Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Jan 21.
Published in final edited form as: Cell Cycle. 2009 Jul 5;8(13):2093–2100. doi: 10.4161/cc.8.13.8926

Identification of new Rel/NF-kappaB regulatory networks by focused genome location analysis

Adriana De Siervi 1,5,*, Paola De Luca 5, Cristian Moiola 5, Geraldine Gueron 5, Ron Tongbai 1, G V R Chandramouli 1, Cynthia Haggerty 1, Inna Dzekunova 2, David Petersen 2, Ernest Kawasaki 2, Whoon Jong Kil 3, Kevin Camphausen 3, Dan Longo 4, Kevin Gardner 1,*
PMCID: PMC2809250  NIHMSID: NIHMS158532  PMID: 19502793

Abstract

NF-κB is an inducible transcription factor that controls kinetically complex patterns of gene expression. Several studies reveal multiple pathways linking NF-κB to the promotion and progression of various cancers. Despite extensive interest and characterization, many NF-κB controlled genes still remain to be identified. We used chromatin immunoprecipitation combined with microarray technology (ChIP/Chip) to investigate the dynamic interaction of NF-κB with the promoter regions of 100 genes known to be expressed in mitogen-induced T-cells. Six previously unrecognized NF-κB controlled genes (ATM, EP300, TGFβ, Selectin, MMP-1, and SFN) were identified. Each gene is induced in mitogen-stimulated T-cells, repressed by pharmacological NF-κB blockade, reduced in cells deficient in the p50 NF-κB subunit and dramatically repressed by RNAi specifically designed against cRel. A coregulatory role for Ets transcription factors in the expression of the NF-κB controlled genes was predicted by comparative promoter analysis and confirmed by ChIP and by functional disruption of Ets. NF-κB deficiency produces a deficit in ATM function and DNA repair indicating an active role for NF-κB in maintaining DNA integrity. These results define new potential targets and transcriptional networks governed by NF-κB and provide novel functional insights for the role of NF-κB in genomic stability, cell cycle control, cell-matrix and cell-cell interactions during tumor progression.

Keywords: ATM, ChIP/chip, Ets, NF-κB, T-cells

Introduction

Nuclear factor Kappa B (NF-κB) is an inducible dimeric transcription factor that plays a central role in the expression of many genes controlling the immune response, proliferation and cell survival.1, 2 There are five known members of the mammalian NF-κB/Rel family: RelA(p65), cRel, RelB, NF-κB1 (p50/p105), and NF-κB2 (p52/p100). These proteins share sequence similarity over a 300-amino-acid region referred to as the Rel homology domain.3 NF-κB subunits homo- or heterodimerize through the Rel homology domain to form transcription factor complexes with a wide range of DNA-binding and activation potentials. Although all Rel members bind DNA, only p65, cRel, and RelB have extended carboxy termini harboring transactivation function. The most widely studied and abundant form of NF-κB is a heterodimer of p50 and p65.1, 2

High levels of NF-κB activity have been associated with a variety of different cancers of hematopoietic and epithelial origin.4, 5 In most cell types, NF-κB dimers are predominantly held in the cytoplasm, in an inactive form, bound to members of the I-κB family. Following exposure to diverse agents including TNF-α, interleukin 1 (IL-1), lipopolysaccharide, ultraviolet light, ionizing radiation, growth factors, phorbol esters, hypoxia and chemotherapeutic drugs, I-κB becomes phosphorylated, ubiquitylated and subsequently degradated by the proteasome system.6, 7 This frees NF-κB dimers to translocate to the nucleus and act as sequence-specific DNA binding transcription factors.

The combination of chromatin immunoprecipitation (ChIP) followed by microarray analysis (ChIP/Chip), has proven to be an efficient means of mapping protein-genome interactions.8-10 In this report we used the ChIP/Chip technology in a focused analysis to profile the kinetic occupancy of Rel/κB containing complexes at 100 different genes known to be induced in mitogen activated T-cells. By this approach we identified a set of rapidly induced genes not previously thought to be controlled by NF-κB. The NF-κB-targets include ATM, EP300 (p300), SFN (14-3-3σ), TGFβ1, MMP1 (matrix metalloproteinase 1) and SELL (L-selectin). These novel findings provide evidence of new pathways and regulatory networks that involve NF-κB in the control of differentiation, cell cycle progression and the maintenance of genome stability.

Materials and Methods

Cell culture, transfections and reagents

Jurkat T-cells were maintained in RPMI 1640 with 10% fetal bovine serum at 37°C in a humidified atmosphere of 5% CO2. Mouse NF-κB2 KO (p50-/-) embryonic fibroblasts were obtained from Dr Ulrich Siebenlist (NIH/NIAID) and were grown in DMEM medium with 15% fetal calf serum. HEK 293T cells were grown in DMEM medium with 15% fetal bovine serum. Jurkat T-cells were stimulated with 50 ng/ml phorbol myristate acetate (PMA) (Sigma Chemical Co., St. Louis, MO) and 710 ng/ml ionomycin (Calbiochem, San Diego, CA) for the indicated times. Doxorubicin (Sigma Chemical Co) stock solution was prepared in DMSO. NF-κB SN50 cell-permeable inhibitory peptide (BIOMOL International, Plymouth Meeting, PA) was prepared in 50% ethanol and cells were treated with 50 μg/ml. The pcDNA3 ETS dominant negative (DN) expression vector was obtained from Dr Craig Hauser.11 Jurkat T-cells (1×107) were transfected with 10 μg of pcDNA3 or pcDNA3 ETS DN using the Amaxa electroporation kit (Amaxa, Gaithersburg, MD). Cells were then immediately transferred to 10 ml of RPMI1640 media and incubated 24 hours and then cells were mitogen stimulated for 0, 60 or 120 min. All transfections were carried out in triplicate. Similar results were reproduced in at least three independent experiments. Peripheral Blood Mononuclear Cells (PBMC's) were isolated by apheresis from healthy human donors. Proliferating PBMC blasts were generated by incubation of donor PBMC with 1:1000 dilution of anti-CD3 in the presence of IL-2 at 10 U/ml for 5 days. For cRel silencing HEK 293T cells were transfected with 1μg of shRNA pool from Origene (GACCAAGACCTGGTCTCCTCGGTTCAATT; TTCTGACCAGGAAGTTAGTGAATCTATGG; GACATAGTCGGAATGGAAGCGTCATCCAT; TGGTCTTGAACTCCTGACAT CAGGTGATC; GATGAAGACTTCTCCTCCATTGCGGACAT; GCTGTGTTCACAGACCT GGCATCCGTCGA; CCACCATCAAGATCAATGGCTACACAGGA; GATCGTCACCGGATT GAGGAGAAACGTAA) or shRNA scramble and 3 μl of Lipofectamin 2000 (Invitrogen) and 72hs after transfection cells were harvested.

Promoter microarray

The promoter regions of 102 human genes (Supplementary Table S1), from 0.5 kb to 1.2 kb upstream to 50 bp downstream of the Transcription Start Site (TSS) were PCR-amplified from human genomic DNA (Promega Madison, WI). All amplicons were purified on QIAquick PCR purification columns (Qiagen Valencia, CA) and spotted onto amino-silane-coated glass GAPS II slides (Corning), blocked, and crosslinked as previously described.12

Chromatin immunoprecipitation

ChIP was performed as was described in Smith et al 12 with slight modifications as described in Supplementary Methods.

Probe amplification, labeling and hybridization

Chromatin immunoprecipitation (ChIP), probe amplification, and labeling were adopted from Smith et al 12 with slight modifications described in Supplementary Methods.

Promoter Analysis

Sequences spanning 900 bp upstream to 100 bp downstream of the TSS (RefSeq annotated) of ATM, EP300, TGFβ, SELL, MMP-1, and SFN were extracted using the Gene2promoter module of the GenomatixSuite 3.4.1. (Munich). Sequences matching the binding site matrices for NF-κB and Ets families of transcription factors were retrieved using optimized thresholds (NF-κB ≥0.82; Ets≥0.81) for matrix similarity. The number of bindings sites for Ets and NF-κB families conserved between human and mouse were determined use the ConFac database {Karanam, 2004 34967/id}. Matches for homologous sequence alignments located within 3000 bps upstream of the TSS were determined using a default core threshold score ≥0.85 and matrix threshold score ≥0.75. Statistical enrichment values were calculated using a background reference model of 15,318 RefSeq gene 1000 bp promoter sequences extracted from -900 to +100 of the TSS using the ProSpector promoter retrieval website.13 Each promoter in the background model was annotated using Genomatix MatInspector with optimized core and matrix similarity thresholds, as described above. P-value estimates quoted in the text were determined by comparing the gene lists in this study to the reference background model using a complemented Poisson distribution (pdtrc) in the perl math (math-cephes) library 14 assuming the null hypothesis that the observed frequency of TFBS in the gene list could be explained as a random fluctuation.

RNA isolation, retrotranscription and qPCR

RNA isolation, retrotranscription and qPCR were performed as previously described.12 Data were normalized with ACTB. For chromatin immunoprecipitation followed by qPCR, primers were designed to amplify a 100 bp region upstream from the transcription start site in the promoter regions. Fold enrichment was normalized to input DNA before normalization for the background enrichment produced by non-specific IgG. This value was then normalized a second time for the background enrichment produced by the anti-cRel antibody interaction with non- NF-κB binding promoter regions by using rhodopsin, a non-expressed gene in Jurkat T-cells. Primers used in the study are provided in supplementary Table S1.

Immunoblot Analysis

Immuno-blot analysis performed was previously described.15 Antibodies used are described in Supplementary Methods.

Immuno-fluorescent γH2AX staining

Immuno-fluorescent staining and counting of γH2AX positive nuclear foci was performed as previously described.16 Slides were examined on a Leica DMRXA fluorescent microscope (Wetzlar, Germany). Images were captured by a Photometrics Sensys CCD camera (Roper Scientific, Tucson, AZ) and imported into IP Labs image analysis software package (Scanalytics, Inc., Fairfax, VA) running on a Macintosh G3 computer (Apple, Cupertino, CA). For each treatment condition, H2AX foci were determined in at least 50 cells. To account for the H2AX foci appearing in unirradiated S phase cells, cells were classified as positive (i.e., containing radiation-induced H2AX foci) when more than five foci were detected.

Results

Validation of anti-cRel antibody in ChIP assays

To identify new candidates for NF-κB control in mitogen-stimulated T-cells we developed an affinity-purified antibody from rabbits inoculated with a GST fusion containing full-length cRel. Although raised against antigen containing the Rel homology domain common to all NF-κB subunits, the purified antibody shows remarkable specificity for cRel in comparison to p65 and p50 by immunoblot analysis (Fig. 1A) and immunoprecipitates cRel with efficiency comparable to commercial antibody (Fig. 1B, lanes 2 and 5). Moreover, the purified antibody detects in vivo assembly of Rel/κB complexes at the BCL2L1 (BCLxL) promoter, a well known NF-κB-target (Fig. 1C).17

Figure 1. ChIP/chip reveals six new targets of Rel/κB.

Figure 1

(A). Western blot from Jurkat T-cells using different antibodies from NF-κB family members. (B). Whole lysates from Jurkat T-cells non-crosslinked (lane 4) or after 15′ of formaldehyde crosslink (lane 7), or immunoprecipitated lysates with GAL4 (lane1), cRel (lanes 2, 5) and cRel from Santa Cruz (lanes 3, 6) antibodies. Lanes 2 and 3 show immunoprecipitation from non-crosslinked cells, lanes 5 and 6 show immunoprecipitation from crosslinked cells. (C). ChIP-qPCR for BCL2L1 promoter region was performed from Jurkat T-cells after mitogen stimulation for 0′, 15′, 30′, 45′. Data were normalized to input, non-specific IgG and the α-cRel signal at the rhodopsin promoter. One representative experiment from 7 independent experiments is shown. (D) right. Image from ChIP/chip with cRel antibody in Jurkat T-cells after mitogen stimulation. Log2 fold enrichment values range is between -3.5 (green) to 1.9 (red). Left. Plot showing the enrichment of the six genes in cluster 14 after ChIP/chip.

ChIP/chip reveals six new targets for Rel/κB

To screen for new targets of NF-κB in activated T-cells we examined the assembly of cRel/NF-κB complexes at 102 mitogen-inducible genes in Jurkat T-cells at 0, 15, 30 and 45 min following simulation with phorbol ester and ionomycin by anti-cRel ChIP/Chip (Fig. 1D). Data from seven independent time courses were normalized, averaged, and the different kinetic profiles of Rel/κB assembly at the 102 promoters were compared by K-means clustering. Seventeen clusters were identified (Fig. 1D and Supplementary Fig. S1). We focused first on promoter clusters that showed inducible binding by Rel/κB at two or more consecutive time points following mitogen stimulation. Within the four clusters that met this criteria (Fig. 1D and Supplementary Fig. S1), only cluster 14 showed a 100% consensus for a κB-site located within 900 bp upstream and 100 bp downstream of the transcription start site (Table 1, Supplementary Fig. S1, and Tables S2 and S3). As shown in Fig. 2, each member of cluster 14 including ATM, EP300, SFN, TGFβ1, MMP1, and SELL were validated for mitogen inducible association with cRel/κB by ChIP-qPCR. This group showed enrichment for cRel/NF-κB at least in 2 consecutive points following mitogen stimulation.

Table 1.

Frequency and conservation of NF-κB and ETS family binding sites in cluster 14 genes. ‡ NF-κB bindings site sequences found in cluster 14 genes. Upstream gene regulatory sequences from -900 to +100 bp relative to the TSS of each gene were extracted with the Gene2promoter module of the GenomatixSuite 3.4.1. (Munich). Matches for transcription factor binding site matrix families were searched using optimized thresholds for each matrix family. Match count for V$NFkB matrices (matrix threshold >0.82) and V$ETSF matrices (threshold >0.81) were scored for non-overlapping sequences only. †Gene names and Refseq ID of cluster 14 genes were submitted to the CONFAC database for identification of NF-κB and Ets family TFBS conserved in mouse. Matches for homologous sequence alignments located within 3000 bps upstream of the TSS were determined using a default core threshold score >0.85 and matrix threshold score >0.75.

Occurrence of NF-κB and ETS Families TFBSs within -900 to +100 of the TSS of Cluster 14 genes‡
NF-κB Binding Sites

Gene NF-kB Sequence Gene NF-κB Sequence

ATM ctcgggctTCCCctc SFN ggGGGAagttacctg
ATM gaGGGGaagcccgag SFN ttGGGAaactccatg
EP300 ggGGGAcccgccacc TGFB1 ggGGGGacgccccgt
EP300 ggGGGAgtttgcgga TGFB1 ccGGGGcaccccccc
EP300 agGGGAgtggccggg TGFB1 ggGGGGgtgccccgg
EP300 gccggctgTTCCggg TGFB1 aaGGGAcccccctcg
MMP1 gagggagcTTCCtag TGFB1 gaGGGActctgcctc
SELL agtgggtcTTCCttt TGFB1 gaGGGGggtcccttc
SELL agtggcacTTCCtga TGFB1 acGGGGcgtcccccc
SFN catggagtTTCCcaa
NF-κB and ETS TFBS totals

TFBS SFN EP300 ATM EP300 TGFB1 SELL MMP1

V$NFKB 2 4 1 4 4 2 1
V$ETSF 5 5 7 5 2 8 1
Distribution of Conserved NF-κB and ETS TFBS in Cluster 14 Genes†

TFBS SFN EP300 ATM TGFB1 SELL MMP1

CREL-01 0 4 2 1 0 1
NFKAPPAB-01 2 5 0 9 0 0
NFKAPPAB50-01 0 1 0 5 0 0
NFKAPPAB65-01 0 2 0 2 0 0
NFKB-C 0 3 0 2 0 0
NFKB-Q6 0 3 0 2 0 1
NFKB-Q6_01 0 2 0 2 0 0
ETS1-B 2 6 0 9 0 2
ETS2-B 1 2 0 5 0 2
CETS168-Q6 5 11 1 9 0 2
CETS1P54-01 5 6 0 8 0 0
ELK1-01 0 4 0 1 0 2
ELK1-02 4 11 2 7 0 1
Length, bp 744 1207 164 821 74 189

Figure 2. Validation of Rel/κB target genes by ChiP-qPCR.

Figure 2

Jurkat T-cells were PMA/ionomycin stimulated and then ChIP-qPCR was performed using IgG or cRel antibodies and primers for the promoters of ATM, EP300, SFN, TGFβ, MMP1 and SELL. Data were normalized to input, non-specific IgG and the α-cRel background signal at Rhodopsin. Results were reproducible in two independent experiments

Regulation of the putative Rel/κB targets by the NF-κB pathway

To determine if the six Rel/κB bound genes were inducibly regulated by NF-κB pathways following stimulation, RNA was isolated from mitogen stimulated cells treated in the presence or absense of the membrane diffusible NF-κB nuclear import inhibitory peptide SN5018 and measured for gene specific expression by quantitative RT-PCR (Fig. 3A). Expression of all six genes was induced within 45 minutes following stimulation and all six genes were repressed by NF-κB blockade with SN50 (Fig. 3A). Genetic confirmation of a NF-κB requirement for phorbol inducible expression of all six Rel/κB targets was obtained using mouse embryonic fibroblasts carrying a homozygous deletion of the NF-κB p50 subunit (MEFp50-/-) (Fig. 3B). Furthermore, HEK 293T cells were transfected with shRNA cRel or shRNA scramble control plasmids and after 72hs cluster 14 mRNA levels was measured by RT-qPCR. As shown in Fig. 3C, all six genes showed significantly decreased expression by shRNA cRel blockade. In summary, these in vivo results clearly reveal show that the genes in cluster 14 are direct targets of NF-κB signlaing.

Figure 3. NF-κB blockade inhibits the endogenous expression of all six putative Rel/κB targets.

Figure 3

(A). Jurkat T-cells were PMA/ionomycin stimulated (■) or preincubated with SN50 NF-κB blocking peptide (□) 30′ and then PMA/ionomycin stimulated prior to RNA isolation and RT-qPCR. Data were normalized with ACTB. Similar results were obtained for 3 independent experiments. (B). MEF p50+/+ or MEF p50-/- were PMA/ionomycin stimulated. RNA isolation and RT-qPCR was performed. Data were normalized with ACTB. Data are average to duplicate measurements and error bars represent +/- standard error of the mean. (C). HEK 293T cells were transfected with shRNA cRel or shRNA scramble plasmids and after 72hs cells were harvested and protein or RNA isolation was performed. WB using antibodies against cRel or actin were developed. RT-qPCR for the cluster 14 genes was determined. Data were normalized with ACTB. Data are average to duplicate measurements and error bars represent +/- standard error of the mean.

Co-regulation of Rel/κB controlled genes by Ets

Ets are a large family of mitogen-inducible transcription factors and recent studies have demonstrated that both NF-κB and Ets family transcription factor binding sites (TFBSs) are over-represented in the promoter of genes showing lymphoid specific expression.19, 20 Moreover, Ets factors can act in synergy with NF-κB to control target genes.21 Bioinformatic analysis of the promoter regions of cluster 14 showed a mutual occurrence of Ets and NF-κB binding sites (Table 1 and Table S2, S3, and S4). There was at least one Ets-site located within 150 bp of a κB-site in each promoter (Tables S2 and S3) and a significant number of both NF-κB and Ets sites were found to be conserved between human and mouse (Table 1). These data suggest that Ets might also have a role in the regulation of the cluster 14 genes. To support this hypothesis we examined the in vivo association of Ets1/Ets2 factors with the promoters of the cluster 14 genes following mitogen stimulation. As shown in Fig. 4A, ChIP shows that four of the six genes (ATM, SFN, MMP1 and SELL) are significantly enriched for Ets factors following mitogen stimulation. All of these four genes were substantially inhibited by disruption of Ets pathways via expression of a dominant negative Ets2 expression vector lacking the N-terminal transactivation domain (Fig. 4B).11

Figure 4. Disruption of Ets transactivation inhibits endogenous of ATM, SFN, MMP1 and SELL expression.

Figure 4

(A). ChIP-qPCR for cluster 14 genes was done using Ets or IgG antibodies in Jurkat T-cells after PMA/ionomycin stimulation. Data were normalized to input, IgG and the cRel background signal for Rhodopsin. (B). Jurkat T-cells were transfected with pcDNA3 or pcDNA3-Ets DN plasmid and after 24h cells were PMA/ionomycin stimulated. RNA isolation and RT-qPCR was performed. Data were normalized to ACTB. Results are means of duplicate measurements (±SEM) and graphics show one representative experiment from two independent assays.

Regulation of ATM protein levels and function by Rel/κB

ATM is a protein kinase that plays a central role in the maintenance of genome stability by coordinating the response to DNA damage. ATM levels are significantly upregulated in proliferating lymphocytes and many substrates of ATM following genotoxic stress are cell cycle regulators including the tumor suppressors p53 and BRCA1.22 As shown in Fig. 5A, the levels of ATM mRNA and protein are significantly reduced in proliferating donor PBMCs by NF-κB blockade with SN50. Similarly, ATM protein induction by either phorbol ester or the genotoxic agent doxorubicin is significantly attenuated in SN50 pre-treated Jurkat T-cells (Fig. 5B).

Figure 5. Regulation of ATM by Rel/κB.

Figure 5

(A). PBMCs cells were incubated with SN50 blocking peptide 16h and total RNA and protein were isolated. RT-qPCR and western blot for ATM was performed. Data were normalized to ACTB. (B). Jurkat T-cells were incubated as shown (PMA/ionomycin: 1h; Doxorubicin: 3h; SN50 NF-κB blocking peptide preincubation 30′) and whole lysates were analyzed by western blot for ATM or ACTB. (C). Western blot for phosphorylated BRCA1Ser1524 and Ser1497, total BRCA1 and NuMA were performed from Jurkat T-cells. Fold induction of phosphorylated BRCA1Ser1524 related to BRCA1 total was obtained after quantitation with ImageQuant 5.2 software. One representative experiment from three independent experiments with comparable results is shown. (D). MEF cells growing in chamber slides were irradiated (2 Gy), and fixed at the specified times for immunocytochemical analysis of nuclear H2AX foci. Foci were evaluated in 50 nuclei per treatment per experiment. Cells with more than five foci per nucleus were classified as positive for radiation-induced γH2AX. Asterisk (*) indicates a P <0.001 compared to WT according to Student's t-test. Right panel shows a line graph of an independent experiment over similar time course to demonstrate persistence of foci after prolong (>4 h) repair time.

A well known ATM-specific phosphorylation site on BRCA1 is Ser1524.23 To determine if doxorubicin induced BRCA1 phosphorylation is impaired following NF-κB blockade we examined the levels of BRCA1ser1524 phosphorylation following NF-κB blockade. Doxorubicin-dependent ser1524 phosphorylation is notably reduced after NF-κB blockade while phosphorylation at an ATM-independent site (ser1497) is not (Fig. 5C). These results suggest the ATM mediated DNA-repair in cells defective in NF-κB function should be impaired.

Furthermore, MEF cells p50-/- and p50+/+, and MEF cells p50+/+ pre-treated with the NF-κB inhibitor parthenolide24, were exposed to 2Gy ionizing radiation and allowed to repair over an interval of 6 hours. The extent of DNA repair was then determined by counting the phospho-γH2AX positive nuclear foci that remained after irradiation. As shown in Fig. 5D, NF-κB inhibition by parthenolide or deficiency in p50 is associated with greater persistence of unrepaired foci following exposure to ionizing radiation. This observation shows that impaired NF-κB signaling can lead to deficits in DNA repair.

Discussion

In this study ChIP/Chip technology was used to profile the kinetic association of Rel/κB complexes with several genes known to be induced in mitogen stimulated T-cells. New candidate genes were validated by coupling of quantitative ChIP with direct measurement of transcript levels and bioinformatics. Six previously unrecognized targets of Rel/NF-κB were identified. Common features of this class include early and sustained assembly of cRel-containing complexes (within 15-30 min of mitogen stimulation), rapid elevation of RNA transcript levels (within 45 min after stimulation), and validation of NF-κB control by both molecular and genetic studies. Common genomic features of promoter composition within this group show coregulation by the Ets family of transcription factors validated by ChIP-qPCR and loss of mitogen-induced transcript accumulation following disruption of Ets transcriptional control.

The strategy outlined in this paper provides a robust means of identifying true transcriptional targets of Rel/κB that can be expanded to larger genomic platforms capable of analyzing thousands of genes.8-10, 25 However there are certain limitations of the approach that warrant discussion. First, screening with discrete promoter fragments 500-1000 bp in length and anchored at the transcription start site will miss many interactions that occur at greater distances relative to the primary transcript as has been described recently for several p65 binding sites in chromosome 22.9 Second, NF-κB transcriptional control occurs with differing specificity and kinetics depending on the stimulus and cell type. Our use of phorbol ester and ionomycin provides a robust stimulation of NF-κB in T-cells but results may differ significantly when other stimuli and cell types are assessed. We have biased our screen for changes in occupancy that occur within the first 45 min. Late assembly would not be detected. Also because of limitations in determining absolute baselines, the approach used here is biased toward dynamic changes relative to the control or unstimulated state. Those interactions that may be constitutive, as suggested in previous studies of various NF-κB subunits in other cell types9, will not be reliably discriminated from background. Finally our screen focused on those gene groups showing increased association. Those groups that showed no change or a decrease were ignored. Nonetheless expansion of this kinetic profiling method to large-scale studies is highly feasible and will yield stimulus and cell-specific information that will complement and extend recent studies.9 The use of tiling promoter arrays for such kinetic studies is likely to be most informative approach when coupled to validation by quantitative ChIP and RNA transcript measurement.9 In prior studies ChIP/Chip methods were used to identify p65 binding sites on chromosome 22 in TNF-α stimulated HeLa cells (cervical carcinoma) and the binding sites for p65, cRel, p50 and p52 in LPS stimulated U937 cells (monocytic lymphoma). Of the total number of NF-κB targets identified, the only potential candidate corroborated by our study was EP300.9 This lack of correlation is likely due to the difference in stimulation and cell type used in these studies and differential genomic coverage of the arrays platforms. It should be noted however that recent gene expression analysis of T-cells deficient in cRel reveals a deficit in SELL expression (F. Shannon, personal communication).

cRel is primarily expressed in cells of hematopoietic origin.26 Few genes have been identified that are exclusively regulated by cRel.27 Thus, though we cannot be absolutely sure that our ChIP studies exclusively recognize cRel containing complexes, it will be important to determine if the κB targets identified in this current study will be similarly targeted by NF-κB in cells that do not express cRel.

The new Rel/κB targets identified in this study belong to diverse functional classes governing transcriptional regulation, differentiation, cell cycle control, genome stability, cellular adhesion, connective tissue remodeling and cellular motility. MMP1 is a well known Ets inducible metalloproteinase involved in tissue remodeling. However there are numerous other functions of MMP1 that have profound influence on cellular behavior by degrading insulin-like growth factor binding proteins, TNF-α and stromal cell-derived-factor 1.28 Thus MMP1 control through κB could have significant influence on cellular growth and the pro-inflammatory response. The suppressive activity of TGFβ1 during the immune response is well known, and past studies have suggested that TGFβ1 can inhibit NF-κB activity directly.29 NF-κB may therefore participate in an intricate array of repressive feedback loops to mediate homeostasis during the immune response. SFN is a relatively uncharacterized tumor suppressor gene expressed in lymphoid cells.30 It also occurs in a releasable form that upregulates MMP1 expression in dermal fibroblasts.31 SELL is expressed on the membrane surface of almost all leukocytes. It is induced during the inflammatory response, and plays a major functional role in facilitating transendothelial migration. EP300 is a well known transcriptional co-activator and histone acetylase that plays a central role in signal-regulated transcriptional control.32 Several prior studies implicate a distinct role for EP300 in DNA repair.33, 34 The combined regulation of both ATM and EP300 by NF-κB strongly implicates a prominent role for NF-κB in maintaining genome stability.

Several studies have suggested that ATM functions upstream of NF-κB by regulating the I-κB kinase.35, 36 The finding that ATM is both up and downstream from NF-κB may shed new light on critical events during B-cell development where depletion of ATM, secondary to impaired NF-κB signaling, could have dire consequences for maintaining genome integrity.37 Loss of ATM in p53 null tissues increases sensitivity to DNA damaging agents38, attenuation of ATM expression has been shown to increase radiosensitivity of human tumors39, 40 and recent studies demonstrate a correlation between ATM expression and radio-resistance.41 Given the well known role played by unrestrained NF-κB activity in human malignancies1, it is quite likely that NF-κB induction of ATM may be an underlying mechanism that contributes to the resistance of various tumors to DNA-damaging agents. This would especially be the case in those tumors that are associated with loss of p53 function.

Supplementary Material

Supplement

Acknowledgments

This research was supported by the Intramural Research Program of the NIH, National Cancer Institute, and the National Institute on Aging.

References

  • 1.Karin M, Lin A. NF-kappaB at the crossroads of life and death. Nature immunology. 2002;3:221–7. doi: 10.1038/ni0302-221. [DOI] [PubMed] [Google Scholar]
  • 2.Siebenlist U, Brown K, Claudio E. Control of lymphocyte development by nuclear factor-kappaB. Nature reviews. 2005;5:435–45. doi: 10.1038/nri1629. [DOI] [PubMed] [Google Scholar]
  • 3.May MJ, Ghosh S. Signal transduction through NF-kappa B. Immunology today. 1998;19:80–8. doi: 10.1016/s0167-5699(97)01197-3. [DOI] [PubMed] [Google Scholar]
  • 4.Luo JL, Kamata H, Karin M. IKK/NF-kappaB signaling: balancing life and death--a new approach to cancer therapy. The Journal of clinical investigation. 2005;115:2625–32. doi: 10.1172/JCI26322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sovak MA, Bellas RE, Kim DW, Zanieski GJ, Rogers AE, Traish AM, Sonenshein GE. Aberrant nuclear factor-kappaB/Rel expression and the pathogenesis of breast cancer. The Journal of clinical investigation. 1997;100:2952–60. doi: 10.1172/JCI119848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Pahl HL. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene. 1999;18:6853–66. doi: 10.1038/sj.onc.1203239. [DOI] [PubMed] [Google Scholar]
  • 7.Karin M, Ben-Neriah Y. Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annual review of immunology. 2000;18:621–63. doi: 10.1146/annurev.immunol.18.1.621. [DOI] [PubMed] [Google Scholar]
  • 8.Ren B, Robert F, Wyrick JJ, Aparicio O, Jennings EG, Simon I, Zeitlinger J, Schreiber J, Hannett N, Kanin E, Volkert TL, Wilson CJ, Bell SP, Young RA. Genome-wide location and function of DNA binding proteins. Science (New York, NY. 2000;290:2306–9. doi: 10.1126/science.290.5500.2306. [DOI] [PubMed] [Google Scholar]
  • 9.Martone R, Euskirchen G, Bertone P, Hartman S, Royce TE, Luscombe NM, Rinn JL, Nelson FK, Miller P, Gerstein M, Weissman S, Snyder M. Distribution of NF-kappaB-binding sites across human chromosome 22. Proceedings of the National Academy of Sciences of the United States of America. 2003;100:12247–52. doi: 10.1073/pnas.2135255100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wu J, Smith LT, Plass C, Huang TH. ChIP-chip comes of age for genome-wide functional analysis. Cancer research. 2006;66:6899–902. doi: 10.1158/0008-5472.CAN-06-0276. [DOI] [PubMed] [Google Scholar]
  • 11.Galang CK, Garcia-Ramirez J, Solski PA, Westwick JK, Der CJ, Neznanov NN, Oshima RG, Hauser CA. Oncogenic Neu/ErbB-2 increases ets, AP-1, and NF-kappaB-dependent gene expression, and inhibiting ets activation blocks Neu-mediated cellular transformation. The Journal of biological chemistry. 1996;271:7992–8. doi: 10.1074/jbc.271.14.7992. [DOI] [PubMed] [Google Scholar]
  • 12.Smith JL, Freebern WJ, Collins I, De Siervi A, Montano I, Haggerty CM, McNutt MC, Butscher WG, Dzekunova I, Petersen DW, Kawasaki E, Merchant JL, Gardner K. Kinetic profiles of p300 occupancy in vivo predict common features of promoter structure and coactivator recruitment. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:11554–9. doi: 10.1073/pnas.0402156101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.McNutt MC, Tongbai R, Cui W, Collins I, Freebern WJ, Montano I, Haggerty CM, Chandramouli G, Gardner K. Human promoter genomic composition demonstrates non-random groupings that reflect general cellular function. BMC bioinformatics. 2005;6:259. doi: 10.1186/1471-2105-6-259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Stajich JE, Block D, Boulez K, Brenner SE, Chervitz SA, Dagdigian C, Fuellen G, Gilbert JG, Korf I, Lapp H, Lehvaslaiho H, Matsalla C, Mungall CJ, Osborne BI, Pocock MR, Schattner P, Senger M, Stein LD, Stupka E, Wilkinson MD, Birney E. The Bioperl toolkit: Perl modules for the life sciences. Genome research. 2002;12:1611–8. doi: 10.1101/gr.361602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Butscher WG, Powers C, Olive M, Vinson C, Gardner K. Coordinate transactivation of the interleukin-2 CD28 response element by c-Rel and ATF-1/CREB2. The Journal of biological chemistry. 1998;273:552–60. doi: 10.1074/jbc.273.1.552. [DOI] [PubMed] [Google Scholar]
  • 16.Camphausen K, Brady KJ, Burgan WE, Cerra MA, Russell JS, Bull EE, Tofilon PJ. Flavopiridol enhances human tumor cell radiosensitivity and prolongs expression of gammaH2AX foci. Molecular cancer therapeutics. 2004;3:409–16. [PubMed] [Google Scholar]
  • 17.Khoshnan A, Tindell C, Laux I, Bae D, Bennett B, Nel AE. The NF-kappa B cascade is important in Bcl-xL expression and for the anti-apoptotic effects of the CD28 receptor in primary human CD4+ lymphocytes. J Immunol. 2000;165:1743–54. doi: 10.4049/jimmunol.165.4.1743. [DOI] [PubMed] [Google Scholar]
  • 18.Kolenko V, Bloom T, Rayman P, Bukowski R, Hsi E, Finke J. Inhibition of NF-kappa B activity in human T lymphocytes induces caspase-dependent apoptosis without detectable activation of caspase-1 and -3. J Immunol. 1999;163:590–8. [PubMed] [Google Scholar]
  • 19.Smith EM, Gregg M, Hashemi F, Schott L, Hughes TK. Corticotropin Releasing Factor (CRF) activation of NF-kappaB-directed transcription in leukocytes. Cellular and molecular neurobiology. 2006;26:1021–36. doi: 10.1007/s10571-006-9040-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Barrette TR, Ghosh D, Chinnaiyan AM. Mining for regulatory programs in the cancer transcriptome. Nature genetics. 2005;37:579–83. doi: 10.1038/ng1578. [DOI] [PubMed] [Google Scholar]
  • 21.John S, Reeves RB, Lin JX, Child R, Leiden JM, Thompson CB, Leonard WJ. Regulation of cell-type-specific interleukin-2 receptor alpha-chain gene expression: potential role of physical interactions between Elf-1, HMG-I(Y), and NF-kappa B family proteins. Molecular and cellular biology. 1995;15:1786–96. doi: 10.1128/mcb.15.3.1786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fukao T, Kaneko H, Birrell G, Gatei M, Tashita H, Yoshida T, Cross S, Kedar P, Watters D, Khana KK, Misko I, Kondo N, Lavin MF. ATM is upregulated during the mitogenic response in peripheral blood mononuclear cells. Blood. 1999;94:1998–2006. [PubMed] [Google Scholar]
  • 23.Cortez D, Wang Y, Qin J, Elledge SJ. Requirement of ATM-dependent phosphorylation of brca1 in the DNA damage response to double-strand breaks. Science (New York, NY. 1999;286:1162–6. doi: 10.1126/science.286.5442.1162. [DOI] [PubMed] [Google Scholar]
  • 24.Hehner SP, Hofmann TG, Droge W, Schmitz ML. The antiinflammatory sesquiterpene lactone parthenolide inhibits NF-kappa B by targeting the I kappa B kinase complex. J Immunol. 1999;163:5617–23. [PubMed] [Google Scholar]
  • 25.Collas P, Dahl JA. Chop it, ChIP it, check it: the current status of chromatin immunoprecipitation. Front Biosci. 2008;13:929–43. doi: 10.2741/2733. [DOI] [PubMed] [Google Scholar]
  • 26.Gugasyan R, Grumont R, Grossmann M, Nakamura Y, Pohl T, Nesic D, Gerondakis S. Rel/NF-kappaB transcription factors: key mediators of B-cell activation. Immunological reviews. 2000;176:134–40. doi: 10.1034/j.1600-065x.2000.00615.x. [DOI] [PubMed] [Google Scholar]
  • 27.Sanjabi S, Hoffmann A, Liou HC, Baltimore D, Smale ST. Selective requirement for c-Rel during IL-12 P40 gene induction in macrophages. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:12705–10. doi: 10.1073/pnas.230436397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pardo A, Selman M. MMP-1: the elder of the family. The international journal of biochemistry & cell biology. 2005;37:283–8. doi: 10.1016/j.biocel.2004.06.017. [DOI] [PubMed] [Google Scholar]
  • 29.Gorelik L, Flavell RA. Immune-mediated eradication of tumors through the blockade of transforming growth factor-beta signaling in T cells. Nature medicine. 2001;7:1118–22. doi: 10.1038/nm1001-1118. [DOI] [PubMed] [Google Scholar]
  • 30.Bhatia K, Siraj AK, Hussain A, Bu R, Gutierrez MI. The tumor suppressor gene 14-3-3 sigma is commonly methylated in normal and malignant lymphoid cells. Cancer Epidemiol Biomarkers Prev. 2003;12:165–9. [PubMed] [Google Scholar]
  • 31.Ghahary A, Marcoux Y, Karimi-Busheri F, Li Y, Tredget EE, Kilani RT, Lam E, Weinfeld M. Differentiated keratinocyte-releasable stratifin (14-3-3 sigma) stimulates MMP-1 expression in dermal fibroblasts. The Journal of investigative dermatology. 2005;124:170–7. doi: 10.1111/j.0022-202X.2004.23521.x. [DOI] [PubMed] [Google Scholar]
  • 32.Goodman RH, Smolik S. CBP/p300 in cell growth, transformation, and development. Genes & development. 2000;14:1553–77. [PubMed] [Google Scholar]
  • 33.Hasan S, Hassa PO, Imhof R, Hottiger MO. Transcription coactivator p300 binds PCNA and may have a role in DNA repair synthesis. Nature. 2001;410:387–91. doi: 10.1038/35066610. [DOI] [PubMed] [Google Scholar]
  • 34.Tini M, Benecke A, Um SJ, Torchia J, Evans RM, Chambon P. Association of CBP/p300 acetylase and thymine DNA glycosylase links DNA repair and transcription. Molecular cell. 2002;9:265–77. doi: 10.1016/s1097-2765(02)00453-7. [DOI] [PubMed] [Google Scholar]
  • 35.Li N, Banin S, Ouyang H, Li GC, Courtois G, Shiloh Y, Karin M, Rotman G. ATM is required for IkappaB kinase (IKKk) activation in response to DNA double strand breaks. The Journal of biological chemistry. 2001;276:8898–903. doi: 10.1074/jbc.M009809200. [DOI] [PubMed] [Google Scholar]
  • 36.Brzoska K, Szumiel I. Signalling loops and linear pathways: NF-kappaB activation in response to genotoxic stress. Mutagenesis. 2009;24:1–8. doi: 10.1093/mutage/gen056. [DOI] [PubMed] [Google Scholar]
  • 37.Sekiguchi J, Ferguson DO, Chen HT, Yang EM, Earle J, Frank K, Whitlow S, Gu Y, Xu Y, Nussenzweig A, Alt FW. Genetic interactions between ATM and the nonhomologous end-joining factors in genomic stability and development. Proceedings of the National Academy of Sciences of the United States of America. 2001;98:3243–8. doi: 10.1073/pnas.051632098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Westphal CH, Hoyes KP, Canman CE, Huang X, Kastan MB, Hendry JH, Leder P. Loss of atm radiosensitizes multiple p53 null tissues. Cancer research. 1998;58:5637–9. [PubMed] [Google Scholar]
  • 39.Fan Z, Chakravarty P, Alfieri A, Pandita TK, Vikram B, Guha C. Adenovirus-mediated antisense ATM gene transfer sensitizes prostate cancer cells to radiation. Cancer gene therapy. 2000;7:1307–14. doi: 10.1038/sj.cgt.7700242. [DOI] [PubMed] [Google Scholar]
  • 40.Guha C, Guha U, Tribius S, Alfieri A, Casper D, Chakravarty P, Mellado W, Pandita TK, Vikram B. Antisense ATM gene therapy: a strategy to increase the radiosensitivity of human tumors. Gene therapy. 2000;7:852–8. doi: 10.1038/sj.gt.3301174. [DOI] [PubMed] [Google Scholar]
  • 41.Tribius S, Pidel A, Casper D. ATM protein expression correlates with radioresistance in primary glioblastoma cells in culture. International journal of radiation oncology, biology, physics. 2001;50:511–23. doi: 10.1016/s0360-3016(01)01489-4. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement

RESOURCES