analysis
We used Volocity software (Improvision, Waltham, MA) to track T cell movements. We obtained cell counts within three-dimensional volumes to calculate cells/mm3. We determined average speed by using mean value of instantaneous speeds spanning 20-30 min. Confinement index is the ratio of displacement to path length with a range of 0 to 1. Immobile fraction is the percent of cells with average displacement rate of < 1 μm/min over a 30 min interval and can be visualized as cells whose movements are confined within a maximum confinement radius of 30 μm (Sims et al., 2007). One-dimensional motility coefficient is the square of mean displacement divided by 2t1/2 (Adachi et al., 2003; Sumen et al., 2004). We determined statistical significance (p < 0.05) using a Student’s t test and a Mann-Whitney rank sum test for populations with non-Gaussian distributions.
3. RESULTS
3.1. Intervertebral spinal cord microscopy preparation
We first devised an inexpensive apparatus to immobilize and create an intervertebral window to image the intact spinal cord in a live anaesthetized mouse (Figure 1). We manipulated standard double edge razor blades to generate a spinal cord clamp and mounting system with correct dimensions for an adult mouse. We assembled the apparatus in three stages: in the first stage, a small stack of 2-3 cemented blades served as a spring clamp to hold the vertebral column; in the second stage, we immobilized this bottom plate by cementing to a transverse blade that was firmly attached to two posts to a position resulting in a stabilized mouse; and in the third stage, a small amount of low melt agarose further stabilized the intact dura and the underlying spinal cord for high-resolution imaging. Bending the inner tabs at 45° below the plane generated a spring clamp to hold the spinal cord (Figure 1A). A midline dorsal incision exposed the thoracic muscles over ~T3 to T7, which are dissected free from the sides of the vertebral bone in an anaesthetized mouse. The bent bottom plate separated the tabs, which in turn can grip either side of the vertebral bone T3-T7 vertebrae (Figure 1B). We then cemented a second plate composed of two razor blades transversely to the bottom plate such that the large central opening is aligned over the intervertebral space. We then secured the top plate to two magnetic posts on either side of the mouse that are positioned to partly lift the thoracic region off the underlying heating plate to reduce effects of breathing movements on the stability of the spinal cord (Figure 1C). We can then carefully peeled the intervertebral fascia leaving the intact dura (~ 50 μm) to protect the spinal cord and further dampen the spinal cord motions by sealing with a drop of low melt agarose on the dura and a coverglass (Figure 1D). The curvature of the mouse thoracic spin resulted in a very natural posture of the anesthetized mouse in the apparatus (Figure 1E). The white matter to either side of the central vein was visible through the intervertebral window after removal of the fascia and application of the agarose and coverslip (Figure 1F and G). We verified that microglial cells in CX3CR1+/gfp mice did not show evidence of surface injury (supplemental Figure 1) and that neutrophils from LysMgfp/+ mice did not arrest inside the vessels or extravasate spontaneously over a 2 hours observation period (data not shown). With this method we isolated the inflammation of our disease model, EAE, with minimal artifacts induced by surgical trauma.
3.2. CXCR6 is not required for EAE-associated ascending paralysis
To study the behavior of inflammatory lymphocytes within the intact spinal cord and cerebral cortex we characterized reporter mice in which GFP replaces CXCR6. First, we determined the course of EAE in CXCR6gfp/+ and CXCR6gfp/gfp C57BL/6 mice compared to the wild-type (WT) by inducing EAE with MOG (35-55) peptide in CFA. EAE disease course was similar between all three groups up to day 21(Figure 2A), with mean onset of disease at day 9.7 +/− 1.25 (WT), 8.9 +/− 1.5 days (CXCR6gfp/+ ) and 9.0 +/− 1.6 (CXCR6gfp/gfp ) days (Figure 2C), mean maximal score of 2.75 +/− 0.75 (WT), 2.7 +/− 0.6(CXCR6gfp/+ ) and 2.7 +/− 0.9(CXCR6gfp/gfp ) (Figure 2D), and proportion responding of 10/10 (WT), 29/29(CXCR6gfp/+ ) and 20/22 (CXCR6gfp/gfp ) (Figure 2E), respectively. We further followed EAE disease up to 50 days between CXCR6gfp/+ and CXCR6gfp/gfp mice and found no statistical difference (data not shown).
Figure 2. CXCR6 and EAE course.
(A) CXCR6 did not affect the course of EAE at the onset, active (days 0-15) and remission phases (days 20-52) (scores ± s.d) for C57BL/6 WT (n=10) CXCR6gfp/+ (n=29) and CXCR6gfp/gfp mice (n=22) aged 9-12 weeks. (B) Day of onset defined by the day on which the score ≥ 1 (day ± s.d.). (C) The mean maximum score for each genotype (score ± s.d.). (D) The fraction of animals developing EAE, which was 10/10 WT, 29/29 CXCR6gfp/+ and 20/22 of the CXCR6gfp/gfp (the results here are not statistically significant by Pearson’s Chi-square test).
Immunohistochemistry and flow cytometry of cells isolated from the spinal cord indicated that GFP+ T cells were CD4+ (supplemental Figures 2-5) and were pro-inflammatory since less than 5% expressed FOXP3 (data not shown). Although 2/22 animals in the CXCR6gfp/gfp group remained completely healthy, this was not statistically significant when compared to the heterozygous mice. These healthy mice were not included in the analysis or imaging experiments due to concerns that there may have been problems with the inoculation given that the other 20 animals had a very similar disease course to the CXCR6gfp/+. We concluded that CXCR6 is not required for ascending paralysis in this model of EAE and thus these mice can be used to study the migratory behavior of inflammatory T cells in the spinal cord.
3.3. T cell movement is biased in the spinal cord
The GFP expression by the CXCR6gfp/+ and CXCR6gfp/gfp mice enabled imaging the behavior of inflammatory T cells in the spinal cord of living mice with EAE and to examine whether CXCR6 contributes to migration patterns. We imaged the spinal cord through the intervertebral space in the thoracic spine area by TPLSM in CXCR6gfp/+ (n=10 animals) and CXCR6gfp/gfp (n=5) mice with EAE (Figure 3A&B; Movie 1). GFP+ cells were mostly confined to the spinal cord white matter based immunofluorescence histology (Supplementary Figure 2). Two photon imaging in perfused thick sections demonstrated that GFP+ cells also rarely penetrated into the underlying gray matter, which can be distinguished from white matter based upon differential autofluorescence (supplementary Figure 3). Furthermore, the GFP+ cells were positive for CD4 but negative for CD8, NK1.1, CD11b and CD11c (supplemental Figures 2, 4 and 5 ). There were no significant differences in numbers of GFP+ cells or their movement between CXCR6gfp/+ and CXCR6gfp/gfp mice: the mean speeds were 4.9 μm/min and 4.7 μm/min (Figure 3C), the mean confinement indices were 0.53 and 0.53 (Figure 3D) and the mean arrested fractions were 22.2% and 26.2% (Figure 3E), respectively. Arrested cells may represent autoantigen specific T cells forming immunological synapses with APC. The CXCR6 expressing T cells include autoreactive T cells in MS (Calabresi et al., 2002), but will also include many activated T cells specific for non-CNS antigens (Zamvil and Steinman, 1990). Visual inspection of the movies showed that GFP+ cells in both genotypes displayed movement that was strikingly biased in that the cells moved more on the rostrocaudal axis than the left-right axis. To quantify this bias in GFP+ cell movement, we aligned the rostrocaudal axis of the spinal cord with the y-axis of our analysis grid and plotted the x and y coordinates of the trajectories (Figure 3F) from 30 minute long intravital movies. Statistically significant difference between x (CXCR6gfp/+, 7.5 ± 0.9 μm; CXCR6gfp/gfp, 5.9 ± 0.8 μm) and y displacements (CXCR6gfp/+, 13.4 ± 1.5 μm; CXCR6gfp/gfp, 13.0 ± 1.4 μm) between 1.5 to 9 min was found with p < 0.001 for both genotypes (Figure 3G). This analysis confirmed that movement was biased along the rostrocaudal axis. GFP+ cells in CXCR6gfp/+ and CXCR6gfp/gfp genotypes exhibited similar rostrocaudal bias between 1.5 to 9 mins (p= 0.06 for x and p=0.75 for y). Plotting the y-displacement against the square root of time yielded a linear plot consistent with a linear random walk, whereas plotting the x-displacement against the square root of time showed a plateau, consistent with confinement (Figure 3H). This analysis strongly indicated that the GFP+ cell movement is described by a rostrocaudal biased random walk with confined lateral movement.
Figure 3. Spinal cord T cell dynamics in EAE determined by TPSLM.
(A& B) Representative intravital spinal cord 2-photon images from both sides of the posterior spinal vein of a CXCR6gfp/+ mouse at day 14 of EAE. GFP+ cells are shown in white and the vasculature, in red. Tracks of the GFP+ cells are outlined from a time-lapse movie spanning 30 min (see the corresponding Movie 1). Scale bar (A+ B) = 50 μm. Average speed(C), confinement indices (D) and immobile fractions (E) from CXCR6gfp/+ (n=10 animals) and CXCR6gfp/gfp (n=5 animals) mice with stable active disease at EAE days 11-18. (F) Tracks of CXCR6gfp/+ (black) and CXCR6gfp/gfp (red) movement over 30 minutes show apparent rostrocaudal migrational bias (each panel represents one animal). The + direction in y is toward the head. (G) Rostrocaudal (y) vs. left-right (x) displacements over 9 min for each track in n ≥ 4 animals and n ≥ 80 cells for each category. Scales for x and y values are in μm. (H) Rostrocaudal (y) vs. left-right (x) displacements vs. square root of time for CXCR6gfp/+ (black) and CXCR6gfp/gfp (red) cell movement. Open and closed symbols represent x and y displacement, respectively (n ≥ 4 mice in each category). The asterisks signify statistical significance.
3.4. Gray matter infiltration in EAE requires CXCR6
In contrast to MS, the monophasic mouse EAE model does not display gray matter lesions (Zamvil and Steinman, 1990). Therefore, it is not surprising that GFP+ cells were not detected in the cortical gray matter while imaging through thinned skull windows of CXCR6gfp/+ or CXCR6gfp/gfp mice with EAE. One reason for the lack of subpial cortical lesions in EAE could be the relatively shorter time frame of the EAE process compared to that of MS. We hypothesized that in humans the neuroinflammation associated with MS may be combined in a long life-time of small, sterile injuries in the cerebral cortex, which may in combination serve as a nidus for cortical lesions in MS. In order to model the effects of small sterile injury in the context of EAE, we applied a previously established injury model in which we induced acute gray matter injury using a brief exposure to radiation from the femtosecond pulsed laser (Davalos et al., 2005). We reported that such microscopic injuries do not disrupt the blood-brain barrier or induce leukocyte infiltration in healthy mice (Kim and Dustin, 2006). Consistent to this previous finding, there was no T cell infiltration to gray matter parenchymal injury focus in healthy mice based on the absence of GFP+ cells detected through thinned skull windows by TPLSM in injured CXCR6gfp/+ mice over 7 days observation period (data not shown). We chose a stable period of EAE (days 16-20) to monitor the injured brain intravitally through the thinned skull window using TPLSM in anaesthetized mice after inducing a single sterile focal laser injury (~15 μm in diameter). We found that in mice with EAE, injury caused a significant infiltration by GFP+ cells around the injury site in the cortex of CXCR6gfp/+ mice, but not, in CXCR6gfp/gfp mice. 3D rendering of such an injury site revealed subpial infiltration of GFP+ cells around the laser injury (arrow) (Figure 4A). We excluded that meningeal inflammation induced by repeated thin skull procedures contributed to the GFP+ cell infiltration by quantifying cells that are farther than 60 μm from the skull (i.e. not in the meninges)(Figure 4B,D) (Kim and Dustin, 2006). GFP+ cell recruitment began as early as 24 hours after injury, peaked between days 4 and 10 in 4 different CXCR6gfp/+ mice with EAE score 1-2, and then waned to basal levels by day 21 after injury (Figure 4D). In contrast, the same type of injury did not recruit GFP+ T cells into the parenchyma of CXCR6gfp/gfp mice with a similar EAE disease score to the CXCR6gfp/+ mice (Figure 4C,D). The increased infiltration of GFP+ cells into cortical injury sites in mice with EAE compared to healthy mice may be due to increased abundance of GFP+ effector cells in circulation in addition to increased permeability of the blood brain barrier induced by circulating cytokines from the vaccination site and draining lymph nodes. To test this possibility, we vaccinated CXCR6gfp/+ mice (n=5) with ovalbumin in CFA with pertussis toxin (on days 0 and 2). We then induced laser injury into the barrel cortex on day 7 after vaccination, the peak of this response, and found no infiltration of GFP+ cells to the injured focus under these circumstances. Therefore, the accumulation of GFP+ cells in the gray matter after laser injury requires both CXCR6 and CNS inflammation. This result is consistent with work by Perry and colleagues (Matyszak and Perry, 1995; Matyszak and Perry, 1996b; Matyszak and Perry, 1996a; Matyszak and Perry, 1998), in which BCG implanted in the CNS did not elicit a T cell response unless mice were vaccinated with CFA in the periphery.
Figure 4. CXCR6 dependent recruitment of T cell into injured brain in EAE.
The images are all 3D reconstructions that include the thinned skull (blue) the vasculature (red) and the GFP+ T cells (green). (A) Area around a laser injury in a CXCR6gfp/+ mouse with laser injury at day 17 of EAE and imaged on day 27 (10 days post injury). (B) Thinned skull control in CXCR6gfp/+ mouse with EAE showing an example of some GFP+ cells in the meninges, but few in the parenchyma. (C) CXCR6gfp/gfp mouse with injury showing rare GFP+ cells in meninges and perivascular spaces 10 days after injury. Representative images of at least n=3. Grid scale for A-C, 30 μm. Arrows in A and C show the depth level of laser injury. (D) Number of GFP+ cells recruited in the brain parenchyma > 60 μm below the bone undersurface (Kim and Dustin, 2006) as a function of time in CXCR6gfp/+ and CXCR6gfp/gfp mice. Each curve represents a mouse. (E) Quantitative PCR of CXCL16 mRNA from whole brain tissue at various days after EAE induction and injury in CXCR6gfp/+ and CXCR6gfp/gfp mice (n=3 mice per bar graph). Controls are mice without EAE on days 15 and 26.
3.5. EAE induces CXCL16 expression in the brain
Although the small size of the subpial laser lesion precluded characterization of the GFP+ cells in the injury focus by histology, global CXCL16 expression in the brain was evaluated by qPCR (Figure 4E). CXCL16 signal was undetectable in the brains of healthy mice. However, the levels of CXCL16 mRNA increased dramatically during EAE in both CXCR6gfp/+ and CXCR6gfp/gfp mice with or without laser injury. Therefore, CXCL16 mRNA is increased in EAE brain tissue, but was not sufficient on its own to induce CXCR6+ immune cell infiltration. T cell accumulation in the cortex required an additional event, provided in our study by the sterile laser injury.
3.6. CXCR6+ cells decelerate and become confined close to the injury focus
The dynamics of the accumulated GFP+ cells in the gray matter was analyzed by 3D tracking of cell movements by TPLSM through the thinned skull. Inspection of the movies revealed that the GFP+ cells formed a highly dynamic swarm around the injury site with cells farther from the injury moving faster than cells close to the injury, which were sometimes arrested (Figure 5). The average speed of the distant cells was statistically indistinguishable from that of the cells in the spinal cord at 4.7 ± 2.5 (day 4 post injury) and 5.4 ± 1.6 (day 10 post injury) μm/min (mean ± s.d.) (Figure 5C) but with less confinement than in the spinal cord with a confinement index of 0.69 ± 0.21 (day 4 post injury) and 0.67 ± 0.26 (day 10 post-injury) (Figure 5D). In contrast, the cells within 50 μm of the injury site decelerated to 2.2 ± 1.1 (day 4 post-injury) and 3.1 ± 1.9 (day 10 post-injury) μm/min (Figure 5C) and were more restricted in movement than both the cells outside the 50 μm radius of injury and those in the spinal cord with a confinement index of 0.42 ± 0.26 (day 4 post-injury) and 0.38 ± 0.28 (Figure 5D).
Figure 5. Dynamics of GFP+ T cells in the gray matter.
(A&B) TPLSM 40 μm z-stack through thin skull revealed a laser injury of about 15 μm in diameter at 50 μm below the brain surface induced on day 17 of EAE in a CXCR6gfp/+ mouse. GFP+ cells are recruited to the gray matter injury focus on day 10 after injury; GFP+ cells in green, vasculature in red, bone in blue, and the center of the autofluorescent injury site marked with a yellow asterisk in A. A and B are the same images with tracks superimposed for injury proximal and distal cells (corresponds to Fig. 4A and movie 2). C, D- plots of cell speed and confinement coefficient as a function of distance from the injury site (n=3 mice, each category). Close and far indicate within and greater than 50 μm from injury focus.
4. DISCUSSION
We report a new intravital apparatus and methodology, both simple and inexpensive, for TPLSM of the intact mouse spinal cord. We then used this apparatus and the related thinned skull methods for intact cerebral cortex to examine the role of CXCR6 in the MOG(35-55) EAE-B6 mouse model. There was no difference in disease course or intravital GFP+ cell dynamics in the spinal cord between CXCR6gfp/+ and CXCR6gfp/gfp mice. However, we report for the first time a preference for rostrocaudal movement by the infiltrating T cells within the living spinal cord in both genotypes. Surprisingly, a reversible recruitment of CXCR6gfp/+, but not CXCR6gfp/gfp T cells, was induced in response to a focal sterile injury inside the gray matter of the brain parenchyma during EAE. Finally, we demonstrate that CXCL16 expression is upregulated in the brain during EAE, but that this signal is not sufficient to induce gray matter infiltration by GFP+ immune cells in CXCR6gfp/+ mice without additional conditions established by a small sterile injury.
4.1. Spinal cord intravital window
Our surgical strategy was practical for visualizing the intact spinal cord. The thoracic spine curvature is naturally amenable for maximizing the size of the intervertebral space. This method is both accessible and adoptable in any laboratory; it is inexpensive and does not require prolonged surgical training. A minor disadvantage compared to laminectomy is that the small field of view that limits the tracking distance (maximum ~300 μm). However, we have successfully extended the rostrocaudal field of view on either end of the intervertebral space for an additional ~300 μm by thinning adjacent laminar bones in lieu of laminectomy to produce an intravital window through the bone similar to the thinned skull procedure (Grutzendler et al., 2002) (JVK, unpublished findings). The quality of imaging is similar through the thinned bone and the intervertebral space. A second limitation of this method is that due to the extensive dissection of most of the dorsal muscles to expose the sides of the vertebral bone we can only recommend it as a terminal procedure not amenable to longitudinal studies. An apparatus that can hold the same points in the vertebral bone, but not require extensive dissection of the muscle tissue could allow longitudinal studies in the mouse spinal cord. A third limitation is that the intravital window examines the spinal cord under thoracic rather than lumbar spine, where the most highly disease correlated lesions are found (Mendel et al., 1995). Therefore, our findings of T cell dynamics may not reflect T cells in the disease-correlated EAE foci in the lumbar spine. However, on staining for myelin basic protein (MBP) in the EAE afflicted mice used in our studies, we found diminished MBP staining in the white matter extending into the thoracic spinal cord regions (data not shown). Thus, our imaging does reflect areas that are infiltrated to an extent that leads to demyelination, although not as severe as in the lumbar region. By imaging thoracic rather than lumbar areas we may observe T cell dynamics at the advancing edge of lesions in EAE rather than the core of demyelinated foci. A fourth limitation is that the gray matter of the spinal cord cannot be imaged as they lie deeper than 1 mm below the surface.
4.2. Rostrocaudal migrational bias
We report for the first time that the effector T cells migrate preferentially along the rostrocaudal spinal cord axis during EAE. There may be several mechanisms for this phenomenon. One possibility is that T cells may be migrating along myelinated axons or their extracellular matrix sheaths, which are oriented along the rostrocaudal axis and this anatomical environment of the spinal cord may play a similar role in guiding T cell migration in the spinal cord as the stromal cell network in lymph nodes (Bajenoff et al., 2006). Alternatively, rather than be guided, barriers to lateral movement in the white matter may confine T cells. It is difficult to distinguish these possibilities in the absence of direct visualization of guiding or confining elements. The stromal elements in the spinal cord white matter are oriented with the fiber tracts paralleling the predominantly rostrocaudal migration pattern we observe for GFP+ cells (Peters et al., 1991; Huang et al., 2007). T cells may then preferentially encounter APCs that are positioned along these tracks. This biased migration guided or confined by oriented fiber tracks provides a mechanism for spread of inflammation within the spinal cord during EAE (Peters et al., 1991; Huang et al., 2007). We note that previous intravital TPLSM publications using laminectomy to expose the rat spinal cord did not report this striking T cell behavior thus far (Kawakami et al., 2005; Odoardi et al., 2007). There are at least three possibilities for this difference. First, we are not using a T cell transgenic system and the observed infiltrating T cells in the spinal cord are presumably polyclonal with a spectrum of affinities for locally expressed mMHC. Therefore, we may be seeing a higher percentage of lower affinity T cells and bystander T cells, which do not arrest significantly on antigen presenting cells and thus emphasize scanning behavior. Second, the laminectomy performed in the rat model may disrupt this pattern of movement. Consistent with this, Engelhardt and colleagues reported that their laminectomized intravital spinal cord preparation was stable for only ~30 min (Engelhardt et al., 2003), suggesting inflammatory changes from the procedure at longer times that may increase T cell arrest. Third, we may be visualizing this axial motion more readily because the thoracic spinal cord is infiltrated by T cells, but suffers less severe damage than the lumbar region, in which the rostrocaudal tracks may be destroyed by advanced demyelination.
Another possibility for the axial bias in T cell migration may be due to newly formed extracellular matrix (ECM) structures and cells in inflamed spinal cord. For example, during LCMV meningitis ER-TR7+ cells on pial surface are extensively infected and also appear to serve as a substrate for T cell migration (Kim et al., 2009). In other examples, in both human MS tissue (Mohan et al., 2008) and mouse CNS toxoplasmosis brain (Wilson et al., 2009), T cells adhere to inflammation-induced ECM. Such ECM and cellular networks induced in inflamed CNS tissue could affect the biased T cell migration we observed in this study and constitute an interesting body of future research to explore in terms of examining sequestrations of specific adhesion and chemokine molecules to these structures (Bajenoff et al., 2006).
4.3. CXCR6 is not required for EAE
We have shown that CXCR6 deficient mice were equally susceptible to EAE as CXCR6 positive mice and displayed normal levels of T cell infiltration into the spinal cord. In this study we have not examined maintenance of EAE in relapsing and remitting mouse models of EAE and therefore these should be examined for future studies. In contrast to our results with CXCR6, anti-CXCL16 antibodies reduce EAE severity (Fukumoto et al., 2004). Taken together, this suggests that the effects of anti-CXCL16 are not mediated by blocking interaction with CXCR6. Therefore, the effect of CXCL16 may be mediated by its other function as a scavenger receptor for phosphatidylserine on the surface of apoptotic cells, as well as, for oxidized lipids, which are increased in injured tissue (Shimaoka et al., 2000). Antigen presenting cells may utilize CXCL16 in uptake and processing of myelin-associated antigens for MHC class II-mediated presentation, which may be critical steps for disease progression and epitope spreading (Vanderlugt et al., 1998). CXCL16 expression is 10-fold higher in spinal cord than brain during EAE. This may be attributed to accumulation of inflammatory cells in the spinal cord, including CD11b+ macrophages, which are known to have high levels of CXCL16 (Matloubian et al., 2000; Fukumoto et al., 2004; Ludwig et al., 2005). However, inflamed endogenous cells such as astrocytes (Ludwig et al., 2005) and endothelial cells (Hofnagel et al., 2002) may also contribute to this difference. Under inflammatory conditions, astrocytes can to a lesser extent than microglia transform into active antigen presenting cells in vitro (Aloisi et al., 2000) and are certainly capable of innate immune activation (Suh et al., 2007). The elevated CXCL16 levels in the EAE may help to recruit CXCR6+ cells across the blood brain barrier into injured gray matter foci but additional unknown signals provided by injury are required for gray matter infiltration. Our imaging study provides an interesting cellular homing behavior to new injury foci in EAE. Based on our findings and the current body of research literature we have discussed many possibilities of future studies to explore the exact mechanism for both the infiltration and the slower and confined T cell dynamics adjacent to the gray matter injury in EAE mice.
4.4. CXCR6 is required for T cell entry into injured the gray matter during EAE
A limitation of most mouse EAE models is that gray matter lesions are not observed. In MS, gray matter involvement correlates with more severe disease. MRI and pathology findings demonstrate that gray matter infiltration can be significant in patients with relapsing-remitting disease (Audoin et al., 2007; Lassmann et al., 2007) and dendritic cells are located in the gray matter in chronic active disease (Cudrici et al., 2007). Cortical pathology in early relapsing MS has been demonstrated both by neuropathological evaluation and by magnetic resonance imaging studies showing gray matter atrophy at this stage of disease (Bo et al., 2006; Summers et al., 2008). Recent results demonstrate that sub-pial cortical lesions display marked T cell accumulation early in MS (Moll, N., R.M.R., B. Kelley, J.E. Parisi, and C. Lucchinetti, personal communication) - this is often carried out by comparing human MS patients MRI atrophy levels that follow previously infiltrated areas (Rudick et al., 2008).
To determine if sterile injury can occur to promote gray matter infiltration, we have extended the EAE mouse model by inducing small focal injury followed by monitoring of CXCR6-GFP+ cells. Our study suggests that CXCR6 could have a potential role in gray matter infiltration in the context of MS.
CXCR6 was required for the accumulation of activated T cells in the injured cerebral cortex in the presence of EAE. It is not known how T cells enter these injury sites since we did not directly observe the entry process. However, although it is also possible that the T cells migrated from the nearby meninges or over a greater distance from the underlying white matter, it is most likely that recruitment was through parenchymal microvessels (A. Flügel, N. Kawakami, personal communications). CXCR6-dependent accumulation may arise from increased entry, decreased egress, or could also arise from increased survival as previously shown for NKT cells (Geissmann et al., 2005). This response in the cortex was not sustained and resolved over a period of weeks. This suggests that the immune cell infiltration at the cortical injury site does trigger a sustainable cycle of tissue injury and recruitment.
An ongoing controversy surrounds the role of trauma and its relationship to triggering or worsening of EAE and MS (Phillips et al., 1995; Jung et al., 2000; Marcondes et al., 2005; Ling et al., 2006). Weller and colleagues reported exacerbated disease following cortical cryolesions. However, these large injuries appear to disrupt the blood brain barrier since activated CD8+ cells are capable of entering cryolesioned brain parenchyma independent of local antigen presence (Ling et al., 2006). It is established at least in two rodent models that injury trigger disease. In a MBP based mouse EAE model, spinal cord injury initiates disease (Marcondes et al., 2005). Antigen-specific T cell infiltration occurs along Wallerian degeneration sites where microglia express class II molecule I-A (Konno et al., 1990; Molleston et al., 1993). In the latter model, the blood brain barrier is not affected by the injury similarly to our model. Although injury has less effect in provoking inflammation in the brain than in the spinal cord and the brain (Schnell et al., 1999), systemic inflammation can alter immunological barrier and therefore the effect of CNS injury in part mediated by elaborations of in situ cytokine productions (Sun et al., 2004; Teeling and Perry, 2009). The small laser injury in the layer 1 barrel cortex in our hands is the smallest injury reported to date in EAE rodent models and demonstrated recruitment of CXCR6+ cells to the gray matter of mice afflicted with EAE, although not surprisingly given the size of injury, with no apparent side effects in the mouse or statistically significant changes in EAE scores (data not shown). We note, however that the injury site in the barrel cortex might lead to sensory changes near the whiskers, which is difficult to assess.
CONCLUSIONS
Our new intravital spinal cord method revealed a biased T cell migration in EAE spinal cord. The mechanisms remain to be further examined. Our results on CXCR6 suggest a two hit model for vulnerability of the cerebral cortex to T cell infiltration. CXCL16 expression pattern in the CNS suggests that spinal cord infiltration spills over into the brain. In fact, early T cell recruitment takes place through the choroid plexus, which supplies the CSF to the brain and spinal cord (Reboldi et al., 2009). CXCL16 expression in the EAE brain is not itself sufficient to mediate T cell infiltration. Similarly, laser injury alone, which sets up a cascade of astrocyte and microglial responses (Davalos et al., 2005; Kim and Dustin, 2006) is also insufficient to recruit T cells into the parenchyma. However, when both of these hits are present, robust CXCR6 dependent T cell infiltration is observed. This may be due to a lowered threshold for traversing the blood brain barrier. The prevalence of CXCR6 and CXCL16 expression in human clinical specimens should be further evaluated as a first step to assess the potential for anti-CXCR6 based therapies in treating and/or preventing gray matter involvement in MS and promoting recovery of function by reducing inflammatory T cell infiltration (De Jager and Hafler, 2007). Laser injury is but a simple maneuver that was convenient in our mouse model, but we emphasize that its relationship to cortical lesions in MS is not established and therefore the clinical significance of our results in terms of therapeutic targeting of CXCR6 in treating or preventing cortical inflammation in MS will need further investigation.
Supplementary Material
Movie 1: Spinal cord T cell migration pattern. Movement of GFP+ T cells in spinal cord of live CXCR6gfp/+ and CXCR6gfp/gfp mice with EAE score 2 (day 14). GFP+ cells are shown in white and the vasculature, in red. The large blood vessel is posterior spinal vein. Tracks of the GFP+ cells are outlined from 30 minute time lapse movie. First part of the movie corresponds to Fig. 3 A, B. Scale bar = 50 μm.
Movie 2: CXCR6 dependent T cell recruitment into gray matter. GFP+ cell recruitment to cerebral cortex of CXCR6gfp/+ mice with EAE. All parts are TPLSM with 40× objective through thinned skull. Parts 1 and 2- GFP+ cells recruit to the injury focus in the gray matter in a swarming motion. The segment runs twice with close (<50 □m) and then far (> 50 μm) cells tracked. Part 3- In the absence of injury the GFP+ cells are restricted to move within the meninges and perivascular spaces. Movie parts correspond to Fig. 5 A, B. Scale bar = 50 μm.
ACKNOWLEDGMENTS
We thank the following investigators: N. Kawakami and A. Flügel, for demonstrating spinal cord imaging procedures in the rat that contributed to methods development for this study; D. Levy, for his advice on Figure 1; S. Shen, for help with T cell analysis; C.F. Brosnan (A.E.C.O.M., Bronx, NY), for discussions about cortical expression of EAE antigen, myelin basic protein; V.H. Perry ( Southampton University, U.K.), for discussions about cryptic antigens and demyelination; W. Gan, for continuing assistance with intravital TPLSM;. K. Hosiawa and M. Matloubian (U.C.S.F., San Francisco, CA), for the CXCL16 qPCR protocol; and J. Zavadil of the NYUCI Genomics Core, for assistance with qPCR analysis. This work was funded by NIH grants R01 AI055037 (M.L.D.), P30 CA016087 (Core facilities), a Dana Foundation Research Grant (M.L.D. and W. Gan), Collaborative Multiple Sclerosis Research Center Award CA1050-A-12 and New York State Spinal Cord Injury Research grant (J.V.K.). The authors declare no conflicts of interest.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- Adachi N, Ochi M, Sumen Y, Deie M, Murakami Y, Uchio Y. Temporal changes in posterior laxity after isolated posterior cruciate ligament injury: 35 patients examined by stress radiography and MRI. Acta Orthop Scand. 2003;74:683–8. doi: 10.1080/00016470310018207. [DOI] [PubMed] [Google Scholar]
- Aloisi F, Serafini B, Adorini L. Glia-T cell dialogue. J Neuroimmunol. 2000;107:111–7. doi: 10.1016/s0165-5728(00)00231-9. [DOI] [PubMed] [Google Scholar]
- Audoin B, Davies G, Rashid W, Fisniku L, Thompson AJ, Miller DH. Voxel-based analysis of grey matter magnetization transfer ratio maps in early relapsing remitting multiple sclerosis. Mult Scler. 2007;13:483–9. doi: 10.1177/1352458506070450. [DOI] [PubMed] [Google Scholar]
- Bajenoff M, Egen JG, Koo LY, Laugier JP, Brau F, Glaichenhaus N, Germain RN. Stromal cell networks regulate lymphocyte entry, migration, and territoriality in lymph nodes. Immunity. 2006;25:989–1001. doi: 10.1016/j.immuni.2006.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bettelli E, Pagany M, Weiner HL, Linington C, Sobel RA, Kuchroo VK. Myelin oligodendrocyte glycoprotein-specific T cell receptor transgenic mice develop spontaneous autoimmune optic neuritis. J Exp Med. 2003;197:1073–81. doi: 10.1084/jem.20021603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bo L, Geurts JJ, Mork SJ, van der Valk P. Grey matter pathology in multiple sclerosis. Acta Neurol Scand Suppl. 2006;183:48–50. doi: 10.1111/j.1600-0404.2006.00615.x. [DOI] [PubMed] [Google Scholar]
- Bo L, Vedeler CA, Nyland H, Trapp BD, Mork SJ. Intracortical multiple sclerosis lesions are not associated with increased lymphocyte infiltration. Mult Scler. 2003;9:323–31. doi: 10.1191/1352458503ms917oa. [DOI] [PubMed] [Google Scholar]
- Calabresi PA, Yun SH, Allie R, Whartenby KA. Chemokine receptor expression on MBP-reactive T cells: CXCR6 is a marker of IFNgamma-producing effector cells. J Neuroimmunol. 2002;127:96–105. doi: 10.1016/s0165-5728(02)00106-6. [DOI] [PubMed] [Google Scholar]
- Cudrici C, Ito T, Zafranskaia E, Niculescu F, Mullen KM, Vlaicu S, Judge SI, Calabresi PA, Rus H. Dendritic cells are abundant in non-lesional gray matter in multiple sclerosis. Exp Mol Pathol. 2007;83:198–206. doi: 10.1016/j.yexmp.2007.05.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davalos D, Grutzendler J, Yang G, Kim JV, Zuo Y, Jung S, Littman DR, Dustin ML, Gan WB. ATP mediates rapid microglial response to local brain injury in vivo. Nat Neurosci. 2005;8:752–8. doi: 10.1038/nn1472. [DOI] [PubMed] [Google Scholar]
- Davalos D, Lee JK, Smith WB, Brinkman B, Ellisman MH, Zheng B, Akassoglou K. Stable in vivo imaging of densely populated glia, axons and blood vessels in the mouse spinal cord using two-photon microscopy. J Neurosci Methods. 2008;169:1–7. doi: 10.1016/j.jneumeth.2007.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- De Jager PL, Hafler DA. New therapeutic approaches for multiple sclerosis. Annu Rev Med. 2007;58:417–32. doi: 10.1146/annurev.med.58.071105.111552. [DOI] [PubMed] [Google Scholar]
- Denk W, Delaney KR, Gelperin A, Kleinfeld D, Strowbridge BW, Tank DW, Yuste R. Anatomical and functional imaging of neurons using 2-photon laser scanning microscopy. J Neurosci Methods. 1994;54:151–62. doi: 10.1016/0165-0270(94)90189-9. [DOI] [PubMed] [Google Scholar]
- Engelhardt B, Vajkoczy P, Laschinger M. Detection of endothelial/lymphocyte interaction in spinal cord microvasculature by intravital videomicroscopy. Methods Mol Med. 2003;89:83–93. doi: 10.1385/1-59259-419-0:83. [DOI] [PubMed] [Google Scholar]
- Faust N, Varas F, Kelly LM, Heck S, Graf T. Insertion of enhanced green fluorescent protein into the lysozyme gene creates mice with green fluorescent granulocytes and macrophages. Blood. 2000;96:719–26. [PubMed] [Google Scholar]
- Fukumoto N, Shimaoka T, Fujimura H, Sakoda S, Tanaka M, Kita T, Yonehara S. Critical roles of CXC chemokine ligand 16/scavenger receptor that binds phosphatidylserine and oxidized lipoprotein in the pathogenesis of both acute and adoptive transfer experimental autoimmune encephalomyelitis. J Immunol. 2004;173:1620–7. doi: 10.4049/jimmunol.173.3.1620. [DOI] [PubMed] [Google Scholar]
- Geissmann F, Cameron TO, Sidobre S, Manlongat N, Kronenberg M, Briskin MJ, Dustin ML, Littman DR. Intravascular immune surveillance by CXCR6+ NKT cells patrolling liver sinusoids. PLoS Biol. 2005;3:e113. doi: 10.1371/journal.pbio.0030113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Geurts JJ, Barkhof F. Grey matter pathology in multiple sclerosis. Lancet Neurol. 2008;7:841–51. doi: 10.1016/S1474-4422(08)70191-1. [DOI] [PubMed] [Google Scholar]
- Grutzendler J, Kasthuri N, Gan WB. Long-term dendritic spine stability in the adult cortex. Nature. 2002;420:812–6. doi: 10.1038/nature01276. [DOI] [PubMed] [Google Scholar]
- Hofnagel O, Luechtenborg B, Plenz G, Robenek H. Expression of the novel scavenger receptor SR-PSOX in cultured aortic smooth muscle cells and umbilical endothelial cells. Arterioscler Thromb Vasc Biol. 2002;22:710–1. doi: 10.1161/01.atv.0000012402.85056.45. [DOI] [PubMed] [Google Scholar]
- Huang JH, Cardenas-Navia LI, Caldwell CC, Plumb TJ, Radu CG, Rocha PN, Wilder T, Bromberg JS, Cronstein BN, Sitkovsky M, Dewhirst MW, Dustin ML. Requirements for T lymphocyte migration in explanted lymph nodes. J Immunol. 2007;178:7747–55. doi: 10.4049/jimmunol.178.12.7747. [DOI] [PubMed] [Google Scholar]
- Jung S, Aliberti J, Graemmel P, Sunshine MJ, Kreutzberg GW, Sher A, Littman DR. Analysis of fractalkine receptor CX(3)CR1 function by targeted deletion and green fluorescent protein reporter gene insertion. Mol Cell Biol. 2000;20:4106–14. doi: 10.1128/mcb.20.11.4106-4114.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kawakami N, Nagerl UV, Odoardi F, Bonhoeffer T, Wekerle H, Flugel A. Live imaging of effector cell trafficking and autoantigen recognition within the unfolding autoimmune encephalomyelitis lesion. J Exp Med. 2005;201:1805–14. doi: 10.1084/jem.20050011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim JV, Dustin ML. Innate response to focal necrotic injury inside the blood-brain barrier. J Immunol. 2006;177:5269–77. doi: 10.4049/jimmunol.177.8.5269. [DOI] [PubMed] [Google Scholar]
- Kim JV, Kang SS, Dustin ML, McGavern DB. Myelomonocytic cell recruitment causes fatal CNS vascular injury during acute viral meningitis. Nature. 2009;457:191–5. doi: 10.1038/nature07591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kivisakk P, Mahad DJ, Callahan MK, Sikora K, Trebst C, Tucky B, Wujek J, Ravid R, Staugaitis SM, Lassmann H, Ransohoff RM. Expression of CCR7 in multiple sclerosis: implications for CNS immunity. Ann Neurol. 2004;55:627–38. doi: 10.1002/ana.20049. [DOI] [PubMed] [Google Scholar]
- Kivisakk P, Mahad DJ, Callahan MK, Trebst C, Tucky B, Wei T, Wu L, Baekkevold ES, Lassmann H, Staugaitis SM, Campbell JJ, Ransohoff RM. Human cerebrospinal fluid central memory CD4+ T cells: evidence for trafficking through choroid plexus and meninges via P-selectin. Proc Natl Acad Sci U S A. 2003;100:8389–94. doi: 10.1073/pnas.1433000100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Konno H, Yamamoto T, Suzuki H, Yamamoto H, Iwasaki Y, Ohara Y, Terunuma H, Harata N. Targeting of adoptively transferred experimental allergic encephalitis lesion at the sites of wallerian degeneration. Acta Neuropathol. 1990;80:521–6. doi: 10.1007/BF00294613. [DOI] [PubMed] [Google Scholar]
- Lassmann H, Bruck W, Lucchinetti CF. The immunopathology of multiple sclerosis: an overview. Brain Pathol. 2007;17:210–8. doi: 10.1111/j.1750-3639.2007.00064.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ling C, Sandor M, Suresh M, Fabry Z. Traumatic injury and the presence of antigen differentially contribute to T-cell recruitment in the CNS. J Neurosci. 2006;26:731–41. doi: 10.1523/JNEUROSCI.3502-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Loetscher M, Amara A, Oberlin E, Brass N, Legler D, Loetscher P, D’Apuzzo M, Meese E, Rousset D, Virelizier JL, Baggiolini M, Arenzana-Seisdedos F, Moser B. TYMSTR, a putative chemokine receptor selectively expressed in activated T cells, exhibits HIV-1 coreceptor function. Curr Biol. 1997;7:652–60. doi: 10.1016/s0960-9822(06)00292-2. [DOI] [PubMed] [Google Scholar]
- Ludwig A, Schulte A, Schnack C, Hundhausen C, Reiss K, Brodway N, Held-Feindt J, Mentlein R. Enhanced expression and shedding of the transmembrane chemokine CXCL16 by reactive astrocytes and glioma cells. J Neurochem. 2005;93:1293–303. doi: 10.1111/j.1471-4159.2005.03123.x. [DOI] [PubMed] [Google Scholar]
- Marcondes MC, Furtado GC, Wensky A, de Lafaille M.A. Curotto, Fox HS, Lafaille JJ. Immune regulatory mechanisms influence early pathology in spinal cord injury and in spontaneous autoimmune encephalomyelitis. Am J Pathol. 2005;166:1749–60. doi: 10.1016/S0002-9440(10)62485-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Matloubian M, David A, Engel S, Ryan JE, Cyster JG. A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat Immunol. 2000;1:298–304. doi: 10.1038/79738. [DOI] [PubMed] [Google Scholar]
- Matyszak MK, Perry VH. Demyelination in the central nervous system following a delayed-type hypersensitivity response to bacillus Calmette-Guerin. Neuroscience. 1995;64:967–77. doi: 10.1016/0306-4522(94)00448-e. [DOI] [PubMed] [Google Scholar]
- Matyszak MK, Perry VH. A comparison of leucocyte responses to heat-killed bacillus Calmette-Guerin in different CNS compartments. Neuropathol Appl Neurobiol. 1996a;22:44–53. [PubMed] [Google Scholar]
- Matyszak MK, Perry VH. Delayed-type hypersensitivity lesions in the central nervous system are prevented by inhibitors of matrix metalloproteinases. J Neuroimmunol. 1996b;69:141–9. doi: 10.1016/0165-5728(96)00082-3. [DOI] [PubMed] [Google Scholar]
- Matyszak MK, Perry VH. Bacillus Calmette-Guerin sequestered in the brain parenchyma escapes immune recognition. J Neuroimmunol. 1998;82:73–80. doi: 10.1016/S0165-5728(97)00190-2. [DOI] [PubMed] [Google Scholar]
- Mendel I, de Rosbo N. Kerlero, Ben-Nun A. A myelin oligodendrocyte glycoprotein peptide induces typical chronic experimental autoimmune encephalomyelitis in H-2b mice: fine specificity and T cell receptor V beta expression of encephalitogenic T cells. Eur J Immunol. 1995;25:1951–9. doi: 10.1002/eji.1830250723. [DOI] [PubMed] [Google Scholar]
- Miller MJ, Wei SH, Cahalan MD, Parker I. Autonomous T cell trafficking examined in vivo with intravital two-photon microscopy. Proc Natl Acad Sci U S A. 2003;100:2604–9. doi: 10.1073/pnas.2628040100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mohan H, Eisele S, Krumbholz M, Sixt M, Lassman H, Wekerle H, Hohlfield R, Meinle E. Extracellular matrix in MS lesions: induction of fibrillar collagens, biglycans and decorin in association with infiltrating immune cells. Journal of Neuroimmunology. 2008;203:131. [Google Scholar]
- Moll NM, Rietsch AM, Ransohoff AJ, Cossoy MB, Huang D, Eichler FS, Trapp BD, Ransohoff RM. Cortical demyelination in PML and MS: Similarities and differences. Neurology. 2008;70:336–43. doi: 10.1212/01.WNL.0000284601.54436.e4. [DOI] [PubMed] [Google Scholar]
- Molleston MC, Thomas ML, Hickey WF. Novel major histocompatibility complex expression by microglia and site-specific experimental allergic encephalomyelitis lesions in the rat central nervous system after optic nerve transection. Adv Neurol. 1993;59:337–48. [PubMed] [Google Scholar]
- Odoardi F, Kawakami N, Klinkert WE, Wekerle H, Flugel A. Blood-borne soluble protein antigen intensifies T cell activation in autoimmune CNS lesions and exacerbates clinical disease. Proc Natl Acad Sci U S A. 2007;104:18625–30. doi: 10.1073/pnas.0705033104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peters A, Palay SL, Webster H. The Fine structure of the Nervous System. Oxford University Press; 1991. [Google Scholar]
- Phillips MJ, Weller RO, Kida S, Iannotti F. Focal brain damage enhances experimental allergic encephalomyelitis in brain and spinal cord. Neuropathol Appl Neurobiol. 1995;21:189–200. doi: 10.1111/j.1365-2990.1995.tb01050.x. [DOI] [PubMed] [Google Scholar]
- Reboldi A, Coisne C, Baumjohann D, Benvenuto F, Bottinelli D, Lira S, Uccelli A, Lanzavecchia A, Engelhardt B, Sallusto F. C-C chemokine receptor 6-regulated entry of TH-17 cells into the CNS through the choroid plexus is required for the initiation of EAE. Nat Immunol. 2009;10:514–23. doi: 10.1038/ni.1716. [DOI] [PubMed] [Google Scholar]
- Rudick RA, Lee JC, Nakamura K, Fisher E. Gray matter atrophy correlates with MS disability progression measured with MSFC but not EDSS. J Neurol Sci. 2008 doi: 10.1016/j.jns.2008.11.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sato T, Thorlacius H, Johnston B, Staton TL, Xiang W, Littman DR, Butcher EC. Role for CXCR6 in recruitment of activated CD8+ lymphocytes to inflamed liver. J Immunol. 2005;174:277–83. doi: 10.4049/jimmunol.174.1.277. [DOI] [PubMed] [Google Scholar]
- Schnell L, Fearn S, Klassen H, Schwab ME, Perry VH. Acute inflammatory responses to mechanical lesions in the CNS: differences between brain and spinal cord. Eur J Neurosci. 1999;11:3648–58. doi: 10.1046/j.1460-9568.1999.00792.x. [DOI] [PubMed] [Google Scholar]
- Shakhar G, Lindquist RL, Skokos D, Dudziak D, Huang JH, Nussenzweig MC, Dustin ML. Stable T cell-dendritic cell interactions precede the development of both tolerance and immunity in vivo. Nat Immunol. 2005;6:707–14. doi: 10.1038/ni1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shimaoka T, Kume N, Minami M, Hayashida K, Kataoka H, Kita T, Yonehara S. Molecular cloning of a novel scavenger receptor for oxidized low density lipoprotein, SR-PSOX, on macrophages. J Biol Chem. 2000;275:40663–6. doi: 10.1074/jbc.C000761200. [DOI] [PubMed] [Google Scholar]
- Shimaoka T, Nakayama T, Kume N, Takahashi S, Yamaguchi J, Minami M, Hayashida K, Kita T, Ohsumi J, Yoshie O, Yonehara S. Cutting edge: SR-PSOX/CXC chemokine ligand 16 mediates bacterial phagocytosis by APCs through its chemokine domain. J Immunol. 2003;171:1647–51. doi: 10.4049/jimmunol.171.4.1647. [DOI] [PubMed] [Google Scholar]
- Sims TN, Soos TJ, Xenias HS, Dubin-Thaler B, Hofman JM, Waite JC, Cameron TO, Thomas VK, Varma R, Wiggins CH, Sheetz MP, Littman DR, Dustin ML. Opposing effects of PKCtheta and WASp on symmetry breaking and relocation of the immunological synapse. Cell. 2007;129:773–85. doi: 10.1016/j.cell.2007.03.037. [DOI] [PubMed] [Google Scholar]
- Suh HS, Zhao ML, Rivieccio M, Choi S, Connolly E, Zhao Y, Takikawa O, Brosnan CF, Lee SC. Astrocyte indoleamine 2,3-dioxygenase is induced by the TLR3 ligand poly(I:C): mechanism of induction and role in antiviral response. J Virol. 2007;81:9838–50. doi: 10.1128/JVI.00792-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sumen C, Mempel TR, Mazo IB, von Andrian UH. Intravital microscopy: visualizing immunity in context. Immunity. 2004;21:315–29. doi: 10.1016/j.immuni.2004.08.006. [DOI] [PubMed] [Google Scholar]
- Summers M, Swanton J, Fernando K, Dalton C, Miller DH, Cipolotti L, Ron MA. Cognitive impairment in multiple sclerosis can be predicted by imaging early in the disease. J Neurol Neurosurg Psychiatry. 2008;79:955–8. doi: 10.1136/jnnp.2007.138685. [DOI] [PubMed] [Google Scholar]
- Sun D, Newman TA, Perry VH, Weller RO. Cytokine-induced enhancement of autoimmune inflammation in the brain and spinal cord: implications for multiple sclerosis. Neuropathol Appl Neurobiol. 2004;30:374–84. doi: 10.1111/j.1365-2990.2003.00546.x. [DOI] [PubMed] [Google Scholar]
- Teeling JL, Perry VH. Systemic infection and inflammation in acute CNS injury and chronic neurodegeneration: underlying mechanisms. Neuroscience. 2009;158:1062–73. doi: 10.1016/j.neuroscience.2008.07.031. [DOI] [PubMed] [Google Scholar]
- Unutmaz D, Xiang W, Sunshine MJ, Campbell J, Butcher E, Littman DR. The primate lentiviral receptor Bonzo/STRL33 is coordinately regulated with CCR5 and its expression pattern is conserved between human and mouse. J Immunol. 2000;165:3284–92. doi: 10.4049/jimmunol.165.6.3284. [DOI] [PubMed] [Google Scholar]
- Vanderlugt CL, Begolka WS, Neville KL, Katz-Levy Y, Howard LM, Eagar TN, Bluestone JA, Miller SD. The functional significance of epitope spreading and its regulation by co-stimulatory molecules. Immunol Rev. 1998;164:63–72. doi: 10.1111/j.1600-065x.1998.tb01208.x. [DOI] [PubMed] [Google Scholar]
- Wensky AK, Furtado GC, Marcondes MC, Chen S, Manfra D, Lira SA, Zagzag D, Lafaille JJ. IFN-gamma determines distinct clinical outcomes in autoimmune encephalomyelitis. J Immunol. 2005;174:1416–23. doi: 10.4049/jimmunol.174.3.1416. [DOI] [PubMed] [Google Scholar]
- Wilson EH, Harris TH, Mrass P, John B, Tait ED, Wu GF, Pepper M, Wherry EJ, Dzierzinski F, Roos D, Haydon PG, Laufer TM, Weninger W, Hunter CA. Behavior of parasite-specific effector CD8+ T cells in the brain and visualization of a kinesis-associated system of reticular fibers. Immunity. 2009;30:300–11. doi: 10.1016/j.immuni.2008.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu HT, Pan F, Yang G, Gan WB. Choice of cranial window type for in vivo imaging affects dendritic spine turnover in the cortex. Nat Neurosci. 2007;10:549–51. doi: 10.1038/nn1883. [DOI] [PubMed] [Google Scholar]
- Zamvil S, Nelson P, Trotter J, Mitchell D, Knobler R, Fritz R, Steinman L. T-cell clones specific for myelin basic protein induce chronic relapsing paralysis and demyelination. Nature. 1985;317:355–8. doi: 10.1038/317355a0. [DOI] [PubMed] [Google Scholar]
- Zamvil SS, Steinman L. The T lymphocyte in experimental allergic encephalomyelitis. Annu Rev Immunol. 1990;8:579–621. doi: 10.1146/annurev.iy.08.040190.003051. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Movie 1: Spinal cord T cell migration pattern. Movement of GFP+ T cells in spinal cord of live CXCR6gfp/+ and CXCR6gfp/gfp mice with EAE score 2 (day 14). GFP+ cells are shown in white and the vasculature, in red. The large blood vessel is posterior spinal vein. Tracks of the GFP+ cells are outlined from 30 minute time lapse movie. First part of the movie corresponds to Fig. 3 A, B. Scale bar = 50 μm.
Movie 2: CXCR6 dependent T cell recruitment into gray matter. GFP+ cell recruitment to cerebral cortex of CXCR6gfp/+ mice with EAE. All parts are TPLSM with 40× objective through thinned skull. Parts 1 and 2- GFP+ cells recruit to the injury focus in the gray matter in a swarming motion. The segment runs twice with close (<50 □m) and then far (> 50 μm) cells tracked. Part 3- In the absence of injury the GFP+ cells are restricted to move within the meninges and perivascular spaces. Movie parts correspond to Fig. 5 A, B. Scale bar = 50 μm.





