Early and sustained expression of latent and host modulating genes in coordinated transcriptional program of KSHV productive primary infection of human primary endothelial cells

Abstract

Coordinated expression of viral genes in primary infection is essential for successful infection of host cells. We examined the expression profiles of Kaposi’s sarcoma-associated herpesvirus (KSHV) transcripts in productive primary infection of primary human umbilical vein endothelial cells by whole-genome reverse-transcription real-time quantitative PCR. The latent transcripts were expressed early and sustained at high levels throughout the infection while the lytic transcripts were expressed in the order of immediate early, early, and lytic transcripts, all of which culminated before the production of infectious virions. Significantly, transcripts encoding genes with host modulating functions, including mitogenic and cell cycle-regulatory, immune-modulating, and anti-apoptotic genes, were expressed before those encoding viral structure and replication genes, and sustained at high levels throughout the infection, suggesting KSHV manipulation of host environment to facilitate infection. The KSHV transcriptional program in a primary infection defined in this study should provide a basis for further investigation of virus–cell interactions.

Introduction

Kaposi’s sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV8), is a gammaherpesvirus discovered in a Kaposi’s sarcoma (KS) lesion from a patient with AIDS (Chang et al., 1994). KS is a highly vascular angiogenic tumor consisting of proliferating spindle-shape endothelial cells with an infiltration of inflammatory cells (Roth et al., 1992). In the last two decades, KS has evolved from a rare disease restricted to the Mediterranean and Eastern European regions into an emerging dominant malignancy in some African countries, and in patients with AIDS in other parts of the world (Dedicoat and Newton, 2003). Infection with KSHV is associated with the development of all four clinical forms of Kaposi’s sarcoma (KS), including epidemic AIDS-KS, endemic African KS, immunosuppressive iatrogenic organ transplantation KS, and classical KS. KSHV is also linked to the development of primary effusion lymphoma (PEL) and a subtype of multicentric Castleman’s disease (MCD) (Moore, 2000).

The KSHV genome consists of a 140.5-kb long-unique-coding-region (LUR) and 30-kb terminal repeat (TR) sequence (Russo et al., 1996). The LUR contains approximately 90 genes/Orfs, most of which encode for viral structural proteins or proteins involved in viral replication. KSHV also encodes a unique set of genes denoted by letter “K”. Molecular cloning studies have so far shown that over a dozen KSHV genes have host/cellular regulatory functions, including genes that are mitogenic and cell cycle-regulatory (KIS, vIL-6, K-bZip, vIRF-1, Kaposin, vFLIP, vCyclin, LANA, vGPCR, and LAMP), anti-apoptotic (vIL-6, vIAP, vbcl-2, vIRF-1, vIRF-3, vIRF-2, and vFLIP), and immune-modulating (KIS, vKCP, MIR1, vCCL-2, MIR2, vCCL-1, Orf45, vIRF-1, vIRF-2, and vOx-2) (Dourmishev et al., 2003; Russo et al., 1996). Further understanding of the functions of KSHV genes in viral infection and replication, and development of KSHV-related malignancies requires the delineation of expression of KSHV genes during different phases of viral infection.

KSHV genes are broadly classified as latent or lytic genes, reflecting latent and lytic replication phases of the virus, respectively. The lytic genes are further divided into immediate early (IE), early, and late genes. The category to which a gene belongs depends on its expression in the infected host and KSHV-related malignancies, its response to chemical inducers and inhibitors, and its homology to sister genes of other herpesviruses. In KS lesions, the majority of the tumor cells are latently infected by KSHV, which indicates the importance of viral latent replication in the development of KS (Moore and Chang, 2001). Nevertheless, a small number of the infected cells also undergo spontaneous lytic replication. These lytic cycle cells are important not only for sustaining the growth of KS tumors through autocrine and paracrine effects by direct production of KSHV-encoded cytokines or indirect induction of cellular cytokines, but also for generating infectious virions that spread to other cells. Thus, the delineation of the molecular basis of KSHV latent vs. lytic replication, and that of primary infection are essential for understanding the pathogenesis of KSHV-induced malignancies. Although previous studies have investigated the expression profiles of KSHV genes in reactivation from latency in KSHV-infected PEL cell lines by Northern-blot hybridization (Sarid et al., 1998; Sun et al., 1999), microarray (Jenner et al., 2001; Paulose-Murphy et al., 2001), or reverse-transcription real-time quantitative PCR (RT-qPCR) (Fakhari and Dittmer, 2002), definitions of the cellular and viral events in KSHV primary infection have been hampered by the lack of an efficient and sustainable infection system.

KSHV infects a variety of human cell types, including B, T, endothelial, epithelial, fibroblast, and keratinocyte cells; however, primary infection efficiencies in these systems are usually low or cannot be sustained for long-term culture. Furthermore, KSHV usually establishes a latent infection immediately following infection of these systems (Krishnan et al., 2004). The expression of KSHV genes in primary infection was analyzed in default latent infection systems of primary human dermal microvascular endothelial cells (HMVEC) and human foreskin fibroblast (HFF) in the first 8 and 24 h post-infection (h.p.i.), respectively, providing some insights into the transcriptional program leading to KSHV default latency (Krishnan et al., 2004). We have recently established an efficient infection system by using a recombinant KSHV BAC36 to infect primary human umbilical vein endothelial cells (HUVEC) (Gao et al., 2003). In contrast to other KSHV infection systems, KSHV infection of HUVEC in this system is permissive at the early stage of infection, producing large numbers of infectious virions. Thus, unlike other KSHV infection systems, this system resembles more closely the permissive infection systems of other herpesviruses. In this system, KSHV primary infection of HUVEC cultures reaches an infection efficiency of up to 90%, and consists of two phases. The first is a permissive phase, in which the cultures undergo active viral lytic replication, producing a large number of virions and concomitantly resulting in large-scale cell death (Gao et al., 2003). The second is a latent phase, in which cells surviving the permissive phase switch into a latent infection, with a small number of cells undergoing spontaneous viral lytic replication, and proliferate into bundles of KS-like spindle cells (Gao et al., 2003). In the current study, we used whole-genome RT-qPCR to comprehensively assess the expression profiles of KSHV transcripts in this productive primary infection system by examining 10 time points (0–78 h.p.i.) post-infection of HUVEC with BAC36. We found that expression of KSHV genes occurred in a coordinated fashion according to both gene class and gene function. Such highly orchestrated events are likely essential to ensure a successful KSHV primary infection and subsequent establishment of a persistent infection in the host cells.

Results

Permissive primary infection of HUVEC by KSHV

We have previously shown that efficient primary infection of HUVEC by KSHV is productive at the early stage of infection (Gao et al., 2003). Since KSHV replication in this system is different from those in other default latent infection systems but more similar to the permissive infection systems of other herpesviruses, we further examined the expression profiles of KSHV genes in this distinct infection system. HUVEC cultures were infected with high titers of BAC36 KSHV. Two days after infection, close to 90% of cells were green fluorescent protein (GFP)-positive, an indication of high efficient KSHV infection. As previously observed, KSHV entered active lytic replication 4–5 day post-infection (d.p.i.) as evidenced by the expression of a lytic protein mCP encoded by Orf65 in close to 50% of infected cells and active production of infectious virions (data not shown). HUVEC infected by BAC36 at 10 different time points, ranging from 0 (mock-infected control) to 78 h.p.i., were collected for further analysis for KSHV transcriptional program by RT-qPCR.

Specificity and sensitivity of the primer pairs

A total of 92 primer pairs were used to examine the expression profiles of KSHV transcripts (Table 1). The KSHV genome has two gene clusters, Orf71/Orf72/Orf73 and Orf50/OrfK8/OrfK8.1, that have multiple complex alternative splicing transcripts. The positions of their primers are illustrated in Fig. 1. To evaluate the relative sensitivity of each primer pair for amplification of their target sequence, we used purified BAC36 as a copy number control in qPCR. The results of qPCR were determined by analyzing the melting curves and C_T values (Figs. 2A and B). Most of the primer pairs produced melting curves with specific peaks using BAC36 DNA as templates. The 24 primer pairs designed to amplify splicing regions of the transcripts (Table 1) were not evaluated with genomic DNA; however, these primer pairs also produced melting curves with specific peaks when cDNA from KSHV-infected samples was used as templates (Table 2). When the primer pairs were used to amplify a fixed copy number of KSHV genomes (1,091,642 copies), the average C_T value was 24.5 ± 4.5 (Fig. 2C). The Orf16 primer pair had the lowest C_T value (i.e., highest sensitivity, 18.2 ± 1.1) while the Orf52 primer pair had the highest C_T value (36.3 ± 0.6). The difference of C_T value between Orf16 and Orf52 was 18.1 ( $C_{\text{T}}^{\text{Orf}16}-C_{\text{T}}^{\text{Orf}52}=-18.1$), translating into 2.9 × 10⁵ times better amplification efficiency for Orf16 primers than Orf52 primers. The distribution range of C_T values of the amplifiable primer pairs was noticeably wide, reflecting variations in amplification efficiency in qPCR (Fig. 2C). Under our experimental conditions, the extrapolated sensitivities of the primer pairs ranged from 1 (Orf16) to 2675 copies (Orf52) (median, 1).

Table 1.

KSHV primers used for reverse-transcription real-time quantitative PCR

Primer pair	Gene location (KSU75698)	Orientation (splicing)a	Target position (KSU75698)	Product sizeb	Forward primer sequence	Reverse primer sequence
OrfK1c	105– 974	+	196– 280	85	TGATTTCAACGCCTTACACG	CGCAAAAGCCGAGTATTGTT
Orf4	1142–2794	+	2638–2702	65	GCCTCAGAGACCGCGAGA	AGCGATTTTTAGACGCCGG
Orf6	3210– 6611	+	5302–5367	66	CTGCCATAGGAGGGATGTTTG	CCATGAGCATTGCTCTGGCT
Orf7	6628– 8715	+	8259–8322	64	TTTATTTCCCAGTCCTCCAAATG	GGGAAGCATGCCCGC
Orf8	8699– 11236	+	11003– 11065	63	CCCGACGTAGATCGCAGG	GTTTTTGATTTCCTCCCGTGTT
Orf9	11363– 14401	+	12070–12131	62	TAGGCGCTTCGTGCTGG	CCGGATTGCTGCACTCGTA
Orf10	14519–15775	+	15583–15645	63	GGGCGTGGCAATGGC	AAGCTGTATGGTGCCTGGCT
Orf11	15790–17013	+	16772–16833	62	CGGAATGGCGCCCAA	GACGGGATGATCACTCGTGTT
OrfK2	17875–17261	−	17754–17690	65	ACCCTTGCAGATGCCGG	GGATGCTATGGGTGATCGATG
Orf2	18553–17921	−	18119– 18057	63	TGCTCGCCAGGCTTGG	CGTGTTTCTCTCGCATGATAGC
OrfK3	19609–18608	− (spl)	18809–18749	61	AGCCCCATCGCCCG	TGAGCGGTATAGGGCCACTTAC
Orf70	21104– 20091	−	20257–20197	61	AGGCGCGGAAAGGGAC	AAACGCATATAGAGCCACTACGG
OrfK4	21832–21548	−	21795–21735	61	TTGTCCGGTCTATGCCAGG	CTGCCTTGCTTTGTTTGCAA
OrfK5	26483–25713	− (spl)	25987–25924	64	ACAAGGACCGTCAATTCGATG	TGCCATACCGACGGCC
OrfK6	27424–27137	−	27393–27327	67	GGCGTGTACGACACGAGTGA	GCGTACTGCTTGCCACGTT
OrfK7	28622–29002	+	28735–28793	59	GCCGCTTCTGGTTTTCATTG	TTGCCAAAAGCGACGCA
Orf16	30145–30672	+	30344–30405	62	ACCAGCTTGGGTTGAGCATG	GGCTCGCCCCCAGTTC
Orf17	32482–30821	−	30942–30879	64	GAGCGACTGCTGGCTTCAAC	CGGTGGAGAAAGACGCTCC
Orf18	32424–33197	+	33113– 33175	63	AACGTATGCGGTCTCGGGT	GCACCAAGGTAGGCCAGCT
Orf19	34843–33194	−	33734–33673	62	ATACCAGGTTCAAGCGGCG	TGGATTGCTGGAGTTTGGG
Orf20	35573–34611	−	35296–35233	64	CGGCTACTTAGAAACCGCCA	CCACCTACCGCCGGC
Orf21	35383–37125	+	36960–37022	63	CGTAGCCGACGCGGATAA	TGCCTGTAGATTTCGGTCCAC
Orf22	37113– 39305	+	38129–38195	67	TCGGCAGTATGCGGAACTG	AGTGGTGAACGTGGGCATG
Orf23	40516–39302	−	39467–39403	65	TGCCGTCACATATCAGTTCGA	CCCCAAAGACCGTCAAAGC
Orf24	42778–40520	−	40890–40825	66	AGAAGTCAAACAGGCCCCG	GTTCGTTTCTCAGGCTTGACG
Orf25	42777–46907	+	46509–46579	71	CTCGGCGACGTGCTATACAAT	TGCCGACAAGGACTGTACATG
Orf26	46933–47850	+	47287–47519	233	AGCCGAAAGGATTCCACCAT	TCCGTGTTGTCTACGTCCAG
Orf27	47873–48745	+	48313–48375	63	CACCACGTTTGGACGCATT	TAATCCGTAGGCCTGCCGT
Orf28	48991–49299	+	49021–49083	63	GGAGGAATGGTGGACGGC	AAGACCAATCACGGGAGGCT
Orf29bc	50417–49362	− (spl)	50034–49917	118	GAAGTGCCTTGGAAAACAGC	GCTTCTGGTGGGAGTCTGAG
Orf30	50623–50856	+	50707–50773	67	GAGCAAGTGGTCGCGGG	TTTTGTGACATAGAGAGTCAGCGAG
Orf31c	50763–51437	+	51125– 51217	93	TGTGCGGTATTTGCAGACAT	ATAATGGCCGAGATGGTGTC
Orf32	51404–52768	+	52636–52698	63	GAGTCTTGTGGCATGCGTGA	CCCCCAGGTAACACAAGCC
Orf33c	52761–53699	+	53492–53579	88	GACCGGGAATGGAGTGACTA	AGCTGTTACCCTGCTCTGGA
Orf29ac	54676–53738	−	54302–54214	70	GGCCAGAAAAACACACGACT	CGTTCAGAAAGGACGAAAGG
Orf34	54675–55658	+	55135–55196	62	ACCCCCTTCCGTTGCTATG	ACAGTCGGCCCGACAAAA
Orf35	55639–56091	+	55838–55894	57	AGGCGGGCCAGAGGTTT	GCGGCTGGCGCAAA
Orf36	55976–57310	+	57094–57153	60	CACCGGCAAAGCCCAG	TGCTTCTGAAACGCCAGCT
Orf37	57273–58733	+	58593–58661	69	CCCGTCTACTTTCCCCGAG	ACTTCTTGACCAAAAGTTGGCAG
Orf38	58688–58873	+	58743–58811	69	GGGAACCGCTCGACGTAGT	GCTCAAGCAACATGCCCTTT
Orf39	60175–58976	−	59145–59083	63	TGGTCTTTGCTGGGAGGG	CGCCGACGGTCGATAGAA
Orf40c	60308–61681	+	60665–60780	116	AACGTCAGAACACCCAGACC	ATAGAGCTGTGCCACGTTCC
Orf41c	61827–62444	+	61986–62090	105	GGACCAGACACTGAGGGAAA	GTTTAGGGCTCGTTCAATGC
Orf42	63272–62436	−	62837–62778	60	GACGAAGGCCGCGTCC	ATTATTTGTCGCGCCAGAAAG
Orf43	64953–63136	−	63520–63454	67	GGATATGGTGTCCTGAGAATAGGTG GCTGGCTCCCGTTGTTGA
Orf44	64892–67258	+	66469–66533	65	GCCGGTGTCTCAAGAGCTG	TGTCCCCCTCCTGCCC
Orf45	68576–67353	−	67668–67606	63	GCTTTGCGGCTTAAGTTTGG	CGCCTCCTCTGGTAGCGA
Orf46c	69404–68637	−	68916–68813	104	CTGGGATTGGTTCACGAGTT	TGAGCGGAGTTCTGTCAATG
Orf47	69915–69412	−	69486–69424	63	TTGACCTGCGTGCGCTC	GGTTCTGTTAGCGGAAGTCAGAC
Orf48	71381–70173	− (spl)	70495–70434	62	CGGGCAAGCAAGCTGGT	CCCTGGCGATTTTGGGTAC
Orf49	72538–71630	−	72142–72081	62	ACAAAATGGGAGAGGCACCA	GCGCCCCTGGAATCAGA
Orf50	71596–74629	+ (spl)	71589–72645	98 (1057)	CACAAAAATGGCGCAAGATGA	TGGTAGAGTTGGGCCTTCAGTT
OrfK8(1)	74850–75569	+ (spl)	75728–75795	68	CATGCTGATGCGAATGTGC	AGCTTCAACATGGTGGGAGTG
OrfK8(2)	74850–75323	+ (spl)	75800–76459	65 (660)	TGTGCCGTCGTCCGG	TGGATGGTTCCCCAGATGA
OrfK8/K8.1	76433–76714	+ (spl)	76509–76583	75	TGGTGCTAGTAACCGTGTGCC	TCTGCATTGTAGTGCGCGTC
OrfK8.1	75915–76695	+ (spl)	76285–76539	160 (255)	AAAGCGTCCAGGCCACCACAGA	GGCAGAAAATGGCACACGGTTAC
Orf52	77197–76802	−	76915–76856	60	GGCACCAGGAGGCGGT	TCGCTTAGAATCGACGTCTGC
Orf53	77665–77333	−	77543–77481	63	GCAACGTCATAGAATCCTGGG	GCTCAGCGCCAGGCCT
Orf54	77667–78623	+	78444–78505	62	TTGCGCCATAGGAAGCTAGC	TCGCGAAAATGCACTCGAG
Orf55	79448–78765	−	78889–78830	60	ACGAATGCATCGCGGAA	CGGAGGCAACTTTACCCAAG
Orf56c	79436–81967	+	80735–80851	117	GACGGCCTAGAGCGATACTG	CGATAGGCTGAGGTCATGGT
Orf57(1)	82081–83544	+ (spl)	82091–82312	98 (222)	TGGACATTATGAAGGGCATCCTA	CGGGTTCGGACAATTGCT
Orf57(2)	82081–83544	+ (spl)	82250–82312	63	ACGAATCGAGGGACGACG	CGGGTTCGGACAATTGCT
OrfK9	85209– 83860	−	85347– 85207	141	GGCCCACTAATATGTCAGCCA	CATTGTCCCGCAACCAGACT
OrfK10	88164– 86074	−	86577– 86512	66	CCCAACAGGCCAGCTACATAA	CTTCGTGGAACTCTGAGACGC
OrfK10.5(1)	91394– 90936	− (spl)	91020– 90942	79	TGGTCTTCTCCGATGCTTCT	TCACCTACACAGTGGGTCATCAC
OrfK10.5(2)	91394– 90936	− (spl)	90815– 90753	63	TCCTCAGATTCCGCGCC	TGAGGAGGATCACCCAGCC
OrfK10.5(3)	91394– 90936	− (spl)	90753– 91020	177 (268)	TCCTCAGATTCCGCGCC	TCACCTACACAGTGGGTCATCAC
OrfK11	93367– 91964	−	92092– 92018	75	ATCCGAGTCATATTCAGGCGA	AATCGAGAACCTGAAGGGTCC
Orf58c	95544– 94471	+ (spl)	95009– 95121	113	TGCGGAGCATTTATGGTGTA	TGCCTAAATGCCAAAAGTCC
Orf59c	96739– 95549	−	95813– 95715	99	CGAGTCTTCGCAAAAGGTTC	AAGGGACCAACTGGTGTGAG
Orf60c	97787– 96870	−	97246– 97145	102	GCCTTGCCAACGATTACATT	CGTGACTGGGTTTTTCCTGT
Orf61	100194– 97816	−	97956– 97891	66	CCCATCTTGTTTCATCCCAGA	CTGACGGCTCTTCAGTGCC
Orf62	101194–100199	−	100283–100220	64	GCCACACGCGGCCTC	TCTGAACGTGAAGGGCACG
Orf63	101208– 103994	+	103279–103340	62	GCGACTTCGTGCGCGT	ATGCGACAGATGTACGTGCG
Orf64	104000– 111907	+	109840–109905	66	TGAGGTAATAAGGCAGCTGTGG	GAAGCCGTGTCGGATTCATC
Orf65c	112443–111931	−	112340– 112244	97	ATATGTCGCAGGCCGAATAC	CCACCCATCCTCCTCAGATA
Orf66	113759–112470	−	112558– 112494	65	GAACTCCAGCAGCTGTGAGGT	CTGCCCTATTAAAGCACCGTG
Orf67	114508–113693	−	114437– 114346	92	TCAGTCCCTGGATTTGGAAC	CGTGCTGCATTCTAACCGTA
Orf68	114768–116405	+	115770– 115833	64	GTGGTCGCATCCCACGA	ATGGACCCTGTGAGGTGTCTG
Orf69	116669–117346	+	117241– 117302	62	TGCAGTGCAGGTACACACCA	GCATCTCGTCGGTGCAGTCT
OrfK12c	118101–117919	−	118070– 117990	81	TTCATGTCCCGGATGTGTTA	TAATCGCCAACAGACAAACG
Orf71c	122710– 122291	−	122268–122156	113	GGATGCCCTAATGTCAATGC	GGCGATAGTGTTGGGAGTGT
Orf72	123566– 122793	− (spl)	122996–122936	61	CATTGCCCGCCTCTATTATCA	ATGACGTTGGCAGGAACCA
Orf71/72	123566– 122793	− (spl)	127875–123626	213 (4250)	AGCTGCGCCACGAAGCAGTCA	CAGGTTCTCCCATCGACGA
Orf71-73	127296– 123808	− (spl)	123688–123626	63	ACTGAACACACGGACAACGG	CAGGTTCTCCCATCGACGA
Orf73(1)	127296– 123808	− (spl)	127837–127430	74 (408)	GCTTGGTCCGGCTGACTTAT	TGCAGTACCGCCCATGG
Orf73(2)c	127296– 123808	− (spl)	127563–127463	101	GCAGACACTGAAACGCTGAA	AGGTGAGCCACCAGGACTTA
OrfK14/74(1)	127884– 128930	+ (spl)	128830–128890	61	TGGTGGGCCTATTTGGGATA	GATGCACCG CCCTGCTT
OrfK14/74(2)	129391– 130399	+ (spl)	129198–129431	82 (234)	TGGCCCAAACGGAGGATCCTAG	AGTTTCATTCCAGGATTCATCATC
Orf75	134441– 130551	−	131326–131257	70	GAGAACCCCGACAAGGACTG	ACACGGGCTTTGAGGTGG
OrfK15c,d	136772– 134762	− (spl)	404– 293	112	CCCAATGTATTCGGGTATGC	TCCCACCATCAACCCTTAAA
GAPDHa					GAAGGTGAAGGTCGGAGTC	GAAGATGGTGATGGGATTTC

^aGlyceraldehydes-3-phosphate dehydrogenase primer pair was used as an internal control.

^bThe number in parenthesis represents calculated PCR product size based on KSHV genomic sequence (KSU75698).

^cPrimers were newly designed for this study. The rest of the primers were previously published (Fakhari and Dittmer, 2002). The primers were named after the target gene(s).

^dOrfK15 primer pair was designed according to the cDNA sequence (accession AY042973).

Fig. 1.

Transcripts and positions of primers for latent and lytic gene clusters. (A) Orf71/Orf72/Orf73 gene cluster transcribed three transcripts: two tricistronic transcripts (5.8 kb and 5.4 kb) encoding all three genes, and one bicistronic transcript (1.7 kb) encoding Orf71 and Orf72. Orf71, Orf72, and Orf71-73 primer pairs detected all three transcripts. The Orf71/72 primer pair only detected the 1.7 kb transcript. Both Orf73(1) and Orf73(2) primer pairs detected only the 5.8 transcript. (B) Orf50/OrfK8/OrfK8.1 gene cluster transcribed multiple transcripts. The primer pairs did not distinguish all the transcripts.

Fig. 2.

Sensitivities of KSHV primers in real-time quantitative PCR. (A) Melting curve analyses with the MJR Opticon monitor program to determine the reading temperature and amplified specific product (peak on melting curve). (B) Cycle threshold (C_T) value was determined as the point at which the amplification plot crossed the threshold line set automatically at 10 times the standard deviations of the baseline by the program. (C) C_T values of the KSHV primers in amplifying a fixed copy number of recombinant KSHV BAC36 (1,091,642 copies). The experiments were carried out twice, each with 3 repeats. The averages of C_T values (solid line) from both experiments (open and solid cycles) are plotted for each primer pair.

Table 2.

Expression profiles of KSHV genes in primary infection of HUVEC, and uninduced (U) and TPA-induced (I) BCBL-1 cells

Primer	Gene/function	F-classa	Classb	F.E.T.	Clusterc	HUVEC											BCBL-1
						0	1	3	6	10	16	24	36	54	78	MAX	U	I	Fold
OrfK1	KIS	F2/F4		6	C				4.8	6.3	5.0	48.2	51.2	87.7	100.0	0.0003	(−)	17.9	N.A.
Orf4	VKCP	F2		6	C				13.9	2.1	5.7	21.9	44.7	100.0	68.3	0.0075	16.5	81.5	4.9
Orf6	SSB	F1	Early	6	A				0.0	0.0	0.7	8.4	37.2	100.0	12.5	0.0000	(−)	15.3	N.A.
Orf7	Transport	F1	Early	6	E				0.1	1.3	43.0	43.6	60.9	100.0	27.6	0.0032	(−)	32.5	N.A.
Orf8	GB	F1	Late	10	B					0.0	10.4	23.6	50.9	100.0	41.1	0.0021	(−)	15.5	N.A.
Orf9	POL	F1	Early	16	A						5.1	17.7	38.2	100.0	9.8	0.0000	103.1	1198.0	11.6
Orf10		F5		6	B				0.1	4.4	12.0	37.0	42.1	100.0	57.7	0.0323	32.2	195.9	6.1
Orf11		F5		6	B				18.4	11.8	25.5	25.3	41.7	100.0	79.2	0.6906	8.8	40.7	4.6
OrfK2	VIL-6	F2/F3/F4	Early	6	E				0.3	2.7	22.0	47.8	73.4	100.0	59.1	0.0021	28.5	2307.1	81.0
Orf2	DHFR	F1		6	B				0.2	1.7	22.9	43.1	34.8	100.0	62.7	0.0091	0.7	10.6	15.9
OrfK3	MIR1	F2		6	D				0.2	2.2	43.6	44.5	48.8	81.7	100.0	0.1173	12.8	42.7	3.3
Orf70	TS	F1		10	D					1.9	52.1	44.6	46.6	90.6	100.0	0.0346	1.9	26.6	13.7
OrfK4	vCCL-2	F2	Early	16	C						4.6	15.0	74.0	100.0	99.8	0.0001	133.3	120.2	0.9
OrfK5	MIR2	F2	Early	10	D					2.3	32.1	19.2	18.0	88.9	100.0	0.1476	7.4	82.1	11.2
OrfK6	vCCL-1	F2	Early	1	E		0.1	0.2	0.2	0.2	5.5	89.9	30.0	100.0	58.9	0.0006	33.3	3523.7	105.8
OrfK7	vIAP	F3		1	E		0.0	0.0	0.0	0.0	1.2	93.1	83.9	100.0	83.7	0.0009	73,058.9	859,878.2	11.8
Orf16	vbcl-2	F3	Early	1	C		0.5	0.5	1.0	1.4	9.8	26.2	49.9	89.0	100.0	0.0681	8.4	42.3	5.0
Orf17	Assembly	F1	Early	1	B		0.0	0.1	0.2	0.1	1.6	18.0	38.5	100.0	53.3	0.0123	1.0	74.6	77.4
Orf18		F5		16	C						7.6	26.6	43.3	100.0	66.7	0.0224	27.8	113.2	4.1
Orf19	Tegument	F1	Early	16	A						1.0	10.1	28.4	100.0	13.5	0.0000	(−)	317.6	N.A.
Orf20	Fusion	F1	Late	6	B				0.0	0.1	31.5	28.3	45.1	100.0	57.1	0.0005	(−)	1.5	N.A.
Orf21	TK	F1	Early	10	B					0.0	9.7	26.9	33.9	100.0	49.7	0.0015	(−)	46.4	N.A.
Orf22	gH	F1	Late	6	B				0.0	1.0	15.1	26.6	46.0	100.0	60.9	0.1527	2.1	28.5	13.5
Orf23		F5		1	C		0.0	0.2	0.8	2.0	9.6	23.1	37.7	95.3	100.0	0.0420	2.9	27.4	9.6
Orf24		F5		16	B						13.0	26.9	29.1	100.0	43.5	0.0024	(−)	0.0	N.A.
Orf25	MCP	F1	Late	6	B				0.2	1.0	8.4	23.9	40.9	100.0	53.1	0.1714	0.3	10.3	33.4
Orf26	TRI-2	F1	Late	6	B				0.0	0.1	2.5	18.4	31.5	100.0	44.3	0.1051	(−)	11.9	N.A.
Orf27		F5	Late	6	B				0.0	0.3	2.7	19.0	39.2	100.0	47.1	0.0318	0.5	21.6	41.2
Orf28		F5	Late	16	C						3.8	41.9	50.4	100.0	81.9	0.0009	6.2	75.6	12.2
Orf29b	Packaging	F1	IE	10	E					0.7	13.5	58.7	83.7	100.0	30.7	0.0280	0.3	19.1	75.4
Orf30		F5	Late	6	E				0.1	1.7	6.6	50.9	63.3	100.0	42.5	0.0005	0.2	49.6	300.0
Orf31		F5	Early	6	E				0.3	2.2	5.9	53.3	74.0	100.0	25.6	0.0420	(−)	14.8	N.A.
Orf32	Tegument	F1	Late	6	B				0.0	1.8	5.1	22.8	37.2	100.0	34.2	0.0030	0.0	18.5	16,589.7
Orf33		F5	Late	1	C		0.6	0.1	1.0	4.9	7.1	31.3	51.5	100.0	76.9	0.4509	0.2	2.4	13.5
Orf29a	Packaging	F1	Early	6	A				0.1	1.7	11.3	31.2	17.6	100.0	19.6	0.0035	0.0	17.5	375.9
Orf34		F5		16	A						3.4	18.9	22.3	100.0	18.1	0.0000	(−)	21.6	N.A.
Orf35		F5		10	A					5.4	13.6	28.2	23.3	100.0	11.6	0.0001	0.2	63.9	414.7
Orf36	Serine kinase	F1	Early	10	B					11.4	19.2	47.3	46.8	100.0	50.9	0.0017	(−)	13.7	N.A.
Orf37	Exonuclease	F1	Early	1	B		0.0	0.1	0.2	5.3	18.2	22.6	39.4	100.0	70.8	0.1441	3.1	27.1	8.8
Orf38	Tegument	F1		1	D		0.0	0.0	0.1	6.6	24.6	15.7	31.7	63.8	100.0	0.1430	2.3	23.2	10.0
Orf39	gM	F1	Late	3	A			0.0	0.0	0.0	0.6	11.8	17.9	100.0	21.7	0.0036	2.1	49.3	23.3
Orf40	PAF	F1	Early	10	A					0.0	0.0	27.6	14.6	100.0	19.1	0.0014	0.4	79.1	216.4
Orf41	PAF	F1	Early	6	B				0.3	1.9	7.5	40.0	30.8	100.0	62.5	0.0249	3.8	49.6	13.0
Orf42		F5	Late	10	A					0.3	2.6	8.2	14.8	100.0	18.5	0.0010	0.1	7.0	47.4
Orf43		F5	Late	16	A						0.0	1.0	25.4	100.0	6.3	0.0000	(−)	6.7	N.A.
Orf44	HEL	F1	Early	6	B				4.7	7.7	11.1	15.0	56.9	100.0	38.6	0.0084	0.0	34.2	12,590.1
Orf45	ORF45	F2	IE	16	C						0.1	15.4	59.9	100.0	58.9	0.0000	(−)	4.9	N.A.
Orf46	Uracil glucosidase	F1	Early	1	B		0.1	0.1	0.2	0.5	5.5	29.3	27.3	100.0	42.3	0.4218	0.4	10.5	27.7
Orf47	gL	F1	Late	10	B					0.2	16.4	34.2	40.2	100.0	85.9	0.0019	(−)	60.4	N.A.
Orf48	Glycoprotein	F1	IE	16	C						6.7	20.0	44.6	100.0	83.0	0.0628	(−)	22.0	N.A.
Orf49		F5	Early	16	C						3.8	17.9	44.3	86.3	100.0	0.0577	0.4	45.1	121.1
Orf50	Rta	F1/F4	IE	1	C		0.0	0.1	0.4	1.9	16.6	19.6	46.0	90.9	100.0	0.0052	2.5	79.5	31.3
OrfK8(1)	K-bZip	F1/F4	Early	6	C				0.2	1.1	12.9	34.9	56.6	100.0	66.6	0.0021	55.9	413.2	7.4
OrfK8(2)	K-bZip	F1/F4	Early	6	C				0.8	4.0	8.5	25.2	62.4	100.0	76.7	0.0080	6.9	125.7	18.2
OrfK8/K8.1	K-bZip	F1/F4	Early	1	C		0.0	0.1	0.1	0.6	2.2	29.1	70.6	100.0	66.3	0.9540	1.8	23.9	13.1
OrfK8.1	Glycoprotein	F1	Late	1	C		0.2	0.1	0.1	0.1	1.9	42.1	89.6	88.3	100.0	4.0028	1.4	20.8	14.9
Orf52		F5	Late	16	A						0.0	2.9	8.5	100.0	4.6	0.0003	0.0	2.8	513.8
Orf53		F5	Late	16	C						0.4	8.1	37.2	100.0	72.2	0.0008	(−)	3.8	N.A.
Orf54	dUTPase	F1	Early	16	B						18.5	11.9	38.0	100.0	58.9	0.0005	(−)	6.2	N.A.
Orf55		F5	Late	3	D			0.1	0.3	0.2	2.8	4.9	6.8	79.0	100.0	0.0107	2.3	33.5	14.6
Orf56	PRI	F1	Early	16	C						6.4	58.2	49.9	96.3	100.0	0.0199	(−)	6.7	N.A.
Orf57(1)	Mta	F1	Early	6	E				0.9	19.7	62.9	85.2	94.4	100.0	74.3	0.0066	2.8	196.2	71.3
Orf57(2)	Mta	F1	Early	6	D				1.7	16.7	40.3	31.7	52.3	91.5	100.0	0.0736	2.8	81.3	28.8
OrfK9	vIRF-1	F2/F3/F4	Early	1	C		0.1	0.1	0.4	0.6	4.7	16.0	42.3	100.0	86.8	0.0369	7.4	109.9	14.8
OrfK10		F5		1	C		0.0	0.0	0.1	0.3	2.6	10.0	52.8	100.0	73.5	0.0538	2.7	29.5	10.9
OrfK10.5(1)	vIRF-3	F3	Latent	10	C					0.4	4.3	59.5	72.3	87.4	100.0	0.0002	(−)	9.9	N.A.
OrfK10.5(2)	vIRF-3	F3	Latent	16	C						2.6	8.6	46.5	91.0	100.0	0.0046	(−)	53.1	N.A.
OrfK10.5(3)	vIRF-3	F3	Latent	16	C						4.0	12.2	88.8	100.0	58.5	0.0240	1.6	72.0	43.7
OrfK11	vIRF-2	F2/F3		10	B					0.2	2.2	6.3	17.8	100.0	50.1	0.0009	2.3	55.6	24.3
Orf58		F5	Late	3	E			0.0	0.0	0.2	11.4	38.3	52.9	100.0	47.5	0.1225	0.7	11.7	15.7
Orf59	PPF	F1	Early	10	B					0.4	20.0	40.0	42.0	100.0	59.6	1.3775	1.9	27.1	14.6
Orf60	Small RNR	F1	Early	3	B			0.0	0.0	1.0	29.0	33.9	50.4	100.0	81.6	0.2649	0.2	13.1	57.1
Orf61	Large RNR	F1	Early	10	A					0.1	8.6	17.7	24.9	100.0	25.5	0.0067	(−)	7.2	N.A.
Orf62	TRI-1	F1	Late	16	E						11.3	42.0	52.5	100.0	53.1	0.0064	(−)	21.8	N.A.
Orf63	Tegument	F1	Early	16	B						4.2	15.3	29.9	100.0	27.9	0.0000	0.8	172.9	229.3
Orf64	Tegument	F1	Early	16	A						2.3	6.8	31.4	100.0	15.7	0.0001	(−)	168.4	N.A.
Orf65	SCIP	F1		1	C		0.0	0.0	0.0	0.1	2.0	23.5	59.4	75.6	100.0	0.7887	0.2	1.7	10.2
Orf66		F5	Early	1	C		0.0	0.1	0.0	0.1	4.0	17.8	35.3	75.7	100.0	0.1483	5.1	49.5	9.6
Orf67	Tegument	F1	Early	1	C		0.0	0.0	0.0	0.1	6.9	29.6	45.3	74.3	100.0	0.2118	1.1	37.1	35.0
Orf68	Glycoprotein	F1	Early	16	C						2.3	20.3	75.0	100.0	86.1	0.0000	0.1	501.8	3497.2
Orf69		F5	Early	16	B						2.1	16.2	29.1	100.0	25.6	0.0014	0.0	47.5	5579.8
OrfK12	Kaposin	F4	Latent	1	D		0.0	0.0	0.8	0.6	4.8	15.1	31.9	56.9	100.0	1.7894	9.9	52.4	5.3
Orf71	vFLIP	F2/F3	Latent	3	E			0.2	1.3	7.4	42.3	73.3	100.0	83.0	80.0	0.0647	5.9	7.7	1.3
Orf72	vCyclin	F4	Latent	6	E				0.0	2.0	31.4	80.5	84.7	100.0	65.0	0.0239	4.7	16.8	3.6
Orf71/72	1.7 kb transcript	F2/F3/F4	Latent	3	D			0.2	12.7	14.8	36.7	67.5	69.6	77.6	100.0	0.0009	37.3	109.8	2.9
Orf71-73	vFLIP, vCyclin, LANA	F2/F3/F4	Latent	1	D		0.0	0.2	1.7	2.7	28.1	40.7	45.5	67.7	100.0	0.2892	1.4	8.1	5.8
Orf73(1)	LANA	F2/F3/F4	Latent	16	E						16.6	37.5	87.7	100.0	68.6	0.0009	(−)	177.3	N.A.
Orf73(2)	LANA	F2/F3/F4	Latent	6	C				1.7	2.9	13.5	18.0	53.4	100.0	81.0	0.0158	6.6	131.1	19.7
OrfK14/74(1)	vOx-2, vGPCR	F2		16	A						1.5	61.0	7.7	100.0	0.0	0.0000	(−)	3.3	N.A.
OrfK14/74(2)	VOx-2, vGPCR	F4	Early	16	E						0.1	43.9	100.0	23.9	50.7	0.0000	(−)	1341.5	N.A.
Orf75	FGARAT	F1		16	E						1.2	38.3	100.0	69.1	71.8	0.0017	(−)	0.0	N.A.
OrfK15	LAMP	F4	Early	16	E						4.5	52.0	57.6	100.0	44.6	0.0186	(−)	1.5	N.A.

F.E.T.: first expressed time point.

MAX: relative maximum amplification value. U: uninduced BCBL-1 cells. I: BCBL-1 cells induced with TPA for 48 h. N.A.: not applicable.

^aFunctional class: F1, structure and replication; F2, immune-modulating; F3, anti-apoptosis; F4, mitogenic and cell cycle-regulatory; F5, unknown.

^bGene class defined by other investigators.

^cCluster defined by unsupervised clustering analysis.

We then used the primer pairs in RT-qPCR to examine the expression profiles of KSHV transcripts in primary infection of HUVEC (Table 2). The mRNA samples were reverse-transcribed into cDNA, which were then examined with all the primer pairs in qPCR. None of the primer pairs detected any amplification signal in the mock-infected cells. In contrast, all the primer pairs detected the expression of their respective transcripts in at least one time point of the KSHV-infected HUVEC, except the Orf73(1) primer pair that detected only the 5.8 kb transcript (408 bp) instead of the intended 5.4 kb transcript (74 bp) (Fig. 3D). The Orf73(1) primer set was subsequently used for detecting the 5.8 kb transcript in this study. These results demonstrated the specificity of the primers for the detection of their respective transcripts in RT-qPCR. Fig. 3A shows the melting curves of the Orf46 primer pair in detecting its transcripts in KSHV-infected HUVEC at all 10 time points.

Fig. 3.

Quantification and validation of KSHV transcripts in primary infection of HUVEC. (A) Representative analysis of melting curves of Orf46 primers in detecting its specific transcripts in KSHV primary infection of HUVEC. The melting curves of Orf46 and GAPDH primers are shown in solid and dotted lines, respectively. GAPDH primers detected strong peak in all the samples. The specific peak detected by Orf46 primers started to appear at as early as 1 h.p.i. and continued to increase at the later time points. (B) Calculation of the relative expression levels of Orf46 transcripts during KSHV primary infection of HUVEC by analysis of C_T values (thick line) and quantification of PCR products on gels from Fig. 2D (thin line). C_T values or band intensities at different time points were normalized to their respective GAPDH values and then converted to percentages of expression (%E_max), relative to the maximum expression value (E_max). %E_max values from all time points were used to plot the expression kinetic curve (see calculation method details in Materials and methods). (C) Scatter plot of C_T values from the amplification of BAC36 episomes (x-axis) vs. the lowest C_T values (highest expression levels) of all time points in the KSHV primary infection of HUVEC (y-axis). Each point represents a primer pair. (D) Validation of PCR products of representative KSHV genes on gels. The size of a specific PCR product is indicated on the right side of its corresponding gel. Note that the sizes of some PCR products are very close to those of their primer dimers. The intensities of the primer dimers decreased when those of specific amplified products increased.

To determine the effect of amplification efficiency of a primer pair in qPCR on the detection of its respective target transcript(s), we plotted the C_T value obtained from the amplification of BAC36 DNA against the lowest C_T value (i.e., highest expression level) of all 10 time points of KSHV-infected HUVEC after normalization to the C_T value of glyceraldehydes-3-phosphate dehydrogenase (GAPDH). Fig. 3C shows a strong linear correlation of amplification efficiency between episome DNA and transcripts from KSHV-infected HUVEC (R² = 0.5465, P value < 0.001), indicating that the maximum amplification value of each transcript(s) is strongly affected by the amplification efficiency of its primer pair. Because of variation of different primer pairs in qPCR amplification efficiency, and variation of different transcripts in reverse-transcription (RT) efficiency, we decided not to compare the absolute C_T values between transcripts in the subsequent analysis; rather, we analyzed the expression levels of the same transcript at different time points by calibrating them as percentages of the time point with maximum expression value (E_max = 100%), i.e., %E_max. We first normalized the C_T value at a given time point to that of GAPDH, and then to their respective E_max. The thick line in Fig. 3B shows the expression kinetics of Orf46 calculated as %E_max at different time points. We further examined all the PCR products on gels to confirm that they had correct sizes, and their relative intensities (expression) closely tracked those calculated from C_T values. To validate the results of RT-qPCR, we examined several KSHV genes representing different classes by semi-quantitative RT-PCR. Fig. 3D shows that the relative intensities of all genes examined at different time points closely tracked those calculated from their C_T values (Fig. 3D and Table 2). These results demonstrated the validity of RT-qPCR in examining the expression of KSHV genes.

Expression kinetics of KSHV transcripts in primary infection of HUVEC

All primer pairs detected the expression of their target transcripts in more than one time point in KSHV primary infection of HUVEC (Fig. 4). A number of transcripts had low signals with relative maximum amplification values <0.0001 (Table 2). The expression kinetics of these transcripts, which included Orf6, Orf9, Orf19, Orf34, Orf43, Orf45, Orf63, Orf68, OrfK14/74(1), and OrfK14/74(2), were likely to be less reliable. Of the 92 primer pairs, 19 (20.7%) detected positive signals at 1 h.p.i., 25 (27.2%) at 3 h.p.i., 51 (55.4%) at 6 h.p.i., and 65 (70.7%) at 10 h.p.i. (Fig. 4). All 92 (100%) primer pairs detected positive signals at 16 h.p.i. At 1 and 3 h.p.i., the overall KSHV gene expression level was very low (median, 0 and 0.1%, respectively) (Fig. 4). While the 19 transcripts detected at 1 h.p.i. could be newly transcribed transcripts, they could also be KSHV-encapsidated transcripts. The expression of some KSHV transcripts, though remaining low, was noticeable at 6 h.p.i. (median, 0.2%; range, 0 to 18.4%) (Fig. 4). Transcripts that had expression levels >1%E_max at 6 h.p.i. included OrfK1, Orf4, Orf11, Orf16, Orf33, Orf44, Orf57, Orf71, Orf71/72, Orf71-73, and Orf73(2) (Table 2). The overall expression level started to increase at 16 h.p.i. and reached a peak at 54 h.p.i. (median, 100%; range, 23.9 to 100%) (Fig. 4); however, it decreased at 78 h.p.i. (median, 62.7%; range, 0 to 100%). Since KSHV primary infection of HUVEC is permissive at the early stage of infection, we expected that the overall KSHV gene expression peak level (54 h.p.i.) would precede the expression of lytic proteins and virion production.

Fig. 4.

Number of KSHV transcripts and overall median expression levels detected by KSHV primer pairs at different time points during KSHV primary infection of HUVEC.

Expression of KSHV transcripts in BCBL-1 cells

KSHV-infected PEL cell lines serve as excellent systems for examining the expression of KSHV genes in latent and lytic replication cycles in B-cells. In uninduced cells, KSHV is in the latent phase of replication, with a small number of cells undergoing spontaneous lytic replication. Upon treatment with chemical inducers such as 12-O-tetradecanoyl phorbol-13-acetate (TPA), KSHV switches into lytic replication and produces infectious virions (Moore et al., 1996). We compared the differential expression patterns of KSHV transcripts in B-cells and endothelial cells by examining uninduced BCBL-1 cells and BCBL-1 cells treated with TPA for 2 days. All 92 primer pairs detected their target transcripts in TPA-induced BCBL-1 cells, while 63 primer pairs (68.5%) detected their target transcripts in uninduced BCBL-1 cells (Table 2). In uninduced BCBL-1 cells, most primer pairs detected low signals with only 15 of them detecting signals higher than 10% of those in TPA-induced BCBL-1 cells, of which 5 belong to latent transcripts (OrfK12, Orf71, Orf72, Orf71/72, and ORF71-73). These results confirm that uninduced BCBL-1 cells are generally in the latent phase but the culture contains a small number of cells undergoing spontaneous lytic replication (Sarid et al., 1998).

The expression of KSHV transcripts in uninduced BCBL-1 cells was compared with that of TPA-induced BCBL-1 cells after GAPDH calibration (Fig. 5A). Of the 92 primer pairs, 29 (30.5%) did not detect any signals in uninduced BCBL-1 cells and therefore, the induction ratio of their transcripts could not be calculated. These transcripts distributed at the baseline of the x-axis of TPA-induced BCBL-1 cells. For the remaining transcripts, 62 distributed above the 45° oblique line, indicating their induction by TPA treatment (range, 1.3- to 16589.7-fold) with only 1 transcript (OrfK4) distributed below the line, indicating that it was not induced by TPA treatment (0.9-fold). The median fold of increase after TPA-induction was 14.9 (Fig. 5B). Of note, the expression of 4 transcripts (Orf32, Orf44, Orf68, and Orf69) was significantly increased after TPA induction (>3000-fold), which was likely due to their low expression levels in uninduced BCBL-1 cells (Table 2).

Fig. 5.

Expression of KSHV transcripts in uninduced and TPA-induced BCBL-1 cells detected by reverse-transcription real-time quantitative PCR. (A) Scatter plot of C_T values of uninduced (y-axis) vs. TPA-induced (x-axis) BCBL-1 cells. All C_T values were the averages of two independent experiments, each with 3 repeats. All data were normalized to the C_T values of GAPDH; therefore, GAPDH C_T values were placed at the position (0,0). Each circle represents the transcript detected by its primer pair. Latent transcripts are labeled with solid circles. The oblique line was placed at the position where transcripts were expressed equally in uninduced and TPA-induced BCBL-1 cells. If a transcript was positioned on the line, its expression was not altered by TPA induction. If a transcript was positioned above or below the line, its expression was up- or down-regulated by TPA induction, respectively. Transcripts without detectable signals in uninduced BCBL-1 cells were positioned at the baseline of the X-axis of TPA-induced BCBL-1 cells. Note that the C_T values had a negative correlation with the actual expression values. (B) Fold-induction of KSHV transcripts by TPA in BCBL-1 cells. Latent transcripts are represented as open bars.

We compared the expression profiles of KSHV transcripts in BCBL-1 cells with those in primary infection of HUVEC by converting the relative expression levels to %E_max (Table 2). The overall expression levels of KSHV transcripts in both uninduced and TPA-induced BCBL-1 cells were lower than that of HUVEC at E_max. In uninduced BCBL-1 cells, the expression median was 0.7%E_max (range, 0 to 73,058.9) and only three transcripts had %E_max higher than 100% (Orf9 at 103.1%, OrfK4 at 133.3%, and OrfK7 at 73,058.9%). In TPA-induced BCBL-1 cells, the expression median was 31.0%E_max (range, 0 to 859,878.2) but 19 transcripts were expressed higher than E_max, with 8 of them over 300%E_max (Orf9, OrfK2, OrfK6, OrfK7, Orf19, OrfK8(1), Orf68, and OrfK14/74(2)). The transcripts that had expression levels higher than E_max were likely preferentially expressed in B-cells. In contrast, the signals detected by 18 primer pairs were at least 3-fold lower than the already low level of median expression of all KSHV transcripts in TPA-induced BCBL-1 cells. Their respective transcripts were likely preferentially expressed in endothelial cells.

To determine the progression of KSHV replication in primary infection of HUVEC, we clustered the expression profiles of KSHV transcripts with those of uninduced and TPA-induced BCBL-1 cells (Fig. 6A). As expected, TPA-induced BCBL-1 cells were clustered between the time points of 54 and 78 h.p.i., again confirming KSHV full lytic replication at these time points. Interestingly, uninduced BCBL-1 cells were placed between the time points of 10 and 16 h.p.i., indicating that KSHV might be in a transient latent replication status during this period.

Fig. 6.

Hierarchal clustering of expression profiles of KSHV transcripts in HUVEC and BCBL-1 cells. The relative expression level %E_max was used for clustering analyses of data obtained from primary infection of HUVEC. Similarly, for BCBL-1 cells, the sample with the higher expression level was set as 100%, from which the expression level of the other sample was calculated accordingly. (A) Transcripts from uninduced (U) BCBL-1 cells were clustered between 10 and 16 h.p.i. while transcripts from TPA-induced (I) BCBL-1 cells were clustered between 54 and 78 h.p.i. (B) Hierarchal clustering of expression profiles of KSHV transcripts in primary infection of HUVEC. The names of transcripts are labeled in color according to gene class (latent in green, IE in red, early in violet, late in blue, and unclassified in black). Gene functional groups are also labeled in color (structure and replication in red, immune-modulating in brown, anti-apoptosis in yellow, mitogenic or cell cycle-regulatory in green, and unknown group in gray).

Unsupervised clustering of expression profiles of KSHV transcripts in primary infection of HUVEC

The expression profiles of KSHV transcripts in primary infection of HUVEC comprised 5 clusters, each exhibiting a distinct pattern (Fig. 6B). Fig. 7A illustrated the expression median of each cluster. Cluster A consisted of 14 transcripts that had maximal expression levels at 54 h.p.i. (median, 100%) but declined abruptly to a median of 14.6%E_max at 78 h.p.i. Cluster B consisted of 25 transcripts that had maximal expression levels at 54 h.p.i. (median, 100%) but declined moderately to a median of 53.1%E_max at 78 h.p.i. Cluster C consisted of 28 transcripts that had maximal expression levels at 54 h.p.i. (median, 100%) but declined slightly to a median of 86.4%E_max at 78 h.p.i. Cluster D consisted of 9 transcripts with a steady increase of expression levels up to 78 h.p.i. Cluster E consisted of 16 transcripts with unique expression patterns that were different from other clusters. The expression median of cluster E transcripts was almost two times higher than that of all the other transcripts at 24 h.p.i. (51.5% vs. 26.6%). Cluster E also had maximal expression levels at 54 h.p.i. (median, 100%) and declined to a median of 56%E_max at 78 h.p.i. Interestingly, the expression levels of cluster E transcripts were generally low compared to other transcripts (Table 2). It is worth noting that 27 of 29 transcripts with known functions in clusters A and B mainly encode for viral structural proteins or proteins related to viral replication (Table 2). In contrast, transcripts of genes that modulate immune functions or cell growth and survival, including vKCP, LANA, vIRF-1, vCCL-2, Orf45, LANA-2, KIS, vbcl-2, MIR2, Kaposin, MIR1, vFLIP, vCyclin, vCCL-1, vIAP, vIL-6, LAMP, and vGPCR, fell into clusters C, D, and E (Fig. 6B). These results suggest that the expression of different KSHV functional gene groups is modulated in a coordinated fashion in KSHV primary infection.

Fig. 7.

Classification of expression profiles of KSHV transcripts by non-supervised clustering (A), gene function (B), gene class (C), and expression peak time (D). Cluster analysis was performed with the Cluster 3.0 software (Eisen et al., 1998) after adjusting the expression values by normalization and median centering. Gene functions were defined based on previous studies (Dourmishev et al., 2003). Transcripts encoding genes with more than one function were classified into more than one group. Gene classes were defined based on previous studies (Sarid et al., 1998; Sun et al., 1999). Expression peak time was defined as the time when the transcript reached maximum expression value E_max.

Expression patterns of KSHV transcripts classified by gene function

To further correlate expression patterns with gene functions, we analyzed the expression profiles of different functional groups of KSHV transcripts (Fig. 7B). Because some genes had more than one function, their transcripts were classified into more than one group. In general, transcripts encoding proteins with immune-modulating functions (F2, n = 14), anti-apoptotic functions (F3, n = 13), and mitogenic or cell cycle-regulatory functions (F4, n = 15) were expressed before those encoding structural proteins and proteins related to viral replication (F1, n = 44). Transcripts with unknown functions or that did not belong to any of the above groups were classified as group F5 (n = 22). The expression order of different functional groups at 50%E_max was F3 (29.5 h), F4 (30.5), F2 (36 h), F1 (38.8 h), and F5 (39.2 h). These results were in general consistent with those obtained by unsupervised clustering analysis.

Expression patterns of KSHV transcripts classified by gene class

To analyze the expression patterns of different classes of KSHV transcripts, we further grouped the expression profiles of KSHV transcripts by gene class based on previous classification of KSHV genes (Sarid et al., 1998; Sun et al., 1999). Although individual genes in each class manifested fluctuated expression patterns, the patterns of median expression levels of lytic transcripts (IE, early, and late) were similar while the latent class showed a distinct pattern (Fig. 7C). The latent class was expressed first and had already reached 15%E_max by 16 h.p.i. and 71%E_max by 36 h.p.i. In contrast, the lytic classes only reached 6.4%E_max at 16 h.p.i. and 44.3%E_max at 36 h.p.i. The latent class also had the feature of cluster D, with a steady increase of expression levels up to 78 h.p.i. (median, 100%E_max). Among the lytic transcripts, the IE class was expressed slightly earlier, followed by early and late classes. The calculated time points for latent, IE, early, and late classes to reach 10%E_max were 13.5, 16, 17.5, and 18.5 h.p.i., respectively, and 50%E_max were 26, 35, 38.5, and 39 h.p.i., respectively. These data indicated that, during KSHV primary infection, the latent class transcripts were expressed first and followed by IE, early, and late class transcripts. The expression of the latent class transcripts was also sustained throughout the infection, and was consistently higher than those of other classes at all the time points except at 54 h.p.i. (Fig. 7C).

Expression patterns of KSHV transcripts classified by expression peak time

The expression peak time points of KSHV transcripts could also reflect the status of viral replication (Fig. 7D). Only three transcripts, Orf71, OrfK14/74(2), and Orf75, reached their expression peak at 36 h.p.i. (P36) (Table 2). After 36 h.p.i., the expression levels of these transcripts started to moderately decline until 78 h.p.i. (median, 62.6%). The majority of the transcripts (67, 72.8%) peaked expression at 54 h.p.i. (P54). Almost all transcripts encoding viral structural proteins and proteins related to viral replication belonged to the P54 group. Since this group represented the majority of the transcripts, its expression kinetics closely mimicked that of the overall expression pattern of KSHV transcripts. The last group consisted of 22 transcripts that peaked in expression at 78 h.p.i. (P78). The P78 group consisted of most latent transcripts, including OrfK12, Orf71-73, Orf71/72, OrfK10.5(1), and OrfK10.5(2), several immune-modulating transcripts (Orf16, OrfK3, and OrfK5), and a viral replication transactivator Orf50. The P78 group had most of the transcripts in clusters C and D. Because we were not able to calculate the actual expression peak time of the P78 group transcripts, their %E_max at different time points might not reflect the actual proportion of expression levels.

Expression kinetics of KSHV splicing transcripts

We analyzed the expression profiles of gene clusters Orf71/Orf72/Orf73 and Orf50/OrfK8/OrfK8.1, which encode genes that are important for KSHV latent or lytic replication, respectively. The Orf71/Orf72/Orf73 cluster transcribed three transcripts: two tricistronic transcripts (5.8 kb and 5.4 kb) encoding all three genes, and one bicistronic transcript (1.7 kb) encoding Orf71 and Orf72 (Fig. 1A). Orf71 and Orf72 primer pairs were located within their respective coding frames, and both detected all three transcripts. The Orf71-73 primer pair was adjacent to the Orf72 coding frame and also detected all three transcripts. The Orf71/72 primer pair was designed specifically for the 1.7 kb transcript and located on two exons between a large splicing region. Theoretically, it should amplify a product of 213 bp from the 1.7 kb transcript, and products of 4250 bp and 3916 bp from the 5.8 and 5.4 kb transcripts, respectively. Because of preferential amplification of the smaller product, this primer pair only detected the 213 bp product from the 1.7 kb transcript (Fig. 3D). The Orf73(1) primer pair was adjacent to the Orf73 coding frame and between the small splicing region of the 5.4 kb transcript. In theory, it should detect a 74 bp product from the 5.4 kb transcript and a 408 bp product from the unspliced 5.8 transcript; however, gel analysis of its PCR product revealed that it detected only the 408 bp product from the 5.8 transcript in both HUVEC (Fig. 3D) and BCBL-1 cells (data not shown). The Orf73(2) primer pair was also adjacent to the Orf73 coding frame and could only detect the 5.8 kb transcript.

For primer pairs that detect the same transcript(s), their overall expression patterns were similar (Orf71 vs. Orf72 vs. Orf71-73, and Orf73(1) vs. Orf73(2) in Table 2 and Fig. 6B); however, the expression of an individual transcript or combinations of transcripts detected by these primer pairs displayed different patterns, suggesting that these transcripts were differentially expressed during KSHV infection of HUVEC. Differential expression of the Orf71/Orf72/Orf73 gene cluster was also observed in BCBL-1 cells (Table 2).

We also found differential expression patterns of the Orf50/OrfK8/OrfK8.1 gene cluster (Fig. 6B). Although transcripts of this gene cluster used the same 3′-poly(A) signals, they were expressed as different classes of genes: Orf50 as an IE gene, K8 as an early gene, and K8.1 as a late gene (Seaman et al., 1999; Sun et al., 1999). Our primer pairs were not able to distinguish all the known transcripts. Nevertheless, differential expression of the transcripts of this gene cluster in both BCBL-1 cells and HUVEC was evident (Fig. 6B and Table 2). Orf50 was expressed as early as 1 h.p.i. and reached 10%E_max at 13 h.p.i. Both Orf50 and OrfK8.1 were classified into group P78 while K8(1), K8(2), and K8/K8.1 were classified into group P54. As indicated previously, transcripts in group P78 could not be compared directly to other groups. However, since the peak expression level of Orf50 was beyond 78 h.p.i., the actual %E_max of Orf50 could be higher than the estimated values.

Discussion

We have examined the expression profiles of KSHV transcripts in a productive primary infection of HUVEC by whole-genome RT-qPCR. The overall expression patterns of KSHV transcripts reflected the status of virus infection and replication. The expression median of KSHV lytic transcripts lagged behind that of latent transcripts at the early time points of infection and followed the order of IE, early, and late transcripts (Fig. 7C), which was consistent with the previous classification of KSHV genes (Sarid et al., 1998; Sun et al., 1999). KSHV lytic transcripts increased steadily and peaked at 54 h.p.i. The progression rate of the KSHV lytic transcriptional program is comparable to those of some other herpesviruses (Cohrs et al., 2003; Goodrum et al., 2002; Martinez-Guzman et al., 2003). The maximum expression of lytic proteins and production of virions occur at 4 d.p.i. in this primary infection model (Gao et al., 2003). Thus, maximum expression of KSHV lytic transcripts preceded the production of infectious virions. Clustering analysis placed the expression pattern of KSHV transcripts in TPA-induced BCBL-1 cells between the time points of 54 and 78 h.p.i. (Fig. 6A), confirming the active lytic transcriptional activity of KSHV at these time points.

Although KSHV usually remains latent in immunocompetent infected subjects, it can be reactivated in certain clinical conditions such as immunosuppression following an HIV infection, or iatrogenic organ transplantation. If primary infection in vivo is productive, it would trigger an avalanche of KSHV lytic replication through continuous production of large amounts of infectious virions and spreading to uninfected cells for new productive infection. This process would also directly produce virus-encoded cytokines and signaling molecules, such as vIL-6 and vGPCR, and indirectly induce cellular inflammatory cytokines, and therefore contribute to the aggressive progression of KS in these clinical conditions.

While the overall expression level of KSHV IE transcripts preceded those of other lytic transcripts, only one of them, Orf50, which encodes a master transactivator of KSHV lytic replication, was expressed at the early time points. The expression of the Orf50 transcript was detected as early as 1 h.p.i., but remained low until 16 h.p.i. The other 3 IE transcripts (Orf29b, Orf45, and Orf48) were not expressed until 16 h.p.i. (Table 2). Early expression of Orf50 could lead to a protein that is required to induce other viral lytic transcripts, most of which did not increase until 24 h.p.i. (Table 2). Interestingly, while the expression of almost all lytic transcripts started to decline after 54 h.p.i., the expression of the Orf50 transcript continued to increase. Sustained expression of Orf50 might be necessary for the completion of a productive lytic replication, since it has a direct role in DNA replication by acting as a transacting factor of KSHV lytic origin of DNA replication (AuCoin et al., 2004). On the other hand, we also observed induction of latent transcripts by TPA (Table 2), an effect that was most likely due to Orf50 induction of Orf73 promoter (Lan et al., 2005). It can be envisaged that, besides its role in activating KSHV lytic replication, Orf50 might also have a function in KSHV latency, i.e., by promoting the expression of KSHV latent genes and establishment of latency after the shutdown of the lytic transcriptional program during primary infection.

The overall expression levels of KSHV lytic transcripts remained low before 36 h.p.i. (median <50%); however, latent transcripts were sustained at a relatively high level from the early time points and reached 78.4% E_max at 36 h.p.i. (Fig. 7C). It was likely that KSHV established a transient latent infection early in infection, a prediction which was consistent with the results of clustering analysis that placed uninduced BCBL-1 cells between the time points of 10 and 16 h.p.i. (Fig. 6A). Nevertheless, even if such transient latency did exist, it was quickly disrupted by the initiation of viral lytic replication and expression of lytic genes. The overall expression level of KSHV lytic transcripts declined after 54 h.p.i., but those of latent transcripts continued to increase (Fig. 7C). These results were consistent with our previous observation that the majority of KSHV-infected cells in the culture likely entered into latent replication after the initial phase of lytic replication (Gao et al., 2003). The continuous expression of high levels of KSHV latent transcripts, particularly those in the Orf71/72/73 gene cluster, could be important in virus switch from lytic to latent replication.

When analyzed by gene function, we found that KSHV transcripts encoding genes with host/cell regulatory functions, such as those with mitogenic and cell cycle-regulatory, anti-apoptotic, and immune-modulating functions, were generally expressed earlier and maintained at higher levels both before and after the 54 h.p.i. lytic peak time point than transcripts encoding genes of viral structure and replication proteins (Fig. 7B). These genes, including vKCP, LANA, vIRF-1, vCCL-2, Orf45, LANA-2, KIS, vbcl-2, MIR2, Kaposin, MIR1, vFLIP, vCyclin, vCCL-1, vIAP, vIL-6, LAMP, and vGPCR, are likely important in KSHV manipulation of the cellular environment and countering innate immunity induced during primary infection, to facilitate virus entry and productive replication, and establishment of persistent infection in the host cells.

We detected weak expression of 19 transcripts as early as 1 h.p.i. The possibility of association of viral episomes or genomic contaminants with purified virions can be excluded because the total RNA prepared from KSHV-infected HUVEC was treated with RNase-free DNase before RT reaction, and qPCR for genomic DNA with these primer pairs failed to detect any signal before the RT reactions. It was also unlikely that viral transcripts were non-specifically associated with the surface of the purified virions, because it would not be possible for them to survive the virion purification and infection procedures. Therefore, these transcripts were either de novo expressed or encapsidated in KSHV virions. It has been demonstrated that CMV transcripts can be packaged into virions and delivered into infected cells (Bresnahan and Shenk, 2000; Prichard et al., 1998). Regardless of the pathways to reach early expression, the early presence of these transcripts might play a critical role for the successful infection of host cells. A number of genes encoded by these transcripts indeed have host modulating functions, including vCCL-1, vIAP, vbcl-2, vIRF-1, Kaposin, vFLIP, vCyclin, and LANA.

A previous study examined the expression profiles of KSHV genes in primary infection in non-productive default latent infection systems of HMVEC and HFF at 8 and 24 h.p.i. (Krishnan et al., 2004). Comparison of KSHV expression profiles in this system with those of our productive system should help to understand the transcriptional programs and strategies for manipulating cellular pathways employed by KSHV in these contrast default latent and productive infection systems. Both studies observed early expression of latent and host-modulating genes, as well as the key IE gene, RTA. In contrast to our observation that both latent and host modulating genes were sustained beyond 78 h.p.i., the expression of host modulating genes and all the other lytic genes, including RTA, declined sharply by 24 h.p.i. in the default latent systems. Furthermore, only 31% of the KSHV genes were detected in the default latent systems, reflecting non-productive lytic replication (Krishnan et al., 2004), while all the KSHV genes were detected in our current study. Thus, the observed KSHV transcriptional programs in both studies appeared to authentically mirror the actual KSHV replication programs in primary infection. It is particularly interesting that both studies observed early expression of host modulating genes in primary infection, suggesting the importance of manipulating the host pathways in KSHV primary infection.

It is unclear why KSHV productive infection was observed in our system but not in others. As we have previously discussed (Gao et al., 2003), the presence of defective viruses in viral preparations could account for this difference. In fact, we have observed a high prevalence of KSHV defective viruses in PEL cell lines from which viral preparations were generated in other studies (Deng et al., 2004). In our studies, we prepared infectious virions from a full-length recombinant KSHV to reduce the problem (Zhou et al., 2002). It remains possible that the use of different cell types and experimental infection procedures could influence and determine whether a KSHV primary infection is productive.

We identified candidate endothelial or B-cell specific transcripts. The transcripts that were preferentially expressed in B-cells could have important roles in KSHV infection and induction of malignancies of B-cell origins. In contrast, transcripts that were preferentially expressed in endothelial cells could have important functions in the development of KS. For transcripts that have extremely high expression levels in B-cells, OrfK2, OrfK6, and OrfK7 are of particular interest. These transcripts encode proteins that regulate cell growth and survival. OrfK2 encodes an IL-6 homolog (vIL-6), which is a B-cell growth and differentiation factor linked to plasma cell abnormalities, as well as myeloid and lymphoid malignancies. Previous studies have shown that the expression levels of vIL-6 are high in both PEL and MCD but less consistent in KS tumors (Cannon et al., 1999; Parravicini et al., 1997; Staskus et al., 1999). It remains to be determined whether OrfK6 encoding a chemokine homolog vCCL-1 and OrfK7 encoding an inhibitor of apoptosis protein homolog vIAP also have strong expression in PEL and MCD. The expression profile of OrfK4 transcript, which encodes another chemokine homolog vCCL-2, is also of interest. While previous studies showed that OrfK4 was an inducible transcript (Sarid et al., 1998), our results indicated that it was poorly induced by TPA treatment, and thus could represent another previously unidentified latent transcript. It is possible that vCCL-2 has a predominant function during KSHV latent infection while vCCL-1 has more important role during KSHV lytic replication.

It has been shown that OrfK10.5 encoding a homolog of interferon regulatory factor (IRF), vIRF3/LANA2, is expressed in PEL but not in KS tumor (Rivas et al., 2001). In concordance with previous studies, OrfK10.5 was expressed in BCBL-1 cells; however, our results showed that OrfK10.5 was also expressed in endothelial cells during KSHV primary infection. Another IRF homolog, vIRF1, a KSHV oncogene encoded by OrfK9 transcript has been characterized as an early gene but recently shown to be expressed in KS tumors (Dittmer, 2003; Gao et al., 1997; Wang et al., 2001). Our results indicated that it was also expressed in HUVEC during KSHV primary infection. These results suggest that both IRF1 and IRF3 could have important roles during KSHV primary infection.

We observed differential expression of alternatively spliced transcripts of a number of genes/gene clusters (Fig. 6B). Among them, the Orf71/72/73 gene cluster is of particular interest because of the expression patterns of its transcripts, and the functions of its encoded genes in latency and in the regulation of the cell cycle and survival of latently-infected cells. The expression of transcripts encoded by this gene cluster is controlled by the same cis-regulatory region, LANAp, which has characteristics resembling an IE gene promoter. Consistent with this promoter feature, we observed induction of all three latent polycistronic transcripts by TPA in BCBL-1 cells (Table 2). Although TPA could have an unexpected effect on the house-keeping gene GAPDH that could lead to suboptimal calibration of their expression levels, a number of other studies have reported similar levels of induction of these latent transcripts after treatment with TPA or butyrate in PEL cell lines (Paulose-Murphy et al., 2001; Sun et al., 1999). It would be interesting to determine how the differential expression of these transcripts is controlled and whether such patterns could also lead to differential expression of their encoded proteins.

Although unsupervised clustering analyses of expression profiles of KSHV transcripts classified them into 5 clusters, they can be grouped into 2 major groups that reflect not only their expression patterns, but also their gene class and gene function. The first major group consists of clusters A and B, in which most transcripts are lytic transcripts encoding viral structural proteins or proteins related to viral replication. The second major group consists of clusters C, D, and E that include most transcripts encoding genes with cell-modulating and latency-associated functions. Thus, the expression of KSHV genes is regulated at a coordinated fashion. Such highly orchestrated events are likely essential for ensuring successful viral infection and the establishment of persistent infection in the host cells.

Materials and methods

Cell lines, primary cells, and cell culture

BCBL-1 and 293 cells harboring a recombinant KSHV BAC36 (BCBL-1BAC36 and 293BAC36, respectively) were described previously (Zhou et al., 2002). BCBL-1BAC36 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, Sigma, St. Louis, MO), 50 μg/ml gentamicin, 150 μg/ml hygromycin, and 2 mM glutamine. 293BAC36 cells were cultured in Dulbecco’s modified eagle’s medium (DMEM) supplemented with 10% FBS, 50 μg/ml gentamicin, 150 μg/ml hygromycin, and 2 mM glutamine. Primary HUVEC cultures were obtained from Clonetics (BioWhittaker, Inc., Walkersville, MD) and cultured in Endothelial Cell Growth Medium Bullet Kit, containing hEGF, hFGF-B, VEGF, ascorbic acid, hydrocortisone, long R3-IGF-1, and heparin, as instructed by the manufacturer (Clonetics).

Induction of KSHV lytic replication and preparation of infectious virus

To induce KSHV lytic replication, cells were treated with 20 ng/ml of TPA (Sigma) for 5 days as previously described (Zhou et al., 2002). To prepare a high titer of infectious virus preparation, supernatant from the TPA-induced culture was centrifuged at 5000 × g for 30 min to eliminate cell debris, filtered through a 0.45-μm-pore-size filter, and centrifuged again at 100,000 × g for 1 h using a 20% sucrose cushion. The final pellet was resuspended in culture medium overnight, and adjusted to one tenth of the original volume to give a concentration factor of 10X. Undissolved debris was eliminated by centrifugation at 5000 × g for 10 min. All the procedures for virus concentration were handled at 4 °C. Fresh virus preparations with titers of about 2 × 10⁶ GFP cells/ml were used for infection experiments.

Virus infection

HUVEC at 70 to 80% confluency seeded in 75 cm² flasks 1 day before were infected with KSHV (Gao et al., 2003). Briefly, flasks of 75-cm² containing approximately 3 × 10⁶ cells/flask were infected with 3 ml/flask of a virus preparation with a titer of 2 × 10⁶ GFP cells/ml. The infection efficiency was determined by monitoring GFP expression at 2 d.p.i. and estimated to be ~90% for this study. Duplicate infected HUVEC cultures were harvested at 10 separate time points (0, 1, 3, 6, 10, 16, 24, 36, 54, or 78 h.p.i.). The cells from duplicate flasks were combined for subsequent analyses.

RT-qPCR

Total RNA from KSHV- or mock-infected HUVEC was prepared with TRI reagent as recommended by the manufacturer (Sigma, St. Louis, MO). The RNA was resuspended in 50 μl of diethyl pyrocarbonate-treated water, quantified, and treated with RQ1 RNase-free DNase according to the instructions of the manufacturer (Promega, Madison, WI). RNA (5 μg) was reverse-transcribed in a total volume of 40 μl to obtain the first-strand cDNA using the Superscript III first-strand synthesis system (Invitrogen, Carlsbad, CA). A control without reverse transcriptase was conducted in parallel. qPCR was then performed with the cDNA. The primers for KSHV transcripts and GAPDH are listed in Table 1. Seventy-five KSHV primer pairs were previously described (Fakhari and Dittmer, 2002) while another 17 primer pairs were newly designed for this study. qPCR was carried out in a total volume of 20 μl, including 10 μl of DyNAmo SYBR Green qPCR kit (MJ Research, Reno, NV), 0.5 μl of each primer at 50 μM, and 1 μl of cDNA at 15 ng/μl. To determine the sensitivity of the primer pairs, we used purified recombinant KSHV BAC36 episome DNA as a copy number control (Zhou et al., 2002). We used 1 μl of BAC36 DNA at 0.2 ng/μl in each reaction, corresponding to 1,091,642 episomes/reaction. Thermal amplification was performed in a DNA Engine Opticon 2 continuous fluorescence detector (MJ Research), using the following linked profile: 10 min at 96 °C, and then 45 amplification cycles, each with denaturation (95 °C for 10 s), annealing (60 °C for 20 s), and extension (72 °C for 15 s) periods. After amplification, melting curve analysis was carried out by increasing the annealing temperature by 0.2 °C per step from 65.0 °C to 95.0 °C. Fluorescence intensity was detected at 5 temperatures (72, 74, 76, 78, and 80 °C) after the extension step, and calculated by Opticon MONITOR analysis software (MJ Research) (Fig. 2A). The cycle threshold (C_T) value was determined as the point (cycle) at which the amplification plot crossed the threshold line (Fig. 2B). The threshold line was automatically set at 10 times of the standard deviation of the baseline by the program. For some primer pairs, the primers can form dimers and could potentially be misread as real products. Therefore, for each primer pair, we chose a temperature that fell between the peaks of the specific amplified product and primer–dimer by analyzing the melting curve to determine the C_T value (Fig. 2A).

Data analysis

All samples were examined by RT-qPCR in triplicate for each primer pair, together with controls of parallel samples without RT reaction, controls of samples without template, and internal controls of GAPDH amplification in each experiment. Two experiments were independently carried out. All C_T values were normalized to the C_T values of GAPDH obtained from their respective template (ΔC_T = C_T of target gene −C_T of GAPDH). The differential value (ΔΔC_T) between the normalized ΔC_T values of two time points was then averaged for the experiments and converted to the actual fold of difference (2^−ΔΔCT). For the analysis of relative expression levels of the same transcript at different time points and in BCBL-1 cells, the data were converted to percentages relative to the value of the time point with maximum expression level in KSHV primary infection of HUVEC (%E_max). The definition and formula of calculation for each parameter are shown below:

• C_T, threshold of cycle

• ΔC_T, C_T value of an experiment sample calibrated by C_T of internal standard GAPDH:

  $$\mathrm{\Delta }{C}_{\text{T}}=C_{\text{TSample}}-C_{\text{TGAPDH}}$$

• ΔΔC_T, differential C_T value between the normalized ΔC_T values of two time points

• E_sample, actual expression value of an experimental sample:

  $$E_{\text{Sample}}=2^{-\mathrm{\Delta }{C}_{\text{TSample}}}$$
• E_max, the highest expression value within a series of samples amplified by the same primer pair:

  $$E_{max}=max[E_{\text{Sample}1},E_{\text{Sample}2},E_{\text{Sample}3},\dots ]$$
• %E_max, the percent of an expression value of a sample in relative to the E_max in a given time kinetics series:

  $$\%E_{max}=\frac{E_{\text{Sample}}}{E_{max}}\times 100$$

Clustering

For cluster analysis, the expression profiles of KSHV transcripts were clustered with Cluster 3.0 software (Eisen et al., 1998). The expression values were adjusted by normalization and median centering. Hierarchical clustering was performed by complete linkage clustering with uncentered correlation option.