Skip to main content
Studies in Mycology logoLink to Studies in Mycology
. 2009;64:17–47-S7. doi: 10.3114/sim.2009.64.02

Phylogenetic lineages in the Capnodiales

PW Crous 1,2,*, CL Schoch 3, KD Hyde 4, AR Wood 5, C Gueidan 1, GS de Hoog 1, JZ Groenewald 1
PMCID: PMC2816965  PMID: 20169022

Abstract

The Capnodiales incorporates plant and human pathogens, endophytes, saprobes and epiphytes, with a wide range of nutritional modes. Several species are lichenised, or occur as parasites on fungi, or animals. The aim of the present study was to use DNA sequence data of the nuclear ribosomal small and large subunit RNA genes to test the monophyly of the Capnodiales, and resolve families within the order. We designed primers to allow the amplification and sequencing of almost the complete nuclear ribosomal small and large subunit RNA genes. Other than the Capnodiaceae (sooty moulds), and the Davidiellaceae, which contains saprobes and plant pathogens, the order presently incorporates families of major plant pathological importance such as the Mycosphaerellaceae, Teratosphaeriaceae and Schizothyriaceae. The Piedraiaceae was not supported, but resolves in the Teratosphaeriaceae. The Dissoconiaceae is introduced as a new family to accommodate Dissoconium and Ramichloridium. Lichenisation, as well as the ability to be saprobic or plant pathogenic evolved more than once in several families, though the taxa in the upper clades of the tree lead us to conclude that the strictly plant pathogenic, nectrotrophic families evolved from saprobic ancestors (Capnodiaceae), which is the more primitive state.

Keywords: Ascomycetes, Brunneosphaerella, Capnodiales, DNA sequence comparisons, Mycosphaerella, novel primers, systematics

INTRODUCTION

The Dothideomycetes encompasses plant and human pathogens, endophytes, saprobes and epiphytes. The class presently contains two subclasses, namely Pleosporomycetidae and Dothideomycetidae (Schoch et al. 2006, 2009a). Although the main orders, Pleosporales and Dothideales correlate with the presence or absence of pseudoparaphyses and other centrum characteristics, many orders remain unresolved. The Dothideomycetidae include the orders Dothideales, Capnodiales and Myriangiales, which lack paraphyses, pseudoparaphyses and periphysoids. Based on a multi-gene phylogeny, and the presence of ostiolar periphyses as possible synapomorphy, the Capnodiales were recognised as the order incorporating the Capnodiaceae, Davidiellaceae, Mycosphaerellaceae and Piedraiaceae (Schoch et al. 2006). However, several studies (Hunter et al. 2006, Crous et al. 2007a, b) showed the Mycosphaerellaceae to be polyphyletic, and to contain additional variation at the familial level, leading to the circumscriptions of the Teratosphaeriaceae and Schizothyriaceae. Crous et al. (2009b, c) again revealed Teratosphaeriaceae to be too widely defined, including some further unresolved families.

The present study focuses on the Capnodiales, which is based on the Capnodiaceae, representing a group of leaf epiphytes associated with honeydew of insects, usually visible as a black growth on leaf surfaces, fruit and twigs. Members of the Capnodiaceae form superficial ascomata with fasciculate asci, and hyaline to dark, septate ascospores. Anamorphs are dematiaceous, and include mycelial (phragmo- to dictyoconidia), spermatial and pycnidial synanamorphs (Hughes 1976, Cheewangkoon et al. 2009).

The Mycosphaerellaceae was treated as a family in the Dothideales by Hawksworth et al. (1995), while Kirk et al. (2001) introduced a separate order, the Mycosphaerellales for this family, and Kirk et al. (2008) again placed it in the Capnodiales. The Mycosphaerellaceae is recognised by having characteristic pseudothecial ascomata that can be immersed or superficial, embedded in host tissue or erumpent, having ostiolar periphyses, but lacking interascal tissue at maturity. Ascospores are hyaline, but in some cases slightly pigmented (Barr 1987), and predominantly 1-septate, although some taxa with 3-septate ascospores have been recorded (Crous et al. 2003). Although up to 30 anamorph genera have been linked to Mycosphaerella (Crous et al. 2000, 2001, 2007a, b, c, 2009a, b, c, Crous 2009), recent studies have shown this to be incorrect, and that the family in fact consists of numerous genera with morphologically conserved Mycosphaerella-like teleomorphs, and distinct anamorphs (Crous et al. 2007a, b, 2009b, c).

Families tentatively placed in the Capnodiales (Lumbsch & Huhndorf 2007, Kirk et al. 2008) include epiphytes (Antennulariellaceae, Capnodiaceae, Metacapnodiaceae) (Hughes 1976), saprobes and plant pathogens (Davidiellaceae, Dissoconiaceae, Mycosphaerellaceae, Schizothyriaceae, Teratosphaeriaceae) (Aptroot 2006, Crous 2009), and colonisers or hair shafts of mammals (Piedraiaceae) (de Hoog et al. 2000). To address the status of the Capnodiales as an order, and the intrafamilial relationships within this order, DNA sequences of the 18S, 5.8S and 28S nrRNA genes were generated for a set of specifically selected taxa. A further aim was to clarify genera within these families, and resolve anamorph-teleomorph relationships for the taxa investigated.

MATERIALS AND METHODS

Isolates

Isolates were selected (Table 1 - see online Supplementary Information) that are representative of the Mycosphaerellaceae (Crous 1998, Crous et al. 2004a, c, 2006a, b, 2007a), Schizothyriaceae (Batzer et al. 2005, 2007), Teratosphaeriaceae (Crous et al. 2007a, 2008b, c, 2009a, b, c), Piedraiaceae (Kruys et al. 2006), Davidiellaceae (Braun et al. 2003, Schubert et al. 2007a, b), Capnodiaceae (Schoch et al. 2006), as well as numerous other genera for which the familial relationships have remained unclear, such as the Phaeophleospora complex (Crous et al. 1997, 2007a, 2009b, c, Andjic et al. 2007), Polythrincium (Simon et al. 2009), the Dissoconium complex (Crous et al. 2004c, 2007c, 2008b, Arzanlou et al. 2008b), and several less well-known genera represented by one or two species only. For fresh material excised leaf spots bearing ascomata were soaked in water for approximately 2 h, after which they were placed in the bottom of Petri dish lids, with the top half of the dish containing 2 % malt extract agar (MEA; Crous et al. 2009d). Ascospore germination patterns were examined after 24 h, and single-ascospore and conidial cultures established as described by Crous et al. (1991). Colonies were sub-cultured onto synthetic nutrient-poor agar (SNA), potato-dextrose agar (PDA), oatmeal agar (OA), MEA (Crous et al. 2009d), and incubated at 25 °C under continuous near-ultraviolet light to promote sporulation. Other cultures were obtained from the culture collection of the Centraalbureau voor Schimmelcultures (CBS-KNAW) in Utrecht, the Netherlands or the working collection of Pedro Crous (CPC).

Table 1.

Details of the isolates for which novel sequences were generated. Samples without an 18S rDNA accession number were only used in the 28S rDNA analysis; sequences of CBS 723.79 and CBS 123.26 were used in both analyses. The accession number for 5.8S nrDNA also includes the flanking spacer regions.

Species Accession number1 Host Country Collector GenBank Accession numbers 18S nrDNA, 5.8S nrDNA, 28S nrDNA
Aulographina pinorum CBS 302.71; ETH 7129; UAMH 4037 Pinus maritima France E. Müller —, GU214622, GU214393
Batcheloromyces leucadendri CBS 110892; CPC 1837 Leucadendron sp. South Africa L. Swart GU214515, AY260100, EU019246
Batcheloromyces proteae CBS 110696; CPC 1518 Protea cynaroides South Africa L. Viljoen AY251102, AY260099, EU019247
Brunneosphaerella protearum CPC 13905 Protea sp. South Africa P.W. Crous —, GU214623, GU214394
CPC 13914 Protea sp. South Africa P.W. Crous —, GU214624, GU214395
CPC 15231 Protea nitida South Africa L. Mostert —, GU214625, GU214396
CPC 16338 Protea sp. South Africa P.W. Crous —, GU214626, GU214397
Capnobotryella renispora CBS 214.90; CBS 176.88; IAM 13014; JCM 6932; TNS F-198506 Capnobotrys neessii Japan J. Sugiyama AY220612, AY220612, GU214398
CBS 215.90; IAM 13015 Capnobotrys neessii Japan J. Sugiyama AY220613, AY220613, GU214399
Capnodium coffeae CBS 147.52 Coffea robusta Zaire — DQ247808, AJ244239, GU214400
Catenulostroma chromoblastomycosum CBS 597.97 Man, chromoblastomycosis Zaire V. de Brouwere GU214516, AJ244260, EU019251
Catenulostroma elginense CBS 111030; CPC 1958 Protea grandiceps South Africa J.E. Taylor GU214517, AY260093, EU019252
Catenulostroma germanicum CBS 539.88 Stone Germany — GU214518, EU019253, EU019253
Catenulostroma microsporum CBS 110890; CPC 1832 Protea cynaroides South Africa L. Swart GU214520, AY260097, EU019255
Catenulostroma protearum CBS 125421; CPC 15370 Leucadendron tinctum South Africa F. Roets —, GU214627, GU214401
CPC 15368 Hakea sericea South Africa F. Roets —, GU214628, GU214402
CPC 15369 Leucadendron tinctum South Africa F. Roets —, GU214629, GU214403
Cercospora apii CBS 118712 — Fiji P. Tyler GU214653, GU214653, GU214653
Cercospora beticola CBS 116456; CPC 11557 Beta vulgaris Italy V. Rossi AY840527, AY840527, GU214404
Cercospora capsici CPC 12307 Capsicum annuum South Korea H.D. Shin GU214654, GU214654, GU214654
Cercospora janseana CBS 145.37; CPC 4303; IMI 303642 Oryza sativa U.S.A. E.C. Tullis AY251103, AY260064, GU214405
Cercospora sojina CPC 12322 Glycine soja South Korea H.D. Shin GU214655, GU214655, GU214655
Cercospora zebrinae CBS 112893; CPC 3955 Trifolium protense Canada K. Seifert AY251104, AY260078, GU214406
CBS 118789; WAC 5106 Trifolium subterraneum Australia M.J. Barbetti GU214656, GU214656, GU214656
CBS 118790; IMI 262766; WAC 7973 Trifolium subterraneum Australia M.J. Barbetti GU214657, GU214657, GU214657
Cercosporella virgaureae CBS 113304 Erigeron annueus South Korea H.D. Shin GU214658, GU214658, GU214658
Cladosporium bruhnei CBS 115683; ATCC 66670; CPC 5101 CCA-treated Douglas-fir pole U.S.A. — AY251096, AY251078, GU214408
CBS 188.54; ATCC 11290; IMI 049638; CPC 3686 — — G.A. de Vries AY251098, AY251077, EU019263
Cladosporium cladosporioides CBS 109.21; ATCC 11277; ATCC 200940; CPC 3682; IFO 6368; IMI 049625 Hedera helix U.K. G.A. de Vries AY251093, AY251073, EU019262
CBS 401.80; CPC 3683 Triticum aestivum Netherlands N.J. Fokkema AY251091, AY251074, GU214409
Cladosporium herbarum CBS 723.79 Allium porrum New Zealand A.C. Jamieson EU167558, EU167558, GU214410
Cladosporium sp. CPC 15513 Rubus fruticosus Italy P.W. Crous —, GU214630, GU214411
CPC 15516 Pyrus communis Ukraine A. Akulov —, GU214631, GU214412
Cladosporium uredinicola ATCC 46649; CPC 5390 Quercus nigra U.S.A. G. Morgan-Jones AY251097, AY251071, EU019264
Davidiella rosigena CBS 330.51 Leaf spot in Rosa sp. Netherlands — —, GU214632, GU214413
Devriesia hilliana CBS 123187; CPC 15382 Macrozamia communis New Zealand C.F. Hill —, GU214633, GU214414
Devriesia lagerstroemiae CBS 125422; CPC 14403 Lagerstroemia indica U.S.A. P.W. Crous & M.J. Wingfield —, GU214634, GU214415
Devriesia staurophora CBS 375.81; ATCC 200934; CPC 3687 Páramo soil Colombia H. Valencia EF137359, AF393723, GU214416
Devriesia strelitziicola CBS 122480; X1045 Strelitzia sp. South Africa W. Gams & H. Glen —, GU214635, GU214417
Dissoconium aciculare CBS 201.89 Brassica sp. Netherlands T. Hijwegen GU214522, AY725519, GU214418
CBS 204.89 Astragalus sp. Germany T. Hijwegen GU214523, AY725520, GU214419
CBS 342.82; CPC 1534 Erysiphe, on Medicago lupulina Germany T. Hijwegen GU214524, AF173308, EU019266
Dissoconium commune CBS 110747; CPC 831 Eucalyptus nitens South Africa P.W. Crous GU214525, AY725535, GU214420
CBS 114238; CPC 10440 Eucalyptus globulus Spain J.P.M. Vazquez GU214526, AY725541, EU019267
CBS 114239; CPC 10492 Eucalyptus globulus New Zealand W. Gams GU214527, AY725542, GU214421
Dissoconium dekkeri CBS 110748; CMW 14906; CPC 825 Eucalyptus grandis South Africa G. Kemp GU214528, AF309625, GU214422
CBS 111169; CMW 5164; CPC 1232 Eucalyptus globulus Zambia — GU214529, AY725550, GU214423
CBS 111272; CPC 1188 Eucalyptus nitens South Africa M.J. Wingfield GU214530, AY725551, GU214424
CBS 111282; CPC 1233 Eucalyptus globulus Zambia — GU214531, AF173305, GU214425
CBS 567.89; CPC 1535 Juniperus chinensis Netherlands T. Hijwegen AY251101, AF173309, EU019268
Dothistroma pini CBS 116487; CMW 10951 Pinus nigra U.S.A. G. Adams GU214532, AY808302, GU214426
Dothistroma septosporum CBS 112498; CPC 3779 Pinus radiata Ecuador — GU214533, AY293062, GU214427
Graphiopsis chlorocephala CBS 121523; CPC 11969 Paeonia officinalis Germany K. Schubert GU214534, EU009458, EU009458
Hortaea acidophila CBS 113389 Lignite, pH 1 Germany U. Hölker —, GU214636, GU214428
Hortaea thailandica CBS 125423; CPC 16651 Syzygium siamense Thailand P.W. Crous & K.D. Hyde —, GU214637, GU214429
Lecanosticta acicola CBS 871.95; MPFN 314 Pinus radiata France M. Morelet GU214663, GU214663, GU214663
Leptoxyphium fumago CBS 123.26; ATCC 11925; IMI 089363; LSHB X13 Hibiscus tiliaceus Indonesia — GU214535, —, GU214430
Melanodothis caricis CBS 860.72; ATCC 24309; DAOM 116433 Carex sitchensis Canada — —, GU214638, GU214431
Miuraea persicae CPC 10069 Prunus persica South Korea H.D. Shin GU214660, GU214660, GU214660
Mycosphaerella acaciigena CBS 112515; CPC 3837 Acacia mangium Venezuela M.J. Wingfield AY251116, AY752143, GU214432
CBS 112516; CPC 3838 Acacia mangium Venezuela M.J. Wingfield GU214661, GU214661, GU214661
Mycosphaerella africana CBS 116154; CMW 4945; CPC 794 Eucalyptus viminalis South Africa P.W. Crous GU214536, AF173314, GU214433
Mycosphaerella bixae CBS 111804; CPC 2554 Bixa orellana Brazil P.W. Crous & R.L. Benchimol GU214557, AF362056, GU214455
Mycosphaerella ellipsoidea CBS 110843; CPC 850 Eucalyptus cladocalyx South Africa P.W. Crous GU214537, AY725545, GU214434
Mycosphaerella endophytica CBS 114662; CPC 1193 Eucalyptus sp. South Africa P.W. Crous GU214538, DQ302953, GU214435
Mycosphaerella graminicola CBS 100335; IPO 69001.61 Triticum aestivum — G.H.J. Kema GU214539, EU019297, EU019297
CBS 110744; CPC 658 Triticum sp. South Africa P.W. Crous AY251117, AF362068, EU019298
CBS 115943; IPO323 Triticum aestivum Netherlands R. Daamen GU214540, AF181692, GU214436
Mycosphaerella handelii CBS 113302 Rhododendron sp. Netherlands P.W. Crous & U. Braun EU167581, EU167581, GU214437
Mycosphaerella heimii CBS 110682; CMW 4942; CPC 760 Eucalyptus sp. Madagascar P.W. Crous GU214541, AF309606, GU214438
Mycosphaerella heimioides CBS 111190; CMW 3046; CPC 1312 Eucalyptus sp. Indonesia M.J. Wingfield GU214542, AF309609, GU214439
Mycosphaerella holualoana CBS 110699; CPC 2155 Leucospermum sp. U.S.A.: Hawaii P.W. Crous GU214543, AY260084, GU214440
Mycosphaerella irregulariramosa CBS 111211; CPC 1362 Eucalyptus saligna South Africa M.J. Wingfield GU214544, AF309608, GU214441
Mycosphaerella keniensis CBS 111001; CMW 5147; CPC 1084 Eucalyptus grandis Kenya M.J. Wingfield GU214545, AF173300, GU214442
Mycosphaerella latebrosa CBS 652.85 Acer pseudoplatanus Netherlands H.A. van der Aa AY251114, AF362067, GU214443
CBS 687.94 Acer pseudoplatanus Netherlands G. Verkley GU214546, AY152553, GU214444
Mycosphaerella lupini CPC 1661 Lupinus sp. U.S.A. W. Kaiser GU214547, AF362050, FJ839661
Mycosphaerella marasasii CBS 110790; CPC 348 Syzygium cordatum South Africa M.J. Wingfield GU214548, AF309591, GU214445
Mycosphaerella marksii CBS 110942; CPC 982 Eucalyptus botryoides Australia A.J. Carnegie GU214549, AF309589, GU214446
CPC 11222 Eucalyptus grandis Bolivia M.J. Wingfield GU214550, DQ302983, GU214447
Mycosphaerella parkii CBS 387.92; CMW 14775; CPC 353 Eucalyptus grandis Brazil M.J. Wingfield GU214551, AF309590, GU214448
Mycosphaerella sp. CBS 111166; CPC 1224 Eucalyptus cladocalyx South Africa A.R. Wood GU214552, AF173302, GU214449
CBS 111167; CPC 1225 Eucalyptus cladocalyx South Africa A.R. Wood GU214553, AF309593, GU214450
Mycosphaerella sphaerulinae CBS 112621; CPC 4314 Eucalyptus sp. Chile — GU214554, AY293066, GU214451
Mycosphaerella stromatosa CBS 101953; CPC 1731 Protea sp. South Africa S. Denman AY251115, EU167598, EU167598
Mycosphaerella tasmaniensis CBS 111687; CMW 14780; CPC 1555 Eucalyptus nitens Australia — GU214555, AF310107, GU214452
Passalora ageratinae CBS 125419; CPC 15365 Ageratina adenophora South Africa A.R. Wood —, GU214639, GU214453
Passalora bellynckii CBS 150.49; CPC 3635 Cynanchum vincetoxicum Switzerland S. Blumer GU214556, AF222831, GU214454
Passalora brachycarpa CBS 115124 — — C.F. Hill GU214664, GU214664, GU214664
Passalora armatae CBS 125420; CPC 15419 Dalbergia armata South Africa A.R. Wood —, GU214640, GU214456
Passalora dioscoreae CPC 10855 Dioscorea tokora South Korea H.D. Shin GU214665, GU214665, GU214665
Passalora dodonaea CPC 1223 Dodonaea sp. — P.W. Crous AY251108, GU214641, GU214457
Passalora eucalypti CBS 111318; CPC 1457 Eucalyptus saligna Brazil: Suzano P.W. Crous GU214558, AF309617, GU214458
Passalora fulva CBS 119.46; CPC 3688 Lycopersicon esculentum Netherlands — AY251109, AY251069, DQ008163
Passalora graminis CBS 113303 Alopecurus aequalis var. amurensis South Korea H.D. Shin GU214666, GU214666, GU214666
Passalora perplexa CBS 116364; CPC 11150 Acacia crassicarpa Indonesia M.J. Wingfield GU214559, AY752163, GU214459
Passalora sequoiae CPC 11258 Juniperus virginiana U.S.A. C.S. Hodges GU214667, GU214667, GU214667
Passalora sp. CBS 115525; CPC 3951 Tilia americana Canada K. Seifert GU214560, AY293064, GU214460
CPC 12319 Ambrosia artemisifolia var. elatior South Korea H.D. Shin GU214668, GU214668, GU214668
Passalora vaginae CBS 140.34; DSM 1148; IMI 303641 Saccharum officinarum Taiwan — GU214561, AF222832, GU214461
Passalora zambiae CBS 112970; CPC 1228 Eucalyptus globulus Zambia T. Coutinho GU214562, AY725522, EU019272
CBS 112971; CMW 14782; CPC 1227 Eucalyptus globulus Zambia T. Coutinho GU214563, AY725523, EU019273
Passalora-like genus CPC 11876 Avicermia sp. South Africa W. Gams GU214564, GU214642, GQ852622
Penidiella columbiana CBS 486.80 Paepalanthus columbianus Colombia W. Gams GU214565, AJ244261, EU019274
Phacellium paspali CBS 113093; RoKI 1144 Setaria palmicola Taiwan R. Kirschner & C.-J. Chen GU214669, GU214669, GU214669
Phaeophleospora atkinsonii CBS 124565; ICMP 17860 Leaf of Hebe sp. New Zealand — —, GU214643, GU214462
CBS 124566; ICMP 17862 Leaf of Hebe sp. New Zealand — —, GU214644, GU214463
Phaeophleospora eugeniicola CPC 2557 Eugenia sp. Brazil — GU214566, FJ493190, FJ493208
CPC 2558 Eugenia sp. Brazil — GU214567, FJ493191, FJ493209
Phloeospora maculans CBS 115123 — — C.F. Hill GU214670, GU214670, GU214670
Piedraia hortae var. hortae CBS 374.71 Man French Guiana — —, GU214645, GU214464
CBS 375.71 Man Brazil — —, GU214646, GU214465
CBS 480.64; IHEM 3823; UAMH 4341 Man, hair Brazil — —, GU214647, GU214466
Piedraia hortae var. paraguayensis CBS 276.32; VKM F-393 — — — —, GU214648, GU214467
Piedraia quintanilhae CBS 327.63; IMI 101644 Genetta tigrina Central African Republic — —, —, GU214468
Polychaeton citri CBS 116435 Citrus aurantium, leaf, with Pseudococcus citri Iran R. Zare & W. Gams —, GU214649, GU214469
Pseudocercospora angolensis CBS 112933; CPC 4118 Citrus sp. Zimbabwe — GU214568, AY260063, GU214470
CBS 149.53; ATCC 11669 Citrus sinensis Angola — AY251106, AF222847, GU214471
Pseudocercospora atromarginalis CPC 11372 Solanum nigrum South Korea H.D. Shin GU214671, GU214671, GU214671
Pseudocercospora chengtuensis CPC 10785 Lycium chinense South Korea H.D. Shin GU214672, GU214672, GU214672
Pseudocercospora cordiana CBS 114685; CPC 2552 Cordia goeldiana Brazil P.W. Crous & R.L. Benchimol GU214569, AF362054, GU214472
Pseudocercospora cruenta CBS 462.75 Phaseolus sp. Fiji W. IJzermans-Lutgerhorst AY251105, AF362065, GU214473
CPC 10846 Vigna sp. Trinidad H. Booker GU214673, GU214673, GU214673
Pseudocercospora eucommiae CPC 10802 Eucommia ulmoides South Korea H.D. Shin GU214674, GU214674, GU214674
Pseudocercospora fijiensis X300 Musa sp. Tonga — GU214570, AY752150, GU214474
Pseudocercospora fuligena CPC 12296 Lycopersicum sp. Thailand — GU214675, GU214675, GU214675
Pseudocercospora griseola f. griseola CBS 194.47; ATCC 22393 Phaseolus vulgaris Portugal — DQ289861, DQ289801, GU214475
CBS 880.72 Phaseolus vulgaris Netherlands H. A. v. Kesteren DQ289862, DQ289802, GU214476
Pseudocercospora humuli CPC 11358 Humulus japonicus South Korea H.D. Shin GU214676, GU214676, GU214676
Pseudocercospora kaki CPC 10636 Diospyros lotus South Korea H.D. Shin GU214677, GU214677, GU214677
Pseudocercospora luzardii CPC 2556 Hancornia speciosa Brazil A.C. Alfenas & P.W. Crous GU214571, AF362057, GU214477
Pseudocercospora macrospora CBS 114696; CPC 2553 Bertholletia excelsa Brazil P.W. Crous & R.L. Benchimol GU214572, AF362055, GU214478
Pseudocercospora ocimicola CPC 10283 Ocimum basilicum Mexico M.E. Palm GU214678, GU214678, GU214678
Pseudocercospora opuntiae CBS 117708; CPC 11772 Opuntia sp. Mexico M. De Jesus Yanez GU214679, GU214679, GU214679
Pseudocercospora pallida CPC 10776 Campsis grandiflora South Korea H.D. Shin GU214680, GU214680, GU214680
Pseudocercospora paraguayensis CBS 111317; CPC 1458 Eucalyptus nitens Brazil: Suzano P.W. Crous GU214573, AF309596, GU214479
Pseudocercospora protearum var. leucadendri CPC 1869 Leucadendron sp. South Africa S. Denman & P.W. Crous AY251107, AY260089, GU214480
Pseudocercospora pseudoeucalyptorum CBS 114242; CMW 14908; CPC 10390 Eucalyptus globulus Spain J.P.M. Vazquez GU214574, AY725526, GU214481
Pseudocercospora punctata CBS 113315 Syzygium cordatum South Africa M.J. Wingfield EU167582, EU167582, GU214407
CPC 10532 Syzygium cordatum South Africa M.J. Wingfield GU214659, GU214659, GU214659
Pseudocercospora sp. CPC 11592 Zelkova serrata South Korea H.D. Shin GU214575, DQ303085, GU214482
Pseudocercospora vitis CPC 11595 Vitis vinifera South Korea H.D. Shin DQ073923, DQ073923, GU214483
Pseudocercospora-like genus CPC 10712 Quercus sp. Netherlands G. Verkley GU214681, GU214681, GU214681
Pseudocercosporella capsellae CPC 10301 Brassica sp. U.K. R. Evans GU214662, GU214662, GU214662
Pseudocercosporella fraxini CPC 11509 Fraxinus rhynchophylla South Korea H.D. Shin GU214682, GU214682, GU214682
Pseudocercosporella sp. CBS 112737; CPC 3959 Rhus typhina Canada K. Seifert GU214684, GU214684, GU214684
CPC 4008 Rhys typhina Canada K. Seifert GU214686, GU214686, GU214686
CPC 10050 Rubus oldhamii South Korea H.D. Shin GU214685, GU214685, GU214685
CPC 11414 Vicia amurense South Korea H.D. Shin GU214683, GU214683, GU214683
Pseudotaeniolina globosa CBS 109889 Rock Italy C. Urzi GU214576, AY128700, EU019283
Rachicladosporium cboliae CBS 125424; CPC 14034 Twig debris U.S.A. P.W. Crous —, GU214650, GU214484
Ramichloridium apiculatum CPC 12310 Vicia amurensis South Korea H.D. Shin GU214687, GU214687, GU214687
Ramichloridium cerophilum CBS 103.59; MUCL 10034 Sasa sp. Japan — EU041798, EU041798, GU214485
Ramichloridium musae CBS 190.63; MUCL 9557 Musa sapientum — — GU214577, EU041800, EU041857
Ramichloridium-like genus CPC 10672 Phellodendron amurense South Korea H.D. Shin GU214688, GU214688, GU214688
Ramularia acroptili CBS 120252 Acroptilon repens Turkey R. Sobhian GU214689, GU214689, GU214689
Ramularia brunnea CPC 4903 — — — GU214691, GU214691, GU214691
Ramularia coleosporii CPC 11516 Plectranthus excisus South Korea H.D. Shin GU214692, GU214692, GU214692
Ramularia endophylla CBS 113265 Quercus robur Netherlands G. Verkley AY490775, AY490763, AY490776
Ramularia grevilleana CPC 656 Fragaria sp. South Africa P.W. Crous GU214578, AF173312, GU214486
Ramularia nagornyi CBS 120253 Centaurea solstitiales Greece D. Berner GU214579, EU019257, EU019257
Ramularia pratensis var. pratensis CPC 11294 Rumex crispus South Korea H.D. Shin GU214580, EU019284, EU019284
Ramularia sp. CBS 324.87 leaf spot on Brassica sp., in Mycosphaerella sp. Netherlands — GU214581, EU019285, EU019285
CPC 10066 Alangium plataniflium South Korea H.D. Shin GU214690, GU214690, GU214690
CPC 11297 Stellaria aquatica South Korea H.D. Shin GU214693, GU214693, GU214693
Ramularia uredinicola CPC 10813 Salix sp. South Korea H.D. Shin GU214694, GU214694, GU214694
Ramularia-like genus CPC 10852 Polygonum sp. South Korea H.D. Shin GU214695, GU214695, GU214695
Ramulispora sorghi CBS 110578; CPC 905 Sorghum sp. South Africa D. Nowell AY251110, AY259131, GU214487
CBS 110579; CPC 906 Sorghum sp. South Africa D. Nowell AY251111, AY259132, GU214488
Readeriella dimorphospora CBS 120034; CPC 12636 Eucalyptus nitens Australia — GU214521, EF394850, EU019258
Readeriella mirabilis CBS 116293; CPC 10506 Eucalyptus fastigata New Zealand W. Gams EU754110, AY725529, EU019291
Schizothyrium pomi CBS 228.57 — Italy R. Ciferri EF134947, EF134947, EF134947
CBS 406.61 Rubus idaeus Netherlands — EF134949, EF134949, EF134949
CBS 486.50 Polygonum sachalinense Netherlands — EF134948, EF134948, EF134948
Scorias spongiosa CBS 325.33 Aphid — — GU214696, GU214696, GU214696
Septoria apiicola CBS 400.54; IMI 092628 Apium graveolens Netherlands J.A. von Arx GU214584, AY152574, GU214490
Septoria convolvuli CBS 102325 Calystegia sepium Netherlands G. Verkley GU214697, GU214697, GU214697
Septoria cucubali CBS 102368 Cucubalus baccifer Netherlands G. Verkley GU214698, GU214698, GU214698
Septoria dysentericae CPC 12328 Daucus carota Brazil N. Massola GU214699, GU214699, GU214699
Septoria lactucae CBS 352.58 Lactuca sativa Germany — GU214585, AY489282, GU214491
Septoria leucanthemi CBS 109090 Chrysanthemum leucanthemum Austria G. Verkley GU214586, AY489277, GU214492
Septoria obesa CBS 354.58; BBA 8554; IMI 091324 Chrysanthemum indicum Germany — GU214587, AY489285, GU214493
Septoria protearum CPC 1470 Protea cynaroides South Africa L. Viljoen GU214588, AY260081, GU214494
Septoria pyricola CBS 222.31; CPC 3677 Pyrus communis — — GU214589, AY152591, GU214495
Septoria quercicola CBS 663.94 Quercus robur Netherlands — GU214590, AY490771, GU214496
Septoria rosae CBS 355.58; ATCC 24311; PD 341; CPC 4302 Rosa sp. — — AY251113, AY293065, GU214497
Septoria senecionis CBS 102366 Senecio fluviatilis Netherlands G. Verkley GU214591, AY489272, GU214498
Septoria-like genus CBS 102377 Castanea sativa Netherlands G. Verkley GU214592, AY152588, GU214499
Sonderhenia eucalypticola CPC 11252 Eucalyptus globulus Spain M.J. Wingfield GU214593, DQ303064, GU214500
Sphaerulina polyspora CBS 354.29 — — — —, GU214651, GU214501
Staninwardia suttonii CBS 120061; CPC 13055 Eucalyptus robusta Australia B.A. Summerell GU214594, DQ923535, DQ923535
Stenella araguata CBS 105.75; ATCC 24788; FMC 245 Man Venezuela — GU214596, EU019250, EU019250
Stigmina platani CBS 110755; IMI 136770; CPC 4299 Platanus orientalis India — GU214598, AY260090, FJ839663
Stigmina synanamorph CPC 11721 Platanus occidentalis South Korea H.D. Shin GU214700, GU214700, GU214700
Stomiopeltis betulae CBS 114420 Betula sp. Sweden K. & L. Holm GU214701, GU214701, GU214701
Teratosphaeria aff. nubilosa CBS 114419; CPC 10497 Eucalyptus globulus New Zealand — GU214599, AY725574, EU019303
CBS 116283; CPC 10495 Eucalyptus globulus Spain W. Gams GU214600, AY725573, GU214503
Teratosphaeria alcornii CBS 313.76; CPC 3632 Eucalyptus tessellaris Australia J.L. Alcorn GU214514, AF362061, EU019245
Teratosphaeria angophorae CBS 120493; DAR 77452 Angophora floribunda Australia A.J. Carnegie —, GU214652, GU214504
Teratosphaeria bellula CBS 111700; CPC 1821; JT 196 Protea eximia South Africa J.E. Taylor GU214601, EU019301, EU019301
Teratosphaeria cryptica CBS 110975; CMW 3279; CPC 936 Eucalyptus globulus Australia A.J. Carnegie GU214602, AF309623, GU214505
Teratosphaeria destructans CBS 111369; CPC 1366 Eucalyptus grandis Indonesia M.J. Wingfield GU214603, DQ267595, EU019287
CBS 111370; CPC 1368 Eucalyptus sp. Indonesia P.W. Crous GU214702, GU214702, GU214702
Teratosphaeria fibrillosa CPC 1876 Protea nitida South Africa J.E. Taylor EU019282, EU019282, GU214506
Teratosphaeria juvenalis CBS 110906; CMW 13347; CPC 40 Eucalyptus cladocalyx South Africa P.W. Crous AY720715, AY725513, FJ493217
CBS 111149; CPC 23 Eucalyptus cladocalyx South Africa P.W. Crous AY720714, AY725514, EU019294
Teratosphaeria macowanii CBS 110756; CPC 1872 Protea nitida South Africa J.E. Taylor GU214519, AY260095, EU019254
CBS 111029; CPC 1488 Protea sp. South Africa P.W. Crous AY251118, AY260096, FJ493199
Teratosphaeria mexicana CBS 110502; CMW 14461 Eucalyptus globulus Australia — GU214604, AY725558, GU214507
CBS 120744; CPC 12349 Eucalyptus sp. U.S.A.: Hawaii W. Gams GU214605, EU019302, EU019302
Teratosphaeria molleriana CBS 111164; CMW 4940; CPC 1214 Eucalyptus globulus Portugal M.J. Wingfield GU214606, AF309620, EU019292
CBS 116370; CPC 10397 Eucalyptus globulus Spain J.P.M. Vazquez GU214607, AY725561, GU214508
CPC 4577 Eucalyptus sp. Australia — GU214582, AY725524, GU214489
Teratosphaeria nubilosa CBS 115669; CPC 933 Eucalyptus nitens South Africa M.J. Wingfield GU214608, AY725548, GU214509
CBS 116005; CMW 3282; CPC 937 Eucalyptus globulus Australia A.J. Carnegie GU214609, AY725572, GU214510
Teratosphaeria ohnowa CBS 112896; CMW 4937; CPC 1004 Eucalyptus grandis South Africa M.J. Wingfield AY251119, AF309604, EU019305
CBS 112973; CMW 4936; CPC 1005 Eucalyptus grandis South Africa M.J. Wingfield GU214610, AF309605, GU214511
Teratosphaeria pseudosuberosa CBS 118911; CPC 12085 Eucalyptus sp. Uruguay M.J. Wingfield GU214611, DQ303011, EU019256
Teratosphaeria secundaria CBS 115608; CPC 504 Eucalyptus grandis Brazil A.C. Alfenas GU214612, DQ303018, EU019306
Teratosphaeria sp. CBS 208.94; CPC 727 Eucalyptus grandis Indonesia A.C. Alfenas GU214613, AY626982, EU019307
Teratosphaeria stellenboschiana CBS 116428; CPC 10886 Eucalyptus sp. South Africa P.W. Crous GU214583, AY725518, EU019295
Teratosphaeria suberosa CPC 11032 Eucalyptus sp. Colombia M.J. Wingfield GU214614, DQ303044, GU214512
Teratosphaeria suttonii CPC 11279 Eucalyptus tereticornis Bolivia M.J. Wingfield GU214615, DQ303055, FJ493222
CPC 12352 Eucalyptus sp. U.S.A.: Hawaii W. Gams GU214616, EU019288, EU019288
Teratosphaeria toledana CBS 113313; CMW 14457 Eucalyptus sp. Spain P.W. Crous & G. Bills GU214617, AY725580, GU214513
CBS 115513; CPC 10840 Eucalyptus sp. Spain P.W. Crous & G. Bills GU214618, FJ493198, FJ493225
Teratosphaeria verrucosa CPC 18 Eucalyptus cladocalyx South Africa P.W. Crous AY720713, AY725517, EU019293
Thedgonia-like genus CPC 12304 Oplismenus undulatifolius South Korea H.D. Shin GU214703, GU214703, GU214703
Toxicocladosporium irritans CBS 185.58 Mouldy paint Suriname M.B. Schol-Schwarz GU214619, EU040243, EU040243
Verrucisporota daviesiae CBS 116002; VPRI 31767 Daviesia latifolia Australia V. Beilharz GU214620, FJ839633, FJ839669
Verrucisporota proteacearum CBS 116003; VPRI 31812 Grevillea sp. Australia J.L. Alcorn GU214621, FJ839635, FJ839671
Zasmidium anthuriicola CBS 118742 Anthurium sp. Thailand C.F. Hill GU214595, FJ839626, FJ839662
Zasmidium citri CBS 116366; CMW 11730; CPC 10522 Acacia mangium Thailand K. Pongpanich GU214597, AY752145, GU214502
1

ATCC: American Type Culture Collection, Virginia, U.S.A.; BBA: Biologische Bundesanstalt für Land- und Forstwirtschaft, Berlin-Dahlem, Germany; CBS: Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; CMW: Culture Collection of the Forestry and Agricultural Biotechnology Institute (FABI) of the University of Pretoria, Pretoria, South Africa; CPC: Culture collection of Pedro Crous, housed at CBS; DAOM: Plant Research Institute, Department of Agriculture (Mycology), Ottawa, Canada; DAR: Plant Pathology Herbarium, Orange Agricultural Institute, Forest Road, Orange. NSW 2800, Australia; DSM: Deutsche Sammlung von Mikrorrganismen und Zellkulturen GmbH, Braunschweig, Germany; ETH: Swiss Federal Institute of Technology Culture Collection, Zurich, Switzerland; FMC: Venezuelan School of Medicine; IAM: IAM Culture Collection, Institute of Molecular and Cellular Biosciences, The University of Tokyo, Japan; ICMP: International Collection of Micro-organisms from Plants, Landcare Research, Private Bag 92170, Auckland, New Zealand; IFO: Institute for Fermentation, Osaka, Japan; IHEM: Collection of the Laboratorium voor Microbiologie en Microbiele Genetica, Rijksuniversiteit, Ledeganckstraat 35, B-9000, Gent, Belgium; IMI: International Mycological Institute, CABI-Bioscience, Egham, Bakeham Lane, U.K.; IPO: Culture collection of the Research Institute for Plant Protection, Wageningen, The Netherlands; JCM: Japan Collection of Microorganism, RIKEN BioResource Center, Japan; JT: Working collection of Joanne E. Taylor; LSHB: London School of Hygiene & Tropical Medicine, London, U.K.; MPFN: Culture collection at the Laboratoire de Pathologie Forestie're, INRA, Centre de Recherches de Nancy, 54280 Champenoux, France; MUCL: Université Catholique de Louvain, Louvain-la-Neuve, Belgium; PD: Plant Protection Service, Wageningen, The Netherlands; RoKI: Private culture collection Roland Kirschner; TNS: Herbarium of the National Museum of Nature and Science of Japan, Tokyo, Japan; UAMH: University of Alberta Microfungus Collection and Herbarium, Edmonton, Alberta, Canada; VKM: All-Russian Collection of Microorganisms, Russian Academy of Sciences, Institute of Biochemistry and Physiology of Microorganisms, 142292 Pushchino, Moscow Region, Russia; VPRI: Victorian Department of Primary Industries, Knoxfield, Australia; WAC: Department of Agriculture Western Australia Plant Pathogen Collection, Perth, Australia; X: Working collection of Mahdi Arzanlou.

DNA isolation, amplification and molecular phylogeny

Genomic DNA was extracted from mycelium taken from fungal colonies on MEA using the UltraClean™ Microbial DNA Isolation Kit (Mo Bio Laboratories, Inc., Solana Beach, CA, U.S.A.). A part of the nuclear rDNA operon spanning the 3' end of the 18S rRNA gene (SSU), the first internal transcribed spacer (ITS1), the 5.8S rRNA gene, the second ITS region (ITS2) and the first 900 bp at the 5' end of the 28S rRNA gene (LSU) was amplified and sequenced as described by Cheewangkoon et al. (2008) standard for all strains included (Table 1). For selected strains (see Table 1), the almost complete SSU and LSU (missing the first and last 20–30 nucleotides) were amplified and sequenced using novel and previously published primers (Table 2; see below).

Table 2.

Details of primers used for this study and their relation to selected published primers. Primer names ending with a “d” denotes a degenerate primer whereas those ending with a “m” denotes specific primers designed based on the partial novel sequences generated. The start and end positions of the primers are derived using Magnaporthe grisea GenBank accession AB026819 as reference in the 5'–3' direction.

Name Sequence (5′-3′) Orientation %GC Tm (°C) Start End Reference
5.8S1Fd CTC TTG GTT CBV GCA TCG Forward 57.4 49.8 - 54.2 - 56.8 2333 2350 This study
5.8S1Rd WAA TGA CGC TCG RAC AGG CAT G Reverse 52.3 57.6 - 58.9 - 60.2 2451 2472 This study
F377 AGA TGA AAA GAA CTT TGA AAA GAG AA Forward 26.9 40.3 3005 3030 www.lutzonilab.net/primers/page244.shtml
ITS1 TCC GTA GGT GAA CCT GCG G Forward 63.2 49.5 2162 2180 White et al. (1990)
ITS1F CTT GGT CAT TTA GAG GAA GTA A Forward 36.4 39.0 2124 2145 Gardes & Bruns (1993)
ITS1Fd CGA TTG AAT GGC TCA GTG AGG C Forward 54.5 48.0 2043 2064 This study
ITS1Rd GAT ATG CTT AAG TTC AGC GGG Reverse 47.6 43.1 2671 2691 This study
ITS4 TCC TCC GCT TAT TGA TAT GC Reverse 45.0 41.6 2685 2704 White et al. (1990)
ITS4S CCT CCG CTT ATT GAT ATG CTT AAG Reverse 41.7 42.9 2680 2703 Kretzer et al. (1996)
ITS5 GGA AGT AAA AGT CGT AAC AAG G Forward 40.9 40.8 2138 2159 White et al. (1990)
LR0R GTA CCC GCT GAA CTT AAG C Forward 52.6 43.2 2668 2686 Rehner & Samuels (1994)
LR2 TTT TCA AAG TTC TTT TC Reverse 23.5 28.5 3009 3025 www.lutzonilab.net/primers/page244.shtml
LR2R AAG AAC TTT GAA AAG AG Forward 29.4 30.4 3012 3028 www.lutzonilab.net/primers/page244.shtml
LR3 GGT CCG TGT TTC AAG AC Reverse 52.9 40.5 3275 3291 Vilgalys & Hester (1990)
LR3R GTC TTG AAA CAC GGA CC Forward 52.9 40.5 3275 3291 www.lutzonilab.net/primers/page244.shtml
LR5 TCC TGA GGG AAA CTT CG Reverse 52.9 41.0 3579 3595 Vilgalys & Hester (1990)
LR5R GAA GTT TCC CTC AGG AT Forward 47.1 37.8 3580 3596 www.biology.duke.edu/fungi/mycolab/primers.htm
LR6 CGC CAG TTC TGC TTA CC Reverse 58.8 43.5 3756 3772 Vilgalys & Hester (1990)
LR7 TAC TAC CAC CAA GAT CT Reverse 41.2 35.3 4062 4078 Vilgalys & Hester (1990)
LR8 CAC CTT GGA GAC CTG CT Reverse 58.8 44.3 4473 4489 www.lutzonilab.net/primers/page244.shtml
LR8R AGC AGG TCT CCA AGG TG Forward 58.8 44.3 4473 4489 www.lutzonilab.net/primers/page244.shtml
LR9 AGA GCA CTG GGC AGA AA Reverse 52.9 43.6 4799 4815 www.lutzonilab.net/primers/page244.shtml
LR10 AGT CAA GCT CAA CAG GG Reverse 52.9 41.6 5015 5031 www.lutzonilab.net/primers/page244.shtml
LR10R GAC CCT GTT GAG CTT GA Forward 52.9 41.6 5013 5029 www.lutzonilab.net/primers/page244.shtml
LR11 GCC AGT TAT CCC TGT GGT AA Reverse 50.0 43.9 5412 5431 www.lutzonilab.net/primers/page244.shtml
LR12 GAC TTA GAG GCG TTC AG Reverse 52.9 39.4 5715 5731 Vilgalys & Hester (1990)
LR12R CTG AAC GCC TCT AAG TCA GAA Forward 47.6 43.7 5715 5735 www.biology.duke.edu/fungi/mycolab/primers.htm
LR13 CAT CGG AAC AAC AAT GC Reverse 47.1 38.8 5935 5951 www.lutzonilab.net/primers/page244.shtml
LR14 AGC CAA ACT CCC CAC CTG Reverse 61.1 47.6 5206 5223 www.lutzonilab.net/primers/page244.shtml
LR15 TAA ATT ACA ACT CGG AC Reverse 35.3 32.5 2780 2796 www.lutzonilab.net/primers/page244.shtml
LR16 TTC CAC CCA AAC ACT CG Reverse 52.9 42.1 3311 3327 Moncalvo et al. (1993)
LR17R TAA CCT ATT CTC AAA CTT Forward 27.8 31.2 3664 3681 www.lutzonilab.net/primers/page244.shtml
LR20R GTG AGA CAG GTT AGT TTT ACC CT Forward 43.5 43.6 5570 5592 www.lutzonilab.net/primers/page244.shtml
LR21 ACT TCA AGC GTT TCC CTT T Reverse 42.1 41.7 3054 3072 www.lutzonilab.net/primers/page244.shtml
LR22 CCT CAC GGT ACT TGT TCG CT Reverse 55.0 46.8 2982 3001 www.lutzonilab.net/primers/page244.shtml
LSU1Fd GRA TCA GGT AGG RAT ACC CG Forward 55.0 41.8 - 44.0 - 46.3 2655 2674 This study
LSU1Rd CTG TTG CCG CTT CAC TCG C Reverse 63.2 49.6 2736 2754 This study
LSU2Fd GAA ACA CGG ACC RAG GAG TC Forward 57.5 45.5 - 46.5 - 47.6 3280 3299 This study
LSU2Rd ATC CGA RAA CWT CAG GAT CGG TCG Reverse 52.1 48.3 - 49.0 - 49.8 3379 3402 This study
LSU3Fd GTT CAT CYA GAC AGC MGG ACG Forward 57.1 44.7 - 47.4 - 50.2 3843 3863 This study
LSU3Rd CAC ACT CCT TAG CGG ATT CCG AC Reverse 56.5 49.1 3876 3898 This study
LSU4Fd CCG CAG CAG GTC TCC AAG G Forward 68.4 51.2 4469 4487 This study
LSU4Rd CGG ATC TRT TTT GCC GAC TTC CC Reverse 54.3 47.4 - 48.7 - 50.0 4523 4545 This study
LSU5Fd AGT GGG AGC TTC GGC GC Forward 70.6 51.6 3357 / 5072 3373 / 5088 This study
LSU5Rd GGA CTA AAG GAT CGA TAG GCC ACA C Reverse 52.0 48.3 5355 5379 This study
LSU6Fd CCG AAG CAG AAT TCG GTA AGC G Forward 54.5 48.1 5499 5520 This study
LSU6Rd TCT AAA CCC AGC TCA CGT TCC C Reverse 54.5 48.6 5543 5564 This study
LSU7Fd GTT ACG ATC TRC TGA GGG TAA GCC Forward 52.1 46.0 - 47.4 - 48.8 5943 5966 This study
LSU7Rd GCA GAT CGT AAC AAC AAG GCT ACT CTA C Reverse 46.4 47.9 5927 5954 This study
LSU8Fd CCA GAG GAA ACT CTG GTG GAG GC Forward 60.9 51.2 3469 3491 This study
LSU8Rd GTC AGA TTC CCC TTG TCC GTA CC Reverse 56.5 48.9 4720 4742 This study
LSU9Fm GGT AGC CAA ATG CCT CGT CAT C Forward 54.5 47.9 4882 4903 This study
LSU9Rm GAT TYT GCS AAG CCC GTT CCC Reverse 59.5 49.2 - 50.0 - 50.9 4979 4999 This study
LSU10Fm GGG AAC GTG AGC TGG GTT TAG A Forward 54.5 48.6 5543 5564 This study
LSU10Rm CGC TTA CCG AAT TCT GCT TCG G Reverse 54.5 48.1 5499 5520 This study
LSU11Fm TTTGGTAAGCAGAACTGGCGATGC Forward 50.0 49.4 3753 3776 This study
LSU12Fd GTGTGGCCTATCGATCCTTTAGTCC Forward 52.0 48.3 5355 5379 This study
NS1 GTA GTC ATA TGC TTG TCT C Forward 42.1 36.9 413 431 White et al. (1990)
NS1R GAG ACA AGC ATA TGA CTA C Reverse 42.1 36.9 413 431 www.lutzonilab.net/primers/page244.shtml
NS2 GGC TGC TGG CAC CAG ACT TGC Reverse 66.7 53.8 943 963 White et al. (1990)
NS3 GCAAGTCTGGTGCCAGCAGCC Forward 66.7 53.8 943 963 White et al. (1990)
NS4 CTT CCG TCA ATT CCT TTA AG Reverse 40.0 38.2 1525 1544 White et al. (1990)
NS5 AAC TTA AAG GAA TTG ACG GAA G Forward 36.4 40.1 1523 1544 White et al. (1990)
NS6 GCA TCA CAG ACC TGT TAT TGC CTC Reverse 50.0 47.5 1806 1829 White et al. (1990)
NS7 GAG GCA ATA ACA GGT CTG TGA TGC Forward 50.0 47.5 1806 1829 White et al. (1990)
NS8 TCC GCA GGT TCA CCT ACG GA Reverse 60.0 50.4 2162 2181 White et al. (1990)
NS17 CAT GTC TAA GTT TAA GCA A Forward 31.6 34.2 447 465 Gargas & Taylor (1992)
NS18 CTC ATT CCA ATT ACA AGA CC Reverse 40.0 38.0 887 906 Gargas & Taylor (1992)
NS19 CCG GAG AAG GAG CCT GAG AAA C Forward 59.1 49.3 771 792 Gargas & Taylor (1992)
NS20 CGT CCC TAT TAA TCA TTA CG Reverse 40.0 37.3 1243 1262 Gargas & Taylor (1992)
NS21 GAA TAA TAG AAT AGG ACG Forward 33.3 30.5 1193 1210 Gargas & Taylor (1992)
NS22 AAT TAA GCA GAC AAA TCA CT Reverse 30.0 36.4 1687 1706 Gargas & Taylor (1992)
NS23 GAC TCA ACA CGG GGA AAC TC Forward 55.0 45.5 1579 1598 Gargas & Taylor (1992)
NS24 AAA CCT TGT TAC GAC TTT TA Reverse 30.0 36.2 2143 2162 Gargas & Taylor (1992)
SR11R GGA GCC TGA GAA ACG GCT AC Forward 60.0 47.8 779 798 Spatafora et al. (1995)
SR1R TAC CTG GTT GAT TCT GC Forward 47.1 38.5 394 410 Vilgalys & Hester (1990)
SR3 GAA AGT TGA TAG GGC T Reverse 43.8 34.8 696 711 www.biology.duke.edu/fungi/mycolab/primers.htm
SSU1Fd CTG CCA GTA GTC ATA TGC TTG TCT C Forward 48.0 46.5 407 431 This study
SSU1Rd CTT TGA GAC AAG CAT ATG AC Reverse 40.0 48.7 416 435 This study
SSU2Fd GAA CAA YTR GAG GGC AAG Forward 50.0 47.8 - 50.7 - 53.5 930 947 This study
SSU2Rd TAT ACG CTW YTG GAG CTG Reverse 47.2 48.4 - 49.9 - 51.2 974 991 This study
SSU3Fd ATC AGA TAC CGT YGT AGT C Forward 44.7 48.4 - 49.5 - 50.5 1389 1407 This study
SSU3Rd TAY GGT TRA GAC TAC RAC GG Reverse 47.5 49.0 - 52.5 - 56.0 1397 1416 This study
SSU4Fd CCG TTC TTA GTT GGT GG Forward 52.9 50.0 1670 1686 This study
SSU4Rd CAG ACA AAT CAC TCC ACC Reverse 50.0 50.3 1682 1699 This study
SSU5Fd TAC TAC CGA TYG AAT GGC Forward 47.2 48.9 - 50.1 - 51.2 2037 2054 This study
SSU5Rd CGG AGA CCT TGT TAC GAC Reverse 55.6 52.5 2148 2165 This study
SSU6Fm GCT TGT CTC AAA GAT TAA GCC ATG CAT GTC Forward 43.3 49.0 423 452 This study
SSU6Rm GCA GGT TAA GGT CTC GTT CGT TAT CGC Reverse 51.9 50.1 1707 1733 This study
SSU7Fm GAG TGT TCA AAG CAG GCC TNT GCT CG Forward 55.8 51.0 - 52.2 - 53.3 1153 1178 This study
SSU7Rm CAA TGC TCK ATC CCC AGC ACG AC Reverse 58.7 49.5 - 50.8 - 52.1 1921 1943 This study
SSU8Fm GCA CGC GCG CTA CAC TGA C Forward 68.4 52.2 1848 1866 This study
V9G TTA CGT CCC TGC CCT TTG TA Forward 45.0 42.8 2002 2021 de Hoog & Gerrits van den Ende (1998)

Novel primers were designed using a variety of complete SSU and LSU sequences obtained from the GenBank sequence database (www.ncbi.nlm.nih.gov/). The selection was not limited only to fungi belonging to the Dothideomycetes but encompassed as many as possible full sequences in order to make the primers as robust as possible. We aimed to keep the melting temperature (Tm) of the novel primers at 40–45 °C and the GC content to approximately 50 % to keep them as compatible as possible to existing published primers. Primer parameters were calculated using the OligoAnalyzer tool on the web site of Integrated DNA Technologies (http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/) with the “Oligo Conc” parameter set at 0.2 mM and the “Na+ Conc” parameter set at 16 mM. A framework of existing and novel primers was then aligned onto the sequence of Magnaporthe grisea (GenBank accession AB026819) to derive primer positions (Table 2) and evaluate coverage over the gene regions. These primers were amplified and sequenced in the following overlapping sections to cover the almost complete SSU and LSU for the selected strains (Table 2): SSU1Fd or SSU6Fm with SSU2Rd, SSU2Fd with SSU3Rd, SSU7Fm with SSU4Rd or SSU6Rm, SSU4Fd with 5.8S1Rd, V9G or LSU1Fd with LSU3Rd, LSU8Fd with LSU8Rd, LSU4Fd with LSU5Rd, and LSU5Fd with LSU7Rd. For some strains (Table 3) it was necessary to add an additional overlap for SSU4Fd with 5.8S1Rd (using SSU4Fd with SSU7Rm and SSU8Fm with 5.8S1Rd), for LSU8Fd with LSU8Rd (using LSU8Fd with LSU3Rd and LSU3Fd with LSU8Rd), and for LSU5Fd with LSU7Rd (using LSU5Fd with LSU6Rd and LSU6Fd with LSU7Rd) to complete the gaps due to large insertions.

Table 3.

Isolates containing group I intron sequences. The insertion positions of these introns are derived using Magnaporthe grisea GenBank accession AB026819 as reference in the 5'–3' direction.

Isolate Insertion between 18S or 28S nrDNA Intron size (bp) Blast result
Batcheloromyces leucadendriCBS 110892 1559 - 1560 18S nrDNA 350 No significant similarity
1820 - 1821 18S nrDNA 399 190/252 of AY545722 Hydropisphaera erubescens 18S nrDNA
4875 - 4876 28S nrDNA 328 211/264 of DQ246237 Teratosphaeria mexicana 28S nrDNA
5424 - 5425 28S nrDNA 538 No significant similarity
5538 - 5539 28S nrDNA 383 218/283 of EU181458 Trichophyton soudanense 28S nrDNA
Batcheloromyces proteaeCBS 110696 1559 - 1560 18S nrDNA 325 No significant similarity
1820 - 1821 18S nrDNA 399 191/254 of AY545722 Hydropisphaera erubescens 18S nrDNA
4875 - 4876 28S nrDNA 328 211/263 of DQ246237 Teratosphaeria mexicana 28S nrDNA
5424 - 5425 28S nrDNA 535 75/90 of DQ442697 Arxula adeninivorans 26S nrDNA
5538 - 5539 28S nrDNA 372 34/36 of GQ120133 Uncultured marine fungus 18S nrDNA
Catenulostroma macowaniiCBS 110756 1559 - 1560 18S nrDNA 395 297/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
5424 - 5425 28S nrDNA 914 No significant similarity
Catenulostroma macowaniiCBS 111029 1559 - 1560 18S nrDNA 395 303/379 of DQ848302 Mycosphaerella latebrosa 18S nrDNA
5424 - 5425 28S nrDNA 914 No significant similarity
Cercospora apiiCBS 118712 1820 - 1821 18S nrDNA 733 288/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora capsici CPC 12307 1820 - 1821 18S nrDNA 732 287/363 of EU167577 Mycosphaerella milleri 18S nrDNA
Cercospora janseanaCBS 145.37 1820 - 1821 18S nrDNA 350 295/365 of EU167577 Mycosphaerella milleri 18S nrDNA
Devriesia staurophoraCBS 375.81 3560 - 3561 28S nrDNA 309 No significant similarity
Miuraea persicae CPC 10069 1820 - 1821 18S nrDNA 603 399/443 of DQ848342 Mycosphaerella populorum 18S nrDNA
Mycosphaerella latebrosaCBS 652.85 1559 - 1560 18S nrDNA 370 234/296 of DQ848311 Septoria betulae 18S nrDNA
1820 - 1821 18S nrDNA 933 Matches same species
2168 - 2169 18S nrDNA 494 377/449 of DQ848326 Septoria alnifolia 18S nrDNA
4875 - 4876 28S nrDNA 481 No significant similarity
missing 5018 - 5019 28S nrDNA Not present Not present
5424 - 5425 28S nrDNA 680 No significant similarity
5538 - 5539 28S nrDNA 471 No significant similarity
Micosphaerella latebrosaCBS 687.94 1559 - 1560 18S nrDNA 370 231/295 of DQ848310 Septoria betulae 18S nrDNA
1820 - 1821 18S nrDNA 918 Matches same species
2168 - 2169 18S nrDNA 494 377/449 of DQ848326 Septoria alnifolia 18S nrDNA
4875 - 4876 28S nrDNA 480 No significant similarity
5018 - 5019 28S nrDNA 417 144/181 of AF430703 Beauveria bassiana 28S nrDNA
5424 - 5425 28S nrDNA 680 No significant similarity
5538 - 5539 28S nrDNA 471 No significant similarity
Mycosphaerella marksiiCBS 110942 1559 - 1560 18S nrDNA 341 332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Mycosphaerella marksii CPC 11222 1559 - 1560 18S nrDNA 341 332/355 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora-like genus CPC 11876 5538 - 5539 28S nrDNA 580 No significant similarity
Passalora bellynckiiCBS 150.49 1559 - 1560 18S nrDNA 409 147/191 of DQ848296 Mycosphaerella musae 18S nrDNA
Passalora dodonaea CPC 1223 5424 - 5425 28S nrDNA 738 No significant similarity
Phacellium paspaliCBS 113093 4875 - 4876 28S nrDNA 340 161/197 of DQ248314 Symbiotaphrina kochii 28S nrDNA
Phaeophleospora eugeniicola CPC 2557 missing 5424 - 5425 28S nrDNA Not present Not present
5538 - 5539 28S nrDNA 744 No significant similarity
Phaeophleospora eugeniicola CPC 2558 5424 - 5425 28S nrDNA 1846 No significant similarity
5538 - 5539 28S nrDNA 744 No significant similarity
Pseudocercospora angolensisCBS 112933 5018 - 5019 28S nrDNA 379 No significant similarity
Pseudocercospora angolensisCBS 149.53 5018 - 5019 28S nrDNA 379 No significant similarity
Pseudocercospora punctataCBS 113315 5424 - 5425 28S nrDNA 723 No significant similarity
5538 - 5539 28S nrDNA 725 67/73 of AF430699 Beauveria bassiana 28S nrDNA
Pseudocercospora punctata CPC 10532 5424 - 5425 28S nrDNA 731 No significant similarity
5538 - 5539 28S nrDNA 725 67/73 of AF430699 Beauveria bassiana 28S nrDNA
Ramularia coleosporii CPC 11516 1559 - 1560 18S nrDNA 445 No significant similarity
Ramularia grevilleana CPC 656 5538 - 5539 28S nrDNA 546 No significant similarity
Septoria apiicolaCBS 400.54 5424 - 5425 28S nrDNA 763 No significant similarity
Septoria obesaCBS 354.58 1820 - 1821 18S nrDNA 575 No significant similarity
2168 - 2169 18S nrDNA 548 394/454 of DQ848326 Septoria alnifolia 18S nrDNA
4875 - 4876 28S nrDNA 430 No significant similarity
Septoria pyricolaCBS 222.31 5424 - 5425 28S nrDNA 723 No significant similarity
Septoria quercicolaCBS 663.94 1559 - 1560 18S nrDNA 334 241/308 of DQ848303 Mycosphaerella latebrosa 18S nrDNA
1820 - 1821 18S nrDNA 442 379/452 of DQ848335 Mycosphaerella latebrosa 18S nrDNA
4875 - 4876 28S nrDNA 345 No significant similarity
5018 - 5019 28S nrDNA 367 122/155 of DQ518980 Lipomyces spencermartinsiae 28S nrDNA
5424 - 5425 28S nrDNA 526 No significant similarity
5538 - 5539 28S nrDNA 603 No significant similarity
Septoria rosaeCBS 355.58 1820 - 1821 18S nrDNA 496 No significant similarity
Sonderhenia eucalypticola CPC 11252 1559 - 1560 18S nrDNA 408 339/404 of DQ848314 Mycosphaerella populorum 18S nrDNA
4875 - 4876 28S nrDNA 337 229/289 of AB044641 Cordyceps sp. 28S nrDNA
5424 - 5425 28S nrDNA 705 No significant similarity
Stigmina plataniCBS 110755 1559 - 1560 18S nrDNA 379 40/44 of AB007686 Exophiala calicioides 18S nrDNA
5018 - 5019 28S nrDNA 376 No significant similarity
Stigmina synanamorph CPC 11721 5018 - 5019 28S nrDNA 371 No significant similarity
Teratosphaeria aff. nubilosaCBS 114419 4871 - 4872 28S nrDNA 141 No significant similarity; high identity to Teratosphaeria nubilosa
5538 - 5539 28S nrDNA 580 No significant similarity; high identity to Teratosphaeria nubilosa
Teratosphaeria aff. nubilosaCBS 116283 4871 - 4872 28S nrDNA 141 No significant similarity; high identity to Teratosphaeria nubilosa
5538 - 5539 28S nrDNA 580 No significant similarity; high identity to Teratosphaeria nubilosa
Teratosphaeria juvenalisCBS 110906 1559 - 1560 18S nrDNA 403 52/61 of DQ471010 Rutstroemia firma 18S nrDNA
4875 - 4876 28S nrDNA 345 224/290 of EF115309 Cordyceps bassiana 28S nrDNA
5424 - 5425 28S nrDNA 478 47/50 of EF115313 Cordyceps bassiana 28S nrDNA
5538 - 5539 28S nrDNA 402 No significant similarity
Teratosphaeria juvenalisCBS 111149 1559 - 1560 18S nrDNA 403 52/61 of DQ471010 Rutstroemia firma 18S nrDNA
4875 - 4876 28S nrDNA 345 224/290 of EF115309 Cordyceps bassiana 28S nrDNA
5424 - 5425 28S nrDNA 478 47/50 of EF115313 Cordyceps bassiana 28S nrDNA
5538 - 5539 28S nrDNA 402 No significant similarity
Teratosphaeria mexicanaCBS 110502 954 - 955 18S nrDNA 316 129/158 of DQ518980 Lipomyces spencermartinsiae 26S nrDNA
1559 - 1560 18S nrDNA 360 No significant similarity
1820 - 1821 18S nrDNA 388 128/168 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
3560 - 3561 28S nrDNA 383 124/151 of EF647754 Thecaphora thlaspeos 28S nrDNA
4875 - 4876 28S nrDNA 327 99/114 of L81104 Gaeumannomyces graminis var. tritici 28S nrDNA
5018 - 5019 28S nrDNA 315 No significant similarity
5424 - 5425 28S nrDNA 553 No significant similarity
Teratosphaeria mexicanaCBS 120744 954 - 955 18S nrDNA 318 130/158 of DQ518980 Lipomyces spencermartinsiae 26S nrDNA
1559 - 1560 18S nrDNA 360 No significant similarity
1820 - 1821 18S nrDNA 389 85/109 of AF281670 Cryptendoxyla hypophloia 18S nrDNA
3560 - 3561 28S nrDNA 378 119/155 of AY298780 Lentinellus castoreus 18S nrDNA
4875 - 4876 28S nrDNA 327 162/200 of AB033530 Penicillium sabulosum 18S nrDNA
5018 - 5019 28S nrDNA 309 No significant similarity
5424 - 5425 28S nrDNA 659 No significant similarity
Teratosphaeria nubilosaCBS 115669 4871 - 4872 28S nrDNA 141 No significant similarity; high identity to Teratosphaeria aff. nubilosa
5538 - 5539 28S nrDNA 580 No significant similarity; high identity to Teratosphaeria aff. nubilosa
Teratosphaeria nubilosaCBS 116005 4871 - 4872 28S nrDNA 141 No significant similarity; high identity to Teratosphaeria aff. nubilosa
5538 - 5539 28S nrDNA 580 No significant similarity; high identity to Teratosphaeria aff. nubilosa
Teratosphaeria ohnowaCBS 112896 954 - 955 18S nrDNA 325 28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
3560 - 3561 28S nrDNA 294 168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
5424 - 5425 28S nrDNA 607 47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria ohnowaCBS 112973 954 - 955 18S nrDNA 324 28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
3560 - 3561 28S nrDNA 294 168/227 of FJ358267 Chaetothyriales sp. 28S nrDNA
5424 - 5425 28S nrDNA 607 47/48 of EF115313 Cordyceps bassiana 28S nrDNA
Teratosphaeria pseudosuberosaCBS 118911 3560 - 3561 28S nrDNA 324 28/28 of DQ848329 Botryosphaeria quercuum 18S nrDNA
4875 - 4876 28S nrDNA 364 No significant similarity
Teratosphaeria sp. CBS 208.94 954 - 955 18S nrDNA 342 No significant similarity
3560 - 3561 28S nrDNA 309 59/70 of AY207244 Mycena pura 28S nrDNA
4875 - 4876 28S nrDNA 296 44/51 of EF551317 Tremella globispora 28S nrDNA
Teratosphaeria suberosa CPC 11032 5424 - 5425 28S nrDNA 313 159/197 of AB033529 Penicillium oblatum 18S nrDNA
5538 - 5539 28S nrDNA 596 80/99 of AB044639 Cordyceps kanzashiana 28S nrDNA
Thedgonia-like genus CPC 12304 1820 - 1821 18S nrDNA 444 262/331 of EU167577 Mycosphaerella milleri 18S nrDNA

The internal transcribed spacer regions, as well as all insertions (Table 3) were excluded from all analyses. Sequence data were deposited in GenBank (Table 1) and alignments in TreeBASE (www.treebase.org). Two separate analyses were performed: The first using only partial LSU data due to the limited number of complete LSU sequences available and the second using the almost complete SSU, 5.8S nrDNA and LSU alignment.

Maximum likelihood analyses (ML) were conducted in RAxML v. 7.0.4 (Stamatakis 2006) for the partial LSU alignment. A general time reversible model (GTR) with a discrete gamma distribution and four rate classes was applied. A tree was obtained by simultaneously running a fast bootstrap search of 1000 pseudoreplicates (Stamatakis et al. 2008) followed by a search for the most likely tree. Maximum Likelihood bootstrap value (MLBP) equal or greater than 70 % are given at the nodes (Fig. 1).

Fig. 1.

Fig. 1.

Fig. 1.

Fig. 1.

RAxML tree using only the partial LSU alignment with bootstrap values after 1 000 pseudorepetitions on the nodes. Type strains and novel species described in this study are indicated in bold.

Maximum likelihood analyses (ML) were conducted in RAxML v. 7.0.4 (Stamatakis 2006) for the almost complete SSU, 5.8S nrDNA and LSU alignment. A general time reversible model (GTR) with a discrete gamma distribution and four rate classes was applied to each partition (SSU, 5.8S nrDNA and LSU). A tree was obtained by simultaneously running a fast bootstrap search of 500 pseudoreplicates (Stamatakis et al. 2008) followed by a search for the most likely tree. Maximum Likelihood bootstrap value (MLBP) equal or greater than 70 % are given at the nodes (Fig. 2).

Fig. 2.

Fig. 2.

Fig. 2.

Fig. 2.

RAxML tree using the SSU, 5.8S nrDNA and LSU alignment with bootstrap values after 500 pseudorepetitions on the nodes.

Taxonomy

Fungal structures were mounted in lactic acid, and 30 measurements (× 1000 magnification) obtained per structure type. The range obtained is presented, except for spore measurements, where the 95 % confidence intervals are given with the extremes in parentheses. Colony colours (surface and reverse) were assessed after 1–2 wk on MEA at 25 °C in the dark, using the colour charts of Rayner (1970). All cultures obtained in this study are maintained in the culture collection of the Centraalbureau voor Schimmelcultures (CBS-KNAW) in Utrecht, the Netherlands (Table 1). Nomenclatural novelties and descriptions were deposited in MycoBank (Crous et al. 2004b). Names for which the taxonomy has not been resolved, but need to be allocated to another genus, are placed in inverted commas, e.g. “Mycosphaerella” iridis.

RESULTS

DNA amplification and phylogeny

Amplification products of approximately 1 700 bases were obtained for the standard amplification of the isolates listed in Table 1. The LSU region of these sequences was used to obtain additional sequences from GenBank that were added to the partial LSU alignment. We expected a total size of approximately 5 500 bp for the concatenated SSU, ITS1, 5.8S nrDNA, ITS2 and LSU at the start of the study; however, our alignment totalled about 12 000 bp due to numerous insertions (most likely group 1 introns) encountered for several strains (Table 3). These insertions frequently resulted in products too large to amplify or sequence effectively and sometimes required us to design additional novel primers in extra overlapping steps to complete these gaps (see Materials and Methods for details). Searching the GenBank database using these insertions had varied success (Table 3). Sequences of the 18S nrDNA are more abundant in the database whereas sequences of the second half to two-thirds of the 28S nrDNA are mostly absent. This also evident in Table 3, where insertions in the SSU more frequently found with similarity sequences in the database and insertions in the LSU (e.g. those between positions 5018–5019 and 5424–5425) frequently did not retrieve any significant similarity. Although there were some exceptions (e.g. the insertion between 1820 and 1821 in the SSU of Batcheloromyces leucadendri), most of the insertions in the SSU obtained hits with SSU sequences of species of Capnodiales in the database. In one case, between 954 and 955 for the SSU sequence of Teratosphaeria mexicana (both strains), a partial hit was obtained with an LSU sequence of Lipomyces spencermartinsiae (GenBank DQ518980). Many of the insertions in the LSU sequences did not retrieve significant hits in the database and those that did were with unrelated taxa. It is quite possible that this is an artifact of the poor representation of full-length LSU sequences in the database, especially for members of the Capnodiales. In some cases, an LSU insertion retrieved a hit with SSU sequences in the database, e.g. the insertion between 5538 and 5539 in Batcheloromyces proteae and between 3560 and 3561 and 4875 and 4876 in Teratosphaeria mexicana strain CBS 120744. In two cases (Mycosphaerella latebrosa and Phaeophleospora eugeniicola), an insertion was either lost or gained between two strains of the same species. The primers designed in this study allowed us to effectively amplify and sequence the SSU and LSU for the selected isolates. Althought these primers were not tested on taxa outside of the Capnodiales (except for one of the outgroups, Neofusicoccum australe), we attempted to design them as robust as possible using degeneracy if needed. We therefore expect that these primers will have wider applicability than just the Capnodiales in cases where other published primers fail to amplify or amplify poorly.

The RAxML search of the partial LSU alignment yielded a most likely tree (Fig. 1) with a log likelihood -13397.994021. The matrix had 395 distinct alignment patterns, with 6 % completely undetermined characters in the alignment. The manually adjusted alignment contained 295 sequences (including the outgroup sequence, Dothidea insculpta GenBank DQ247802) and 763 characters including alignment gaps. The RAxML search of the almost complete SSU, 5.8S nrDNA and LSU alignment yielded a most likely tree (Fig. 2) with a log likelihood -39022.881140. The matrix had 1211 alignment patterns with 0.01 % of the characters consisting of gaps or undetermined characters. The manually adjusted alignment contained 205 sequences (including the outgroup sequences, Neofusicoccum australe CPC 10899 and Magnaporthe grisea GenBank AB026819) and 5110 characters including alignment gaps. The obtained phylogenies (Figs 1, 2) are discussed in the Taxonomy section below.

Taxonomy

Several well-supported clades could be distinguished in the present study (Figs 1, 2), correlating to families in the Capnodiales. These families, and several new genera and species, are treated below.

Treatment of phylogenetic clades

Capnodiales Woron. Ann. Mycol. 23: 177. 1925.

Data obtained from multi-gene phylogenies prompted Schoch et al. (2006) to merge Mycosphaerellales with Capnodiales. Although the present study included numerous additional isolates, the orders remain problematic. Although there is support for the Mycosphaerellales as an order, additional families such as the Schizothyriaceae and Dissoconiaceae (see below) would have to also be elevated to order level, which would result in orders containing a single family, while Teratosphaeriaceae appears to comprise unresolved lineages. For this reason it was decided to retain these families within Capnodiales, but noting that as more families are added and better circumscribed, it is quite possible that the Mycosphaerellales would again be resurrected.

Mycosphaerellaceae Lindau, In: Engler & Prantl, Nat. Pflanzenfamilien 1(1): 421. 1897.

Type species: Mycosphaerella punctiformis (Pers.: Fr.) Starbäck, Bih. Kongl. Svenska Vetensk.-Akad. Handl. 15(3, 2): 9. 1889.

Notes: The Mycosphaerellaceae contains numerous genera, 20 of which are listed by Crous (2009), with many names under consideration (Crous et al. 2009b, c). From these data it is clear that genera such as Passalora, Pseudocercospora, Pseudocercosporella, Septoria, Zasmidium and Ramichloridium are paraphyletic (Hunter et al. in prep.). Well-resolved genera include Cercospora, Cercosporella, Ramularia, Ramulispora, Sonderhenia and Polythrincium. One particularly problematic clade contains Periconiella, Ramichloridium, Verrucisporota and Zasmidium, along with “Mycosphaerella” and Rasutoria teleomorphs. Barr (1987) erected Rasutoria for species with brown ascospores occurring on Gymnospermae. Rasutoria clusters in a clade adjacent to “Mycosphaerella” species with hyaline ascospores, such as M. aleuritidis and Mycosphaerella daviesiicola (Verrucisporota daviesiae) (Beilharz & Pascoe 2002).

The genus Phaeophleospora (1916) clusters with Lecanosticta acicola. The genus Lecanosticta (1922) has typical Phaeophleospora-like conidia, except that its conidiomata are acervular, and not pycnidial. If the type of Lecanosticta, L. pini also clusters in this clade, the generic concept Phaeophleospora may have to be widened to include Lecanosticta, as was done with Kirramyces to include Colletogloeopsis (Cortinas et al. 2006a, b).

Considerable controversy has surrounded the coelomycetes that Crous et al. (1997) placed in Phaeophleospora. Based on DNA phylogenetic data, it has now been shown that Kirramyces anamorphs (Walker et al. 1992), including those accommodated in Colletogloeopsis (Crous & Wingfield 1996, Crous et al. 2004c, 2006c, Cortinas et al. 2006a, b), are linked to Teratosphaeria (Andjic et al. 2007, Crous et al. 2009b, c). Crous et al. (2007a) showed Phaeophleospora to reside in the Mycosphaerellaceae and Kirramyces in the Teratosphaeriaceae, respectively. However, most taxa investigated to date were collected from Eucalyptus. As shown in the present study, Phaeophleospora atkinsonii, a pathogen of Hebes spp. (Wu et al. 1996, Pennycook & McKenzie 2002), clusters distant from Phaeophleospora s. str., while the same is true for Phaeophleospora concentrica, which is a pathogen of Protea spp. (Taylor et al. 2001a), and Phaeophleospora stonei, a pathogen of Eucalyptus (Crous et al. 2007c, 2009c). These taxa thus clearly represent yet another two genera in the Phaeophleospora complex. An older name that would potentially be available is Scoleciasis. However, when B. Sutton examined exsiccati of the type species, S. aquatica, only ascomata of a Leptosphaeria species were found (Crous et al. 1997). The association of S. aquatica with the Leptosphaeria was also noted in the original description, and this may indicate that Scoleciasis is allied to taxa in the Phaeosphaeriopsis/Phaeoseptoria complex (Arzanlou & Crous 2006). Both P. atkinsonii and P. concentrica have a typical Kirramyces morphology, namely brown, percurrently proliferating conidiogenous cells, and brown, obclavate, verruculose, transversely euseptate conidia. Further species thus need to be included in analyses before these generic concepts can be clarified.

During the course of this study several fresh collections of Leptosphaeria protearum were obtained. Leptosphaeria protearum is a major leaf spot and blight pathogen of Protea spp. (Knox-Davies et al. 1987), and causes severe losses in plantations of South African Protea spp. in Hawaii, and has been recorded in many countries where South African proteas are cultivated (Taylor & Crous 1998, Taylor et al. 2001b, Crous et al. 2004a). Cultures of this pathogen were found to cluster in the Mycosphaerellaceae, where they represent an undescribed genus, characterised by having bitunicate asci without pseudoparaphyses, brown, 3-septate ascospores, and a Coniothyrium-like anamorph. Its close phylogenetic relationship to Phaeophloeospora concentrica (Fig. 1) suggests that they could be congeneric, and that in future more Phaeophloeospora-like anamorphs may be found to cluster in this clade. We propose a new genus to accommodate Leptosphaeria protearum below.

Brunneosphaerella Crous, gen. nov. MycoBank MB514694.

Etymology: Brunneus + Sphaerella = is after its brown ascospores and Sphaerella-like morphology.

Mycosphaerellae similis, sed ascosporis brunneis, 3-septatis.

Ascomata amphigenous, immersed to semi-immersed, black, single, gregarious, substomatal, pyriform or globose with a papillate, periphysate ostiole. Peridium consisting of three strata of slightly compressed textura angularis, an outer stratum of dark brown, thick-walled cells, becoming paler in the central stratum, and hyaline, thin-walled in the inner stratum. Asci clavate to cylindro-clavate, often curved, tapering to a pedicel, narrowing slightly to a rounded apex with an indistinct ocular chamber, 8-spored, bitunicate with fissitunicate dehiscense. Pseudoparaphyses absent. Ascospores biseriate, fusiform, broader at the apical end, initially hyaline and 1-septate, becoming yellow-brown and 3-septate at maturity, slightly constricted at median to supra-median septum.

Type species: Brunneosphaerella protearum (Syd. & P. Syd.) Crous, comb. nov.

Brunneosphaerella jonkershoekensis (Marinc., M.J. Wingf. & Crous) Crous, comb. nov. MycoBank MB514695. Fig. 3.

Fig. 3.

Fig. 3.

Brunneosphaerella jonkershoekensis. A–B. Vertical sections through ascomata showing wall structure. C–D, G. Bitunicate asci. E–F. Ascospores. Scale bars: A, C = 50 μm, B = 20 μm, D, G = 10 μm, E–F = 5 μm (from Marincowitz et al. 2008).

Basionym: Leptosphaeria jonkershoekensis Marinc., M.J. Wingf. & Crous, In: Marincowitz et al., Microfungi occurring on Proteaceae in the fynbos: 62. 2008.

Ascomata pseudothecial, subepidermal, immersed, obpyriform, papillate, 180–205 × 160–235 μm. Peridium 20–30 μm thick, composed of relatively large cells, 11–15 × 2.5–5.5 μm; cells arranged in three strata; outer stratum consisting of 3–5 layers of dark brown, very thick-walled cells; middle stratum transient, consisting of a few layers of pale brown, thick-walled, compressed cells; inner stratum consisting of 1–2 layers of thin-walled, very compressed cells. Pseudoparaphyses absent. Asci bitunicate, inflated cylindrical to clavate, 81–95 × 13–15 μm, ocular chamber dome-shaped, indistinct. Ascospores pale brown, fusoid to ellipsoidal, tapering towards the base, (25–)29–34(–36) × (5–)6–7(–9) μm (av. 31.4 × 6.7 μm), apical cell the shortest, upper hemispore slightly larger than lower, at times slightly curved, 3-septate, smooth, guttulate (adapted from Marincowitz et al. 2008).

Host range and geographic distribution: Protea repens (South Africa, Western Cape) (Marincowitz et al. 2008).

Specimen examined: south Africa, Western Cape Province, Jonkershoek Nature Reserve, leaf litter of Protea repens, 6 Jun. 2000, S. Marincowitz, PREM 59447 holotype.

Notes: Although no culture is presently available for this species, it clearly represents a species of Brunneosphaerella, characterised by its bitunicate asci, and brown, 3-septate ascospores, as well as the absence of pseudoparaphyses. Brunneosphaerella jonkershoekensis can easily be distinguished from B. protearum based on its much larger ascospores (Crous et al. 2004a).

Brunneosphaerella protearum (Syd. & P. Syd.) Crous, comb. nov. MycoBank MB514696. Fig. 4.

Fig. 4.

Fig. 4.

Brunneosphaerella protearum. A–D. Leaf spots on different Protea spp. E. Close up of leaf spot showing ascomata. F. Substomatal ascomata. G–H. Vertical sections though ascomata, showing wall structure. I–K. Germinating ascospores on MEA. L–M, R. Bitunicate asci. N–Q, S. Juvenile to mature ascospores. Scale bars: G = 75 μm, H = 10 μm.

Basionym: Leptosphaeria protearum Syd. & P. Syd., Ann. Mycol. 10: 441. 1912.

Anamorph: “Coniothyrium” protearum Joanne E. Taylor & Crous, IMI Descriptions of Fungi and Bacteria No. 1343. 1998.

Leaf spots circular to irregular, discrete to confluent, variable in size, under conditions favourable to disease symptoms more similar to a blight than a leaf spot, necrotic, sunken with a raised dark brown margin and with conspicuous black ascomata in the dead tissue, 4–30 mm diam. Ascomata pseudothecial, substomatal, amphigenous, immersed to semi-immersed, not erumpent, black, single, gregarious, 180–320 μm diam; in section, substomatal, subepidermal, pyriform or globose with a papillate, periphysate ostiole, immersed in a stroma consisting of deteriorated host mesophyll cells filled with fungal hyphae, (210–)230–264(–288) μm high, (180–)200–255(–300) μm diam. Peridium consisting of three strata of slightly compressed textura angularis, an outer stratum of dark brown, thick-walled cells, becoming paler in the central stratum, and hyaline, thin-walled in the inner stratum, altogether (20–)24.5–37.5(–50) μm thick. Asci clavate to cylindro-clavate, often curved, tapering to a pedicel, narrowing slightly to a rounded apex with an indistinct ocular chamber, 8-spored, bitunicate with fissitunicate dehiscense, (70–)80–87.5(–105) × (13.5–)14.5–16(–21.5) μm. Pseudoparaphyses absent. Ascospores biseriate, fusiform, broader at the apical end, initially hyaline and 1-septate, becoming yellow-brown and 3-septate at maturity, slightly constricted at median to supra-median septum, (21.5–)27.5–29.5(–37.5) × (6.3–)7.5–8(–10) μm in water mounts, (21–)25.5–27.5(–31) × (5.5–)6–7(–8) μm in lactophenol. Conidiomata barely visible and interspersed between ascomata, pycnidial, subepidermal, substomatal, separate, globose to pyriform, occasionally with well-developed papilla, dark brown, < 200 μm diam. Conidiophores reduced to conidiogenous cells. Conidiogenous cells discrete, smooth, hyaline, doliiform to ampulliform, holoblastic, proliferating 1–2 times percurrently, 4–6 × 3–4 μm. Conidia pale brown to medium brown, thick-walled on maturity, smooth to finely verruculose, eguttulate, ellipsoidal to globose, often truncate at one end, 5–10 × 3–7 μm (adapted from Crous et al. 2004a).

Host range and geographic distribution: Protea cynaroides, P. `Susara' (Portugal, Madeira) (Moura & Rodrigues 2001); P. caffra, P. compacta, P. cynaroides, P. gaguedi, P. grandiceps, P. lacticolor, P. laurifolia, P. lepidocarpodendron, P. lorifolia, P. magnifica, P. nitida, P. punctata, P. repens, P. `Sheila', Protea spp. (South Africa); P. cynaroides, P. laurifolia, P. neriifolia, P. `Ivory Musk', P. `Mink', P. `Pink Ice', P. `Rose Mink', P. susannae, Protea sp. (U.S.A., Hawaii) (Taylor et al. 2001b); P. cynaroides, P. gaguedi, P. neriifolia, Protea sp. (Zimbabwe, Inyanga) (Masuka et al. 1998).

Specimens examined: south Africa, Western Cape Province, Bettys' Bay, leaf litter of Protea magnifica, 11 Jul. 2000, S. Marincowitz, PREM 59448; Helderberg Nature Reserve, leaf litter of Protea laurifolia, 14 Aug. 2000, S. Marincowitz, PREM 59482; Helderberg Nature Reserve, leaf litter of Protea obtusifolia, 14 Aug. 2000, S. Marincowitz, PREM 59495; Jonkershoek Nature Reserve, leaf litter of Protea nitida, 6 Jun. 2000, S. Marincowitz, PREM 59442; Jonkershoek Nature Reserve, leaf litter of Protea repens, 6 Jun. 2000, S. Marincowitz, PREM 59450; Jonkershoek Nature Reserve, S33°59'11.2” E18°57'14.7” leaves of Protea sp., 1 Apr. 2007, P.W. Crous, CBS H-20330, cultures CPC 13914–13916; Jonkershoek Nature Reserve, S33°59'26.1” E18°57'59.5” leaves of Protea repens, 1 Apr. 2007, P.W. Crous, CBS H-20331, cultures CPC 13911–13913; Jonkershoek Nature Reserve, leaves of Protea sp., 1 Apr. 2007, P.W. Crous, CBS H-20332, cultures CPC 13908–13910; Jonkershoek Nature Reserve, “Tweede Waterval”, leaves of Protea sp., 1 Apr. 2007, P.W. Crous, CBS H-20333, cultures CPC 13902–13907; Jonkershoek Nature Reserve, leaves of Protea nitida, 12 Apr. 2008, L. Mostert, CBS H-20334, cultures CPC 15231–15233; Kirstenbosch Botanical Garden, leaves of Protea sp., 13 Jan. 2009, P.W. Crous, CBS H-20335, culture CPC 16338.

Notes: Although Taylor & Crous (1998) reported a Coniothyrium-like anamorph to develop in culture, none of the cultures examined in the present study on MEA, PDA or OA could be induced to sporulate, though spermatogonia and ascomatal initials were commonly observed.

The fact that cultures of Leptosphaeria protearum, which represents a well-known and serious pathogen of Proteaceae, clustered in the Mycosphaerellaceae, was totally unexpected. A further surprise was the fact that this species appears to represent a complex of several cryptic taxa. Whether these taxa can be correlated with differences in host range and geographic distribution can only be resolved once more collections have been obtained for study. Although the genus Sphaerulina, which represents Mycosphaerella-like taxa with 3-septate, hyaline ascospores, is part of the Mycosphaerellaceae (Crous et al., unpubl data), the type species, S. myriadea, clusters in the Septoria clade, and is thus unavailable for the species occurring on Proteaceae. Morphologically Brunneosphaerella is also distinct in that ascospores are always brown at maturity, and anamorphs have brown, percurrently proliferating conidiogenous cells, appearing Phaeophleospora-like. The recognition of Brunneosphaerella as a distinct genus in the Mycosphaerellaceae also raises the intriguing possibility that many phytopathogenic species of the Leptosphaeria-complex with brown, 3-septate ascospores, but lacking paraphyses, actually belong to Brunneosphaerella.

Passalora ageratinae Crous & A.R. Wood, sp. nov. MycoBank MB514697. Fig. 5.

Fig. 5.

Fig. 5.

Passalora ageratinae. A. Leaf spots. B. Close up of leaf spot with fruiting structures. C–D. Conidiophores. E–J. Conidia. Scale bars = 10 μm.

Etymology: Named after the host on which it occurs, Ageratina adenophora.

Passalorae assamensis similis, sed coloniis amphigenis, sine mycelio externo, conidiophoris brevioribus, 15–40 × 3–4.5 μm.

Leaf spots amphigenous, angular to irregular, 2–8 mm diam, medium brown, frequently with pale to grey-brown central part, and raised, dark brown border; pale to medium brown in reverse, with raised, dark brown border. Mycelium internal, consisting of smooth, branched, pale brown, 2–3 μm wide hyphae. Caespituli fasciculate, amphigenous, medium brown, arising from a brown, erumpent stroma, up to 80 μm wide, 40 μm high. Conidiophores subcylindrical, straight to geniculous-sinuous, unbranched, medium brown, finely verruculose, 1–3-septate, 15–40 × 3–4.5 μm. Conidiogenous cells terminal, pale to medium brown, finely verruculose with terminal, sympodial conidiogenous loci that are 1–2 μm diam, slightly thickened, darkened and refractive, 10–20 × 3–4 μm. Conidia in unbranched chains, pale brown, smooth, finely to prominently guttulate, subcylindrical to narrowly obclavate, apex obtuse, base long obconically subtruncate, (0–)1–3(–5)-septate, (20–)30–60(–80) × (3–)4(–4.5) μm; hila 1–1.5 μm wide, somewhat thickened, darkened and refractive.

Culture characteristics: On MEA erumpent, with uneven, folded surface, lobate margin, and moderate aerial mycelium; centre pale mouse-grey with patches of cinnamon, outer margin olivaceous-grey; reverse olivaceous-grey with patches of cinnamon; reaching 15 mm diam; on PDA spreading, with cinnamon to cream patches in centre, becoming umber towards smooth margins, with diffuse red pigment in agar; reverse olivaceous-grey, with patches of red, reaching 15 mm diam; on OA flat, spreading, up to 30 mm diam, iron-grey, with white, solitary mycelia strands, though aerial mycelium generally absent, reaching 30 mm diam.

Host range and geographic distribution: Ageratina adenophora, Australia, South Africa.

Specimen examined: south Africa, KwaZulu-Natal Province, Hilton, on leaves of Ageratina adenophora, 28 May 2008, A.R. Wood, CBS H-20336 holotype, cultures ex-type CPC 15365 = CBS 125419, CPC 15366, 15367.

Notes: Ageratina adenophora (crofton weed; Asteraceae), which is indigenous to Mexico, has invaded many countries as a rapidly growing weed, forming dense thickets (Morris 1989, Parsons & Cuthbertson 1992, Wagner et al. 1999, Zhu et al. 2007, Muniappan et al. 2009). It is considered a serious weed in agriculture and forestry (Bess & Haramoto 1958, Sharma & Chhetri 1977, Kluge 1991), often replacing more-desired vegetation or native species.

A leaf spot pathogen, originally misidentified as Cercospora eupatorii (this species is currently known as Pseudocercospora eupatorii), was found to infect plants in Australia where a stem galling fly (Procecidochares utilis; Tephritidae) was introduced from Hawaii as a biological control agent (Dodd 1961). Presumably the fungus was introduced together with the flies originally from Mexico to Hawaii and then to Australia. Subsequently this same fungus was obtained from Australia and released in South Africa after host specificity testing indicated it was restricted to A. adenophora (Morris 1989). The fungus causes partial defoliation of mature plants (Dodd 1961, Auld 1969), though the impact depends on environmental conditions (Dodd 1961). Seedlings are however killed rapidly (Wang et al. 1997).

This fungus, which has hitherto been known simply as “Phaeoramularia” sp., still lacks a name and proper description. The genus Phaeoramularia is treated as a synonym of Passalora (Crous & Braun 2003), and hence the species is named in the latter genus as P. ageratinae. Interestingly, this species appears to be closely related to Passalora fulva, which is a serious pathogen of tomato (Solanaceae) (Thomma et al. 2005).

Passalora armatae Crous & A.R. Wood, sp. nov. MycoBank MB514698. Fig. 6.

Fig. 6.

Fig. 6.

Passalora armatae. A. Fruiting in vivo. B–C. Caespituli with prominent basal stroma. D. Sporulation on MEA. E. Conidiogenous cells giving rise to conidia. F–G. Conidia. Scale bars: B = 125 μm, C–E = 10 μm.

Etymology: Named after the host on which it occurs, Dalbergia armata.

Passaloraea dalbergiicolae similis, sed conidiophoris in synnematibus densis, conidiis ad basim obconice truncatis, apice rostrato.

Leaf spots amphigenous, on upper surface visible as red-brown, irregular to subcircular spots with indistinct margins, 0.5–2 mm diam; in reverse indistinct, chlorotic to medium or red-brown. Mycelium internal, consisting of smooth, branched, pale brown, 2–3 μm wide hyphae. Caespituli hypophyllous, fasciculate to synnematous, up to 200 μm high and 250 μm wide, situated on a prominently erumpent, pale brown stroma, up to 100 μm high and wide. Conidiophores subcylindrical, unbranched, flexuous, guttulate, pale to medium brown, smooth, 120–180 × 4–6 μm, 2–6-septate. Conidiogenous cells terminal, subcylindrical, guttulate, pale to medium brown, finely verruculose, becoming somewhat swollen, appearing slightly clavate, 25–70 × 6–8 μm; conidiogenous loci 4–20 per conidiogenous cell, sympodial, round, darkened, thickened, refractive, prominent, 2–3 μm wide, up to 1 μm high. Conidia (27–)30–40(–45) × 9–10(–12) μm, pale to medium brown, smooth to finely verruculose, granular to guttulate, thin-walled, ellipsoidal to obovoid, transversely 2–4-euseptate, widest in middle of basal cell, or middle of conidium, tapering to an obconically truncate base; hilum thickened, darkened and refractive; apical cell conical, elongating to an apical beak up to 20 μm long. When cultivated conidia remain attached to conidiogenous cells, giving conidiophores the appearance of small tufts which is very characteristic, and not commonly observed in Passalora.

Culture characteristics: On MEA slow growing, erumpent, with dense white aerial mycelium, which becomes mouse-grey, reaching 5 mm diam after 1 wk; on PDA mouse-grey (surface), iron-grey (reverse), with diffuse red pigment in agar; on OA similar to PDA, also with diffuse red pigment in agar.

Host range and geographic distribution: Dalbergia armata, South Africa.

Specimen examined: south Africa, KwaZulu-Natal Province, South Coast, Mpenjati Nature Reserve, between Ramsgate and Port Edward, on leaves of Dalbergia armata, 28 May 2008, A.R. Wood, CBS H-20337 holotype, cultures ex-type CPC 15419 = CBS 125420, CPC 15420, 15421.

Notes: Passalora dalbergiae, which occurs on Dalbergia sissoo (Fabaceae) in India, is distinct from P. armatae in having superficial mycelium and solitary conidiophores (Hernández-Gutiérrez & Dianese 2009). The previously described Passalora dalbergiicola is similar to P. armatae in conidial dimensions (3-septate, 25–45 × 7–10 μm; Ellis 1976), but distinct in that conidiophores are not in dense synnemata, conidiogenous cells can have single apical loci, and conidia have a less prominent basal taper, and lack the apical beaks typical of P. armatae (in vivo and in vitro).

Schizothyriaceae Höhn. ex Trotter, Sacc., D. Sacc. & Traverso, In: Saccardo, Syll. Fung. 24(2): 1254. 1928.

Type species: Schizothyrium acerinum Desm., Ann. Sci. Nat. Bot. 11: 360. 1849.

Notes: Members of the Schizothyriaceae are associated with flyspeck symptoms on apples and pear fruit. The fungi grow superficially on the epicuticular wax, thereby reducing the marketability of the fruit, but do not penetrate the cuticle (Belding et al. 2000). Batzer et al. (2005, 2007) reported a range of diverse fungi to be associated with flyspeck symptoms on apples, the most prominent being species of Schizothyrium.

Dissoconiaceae Crous & de Hoog, fam. nov. MycoBank MB514699.

Ascomata pseudotheciales, immerse, globosa, uniloculares. Sine pseudoparaphysibus. Asci fasciculati, octospori, bitunicati. Ascosporae ellipsoideae-fusiformes, 1-septatae, hyalinae. Conidiophora separata, ex hyphis oriunda, subcylindrica, subulata, lageniformia vel cylindrica, apicem versus attenuata, apice obtuse rotundato vel truncate, recta vel semel geniculata, laevia, modice brunnea, 0–pluriseptata, locis terminalibus vel lateralibus, rhachidi cum cicatricibus leniter incrassates, fuscatis. Conidia solitaria, pallide olivaceo-brunnea, laevia, ellipsoidea, obclavata vel globosa, 0–1-septata, hilis aliquantum fuscatis. Conidia secundaria nulla vel formata ad conidia primaria, pallide olivacea vel subhyalina, aseptata, pyriformia; conidiis impigre vel passive emittentibus.

Ascomata pseudothecial, immersed, globose, unilocular, papillate, ostiolate, canal periphysate; wall consisting of 3–4 layers of brown textura angularis; inner layer of flattened, hyaline cells. Pseudoparaphyses absent. Asci fasciculate, 8-spored, bitunicate. Ascospores ellipsoid-fusoid, 1-septate, hyaline, with or without mucoid sheath. Mycelium internal and external, consisting of branched, septate, smooth, hyaline to pale brown hyphae. Conidiophores separate, arising from hyphae, subcylindrical, subulate or lageniform to cylindrical, tapering to a bluntly rounded or truncate apex, straight to once geniculate, smooth, medium brown, 0–multi-septate; loci terminal and lateral, visible as slightly thickened, darkened scars on a rachis. Conidia solitary, pale olivaceous-brown, smooth, ellipsoid to obclavate or globose, 0–1-septate; hila somewhat darkened. Secondary conidia present or absent; developing adjacent to primary conidia, pale olivaceous to subhyaline, aseptate, pyriform; conidium discharge active or passive.

Type species: Dissoconium aciculare de Hoog, Oorschot & Hijwegen, Proc. K. Ned. Akad. Wet., Ser. C, Biol. Med. Sci. 86(2): 198. 1983.

Notes: Species of Dissoconium have Mycosphaerella-like teleomorphs (Crous et al. 2004c). The genus is characterised by forming conidia in pairs that are forcefully discharged, which is quite unique in the Capnodiales (de Hoog et al. 1983). Although D. aciculare, the type species of Dissoconium, was originally assumed to be hyperparasitic on powdery mildew (de Hoog et al. 1983), Jackson et al. (2004) revealed that another species, D. dekkeri, could act as a foliar pathogen of Eucalyptus. Dissoconium dekkeri is, however, most commonly found in leaf spots in association with other species of Teratosphaeria and Mycosphaerella. Species of Dissoconium remain commensalists, and frequently occur asexually on lesions associated with pathogenic species of Capnodiales (Crous unpubl. data). They are ecologically and morphologically quite distinct from other members of the Capnodiales, and hence a separate family, the Dissoconiaceae, is herewith introduced to accommodate them. Ramichloridium forms brown, solitary conidiophores with a rachis and apical loci similar to that observed on Dissoconium, and primary conidia that are pale brown, 0–1-septate, with slightly thickened hila, but lacks secondary conidia (Arzanlou et al. 2008b). Both Dissoconium and Ramichloridium have in the past been reported as hyperparasitic on powdery mildews on various hosts (Hijwegen & Buchenauer 1984), which suggests that they share a similar ecology.

Teratosphaeriaceae Crous & U. Braun, Stud. Mycol. 58: 8. 2007.

Type species: Teratosphaeria fibrillosa Syd. & P. Syd., Ann. Mycol. 10: 40. 1912.

Notes: Since the family was established by Crous et al. (2007a) it has been shown to be too widely defined, incorporating many diverse genera (Crous et al. 2009b, c), and even families such as the Piedraiaceae (Fig. 1). The node as such is not well supported, suggesting that as more taxa are added, further families remain to be separated from the Teratosphaeriaceae. Presently it incorporates diverse elements, and even lichens such as Cystocoleus ebeneus and Anisomeridium consobrinum. The identity of the latter strain (CBS 101364) needs to be confirmed, as its position in the tree appears doubtful.

The genus Catenulostroma, which is associated with numerous diverse substrates and habitats (Crous et al. 2007a), is typified by C. protearum, for which an epitype is designated in the present study. Several strains isolated from rock surfaces (Guiedan et al. 2008, Ruibal et al. 2008, 2009, this volume) cluster with Catenulostroma (Fig. 1), and appear to represent undescribed species of the latter. Of interest is the fact that the type species of Aulographina, A. pinorum (CBS 302.71, CBS 174.90), which has hysterothecia, clusters in a clade with Catenulostroma microsporum, which has a Teratosphaeria-like teleomorph with pseudothecia (Taylor & Crous 2000, Crous et al. 2004a, 2007a). Isolates of A. pinorum were found to produce a Catenulostroma anamorph in culture. This raises two possibilities, namely that either the incorrect fungus was originally isolated from pine needles (namely Catenulostroma abietis), or that this is a species complex, in which A. pinorum resides. If these strains are indeed confirmed to represent A. pinorum, then it reveals the genus Aulographina to be heterogeneous, as A. eucalypti, which is a major leaf spot pathogen of Eucalyptus (Crous et al. 1989, Park et al. 2000, Carnegie & Keane 2003), clusters distant from A. pinorum. The taxonomy of these taxa is currently being addressed, and will be reported on elsewhere (Cheewangkoon et al., in prep.). During the course of this study some new members of the Teratosphaeriaceae were collected, which are described below: Catenulostroma protearum (Crous & M.E. Palm) Crous & U. Braun, Stud. Mycol. 58: 17. 2007. Fig. 7.

Fig. 7.

Fig. 7.

Catenulostroma protearum. A. Colony on OA. B–G. Sporulating colony, with variable muriform to transversely septate conidia. Scale bars = 10 μm.

Basionym: Trimmatostroma protearum Crous & M.E. Palm, Mycol. Res. 103: 1303. 1999.

Culture characteristics: On MEA spreading, erumpent, with folded surface, and unevenly lobed, smooth margins; aerial mycelium sparse; surface iron-grey to greenish black, reverse greenish black; reaching 15 mm diam after 2 wk; similar on PDA and OA.

Host range and geographic distribution: Protea, Leucadendron and Hakea spp., South Africa.

Specimens examined: south Africa, on leaves of Protea grandiceps, L. Schroeder, 15 Sept. 1986, holotype BPI 1107849; south Africa, Western Cape Province, Stellenbosch, Assegaibos, on leaves of Leucadendron tinctum, F. Roets, 16 Apr. 2008, epitype designated here CBS H-20338, culture ex-epitype, CPC 15369, 15370 = CBS 125421; ditto, on leaves of Hakea sericea, CBS H-20339, single ascospore culture CPC 15368.

Notes: Catenulostroma protearum was originally described from dead leaves of Protea grandiceps collected in South Africa (Crous & Palm 1999). Unfortunately the cultures died before they could be deposited, and hence the phylogenetic position of Catenulostroma remained uncertain. This proved to be problematic, as the genus was later shown to be heterogeneous (Crous et al. 2007a). The designation of the epitype in the present study clarifies the phylogenetic position of the genus, and reveals Catenulostroma s. str. to represent species that occur in extreme environments, on rocks, or on hard, leathery leaves such as Proteaceae and Gymnospermae.

Devriesia hilliana Crous & U. Braun, sp. nov. MycoBank MB514700. Fig. 8.

Fig. 8.

Fig. 8.

Devriesia hilliana. A. Sporulating colony on OA. B–D. Conidiophores giving rise to catenulate conidia. E–G. Fragmenting conidial segments from aerial hyphae. Scale bars = 10 μm.

Etymology: Named in fond memory of Dr C.F. Hill. “Frank” collected numerous fungi over the years, and sent them to the various international colleagues he knew to be working on these groups. The present species was one of a batch of novel taxa that Frank collected and sent to us for treatment shortly before he had a relapse. Frank's friendship and mycological expertise will be sorely missed.

Devriesiae strelitziae similis, sed conidiis minoribus, (5–)7–10(–12) × (2–)2.5(–3) μm.

Colonies sporulating on MEA. Mycelium consisting of branched, septate, pale brown, smooth, 2–3 μm wide hyphae. Conidiophores solitary, erect on creaping hyphae, unbranched, medium brown, smooth, flexuous, thick-walled, 15–50 × 2–3 μm, 3–11-septate. Conidiogenous cells terminal, medium brown, subcylindrical, smooth, 5–20 × 2–3 μm; proliferating sympodially; hila flattened, unthickened, somewhat darkened, 1–1.5 μm wide. Conidia medium brown, smooth, subcylindrical to narrowly fusoid-ellipsoidal or obclavate, apical conidium with obtuse apex, additional conidia with truncate ends, somewhat darkened, 1–1.5 μm wide; conidia straight to irregularly bent, mostly in unbranched chains, (5–)7–10(–12) × (2–)2.5(–3) μm.

Culture characteristics: On MEA erumpent, spreading, with folded surface, and smooth margins with sparse aerial mycelium; surface mouse-grey, with thin, olivaceous-grey margin; reverse iron-grey, reaching 8 mm diam; on PDA similar, up to 8 mm diam, centre mouse-grey, margin and reverse iron-grey; on OA erumpent with moderate mouse-grey aerial mycelium, and iron-grey margin.

Host range and geographic distribution: Macrozamia communis, Auckland, New Zealand.

Specimen examined: New Zealand, Auckland, Auckland University Campus, Princes Street, on Macrozamia communis, C.F. Hill, 20 Apr. 2008, CBS H-20340 holotype, culture ex-type CPC 15382 = CBS 123187.

Devriesia lagerstroemiae Crous & M.J. Wingf., sp. nov. MycoBank MB514701. Fig. 9.

Fig. 9.

Fig. 9.

Devriesia lagerstroemiae. A. Leaves and flowers of Lagerstroemia indica. B. Leaf spots. C. Colony on OA. D–H. Conidiophores giving rise to branched conidial chains. Scale bars = 10 μm.

Etymology: Named after the host on which it occurs, Lagerstroemia.

Devriesiae strelitziae similis, sed conidiis latioribus, (5–)7–10(–12) × (2–)2.5(–3) μm.

Colonies sporulating on OA. Mycelium consisting of smooth, branched, septate, 2–3 μm wide hyphae. Conidiophores rarely micronematous, predominantly macronematous, erect on creeping hyphae, brown, cylindrical with swollen basal cell, thick-walled, smooth, flexuous, 20–90 × 3–4 μm, 5–20-septate. Conidiogenous cells terminal, cylindrical to clavate, polyblastic, pale to medium brown, 5–10 × 2–3(–4) μm; scars somewhat thickened and darkened, not refractive. Ramoconidia medium brown, smooth, subcylindrical, 9–15 × 3–5 μm, (0–)1(–2)-septate, but with clavate apex and several flattened loci that are somewhat darkened and thickened, 1 μm diam. Conidia in branched chains of up to 10, pale brown, smooth, narrowly ellipsoid, 0–1-septate, (5–)8–12(–15) × 2–3(–4) μm; apical conidium with rounded apex, the rest with flattened loci that are somewhat darkened and thickened, not refractive, 0.5–1 μm diam.

Culture characteristics: On MEA erumpent, spreading, with sparse aerial mycelium and irregular margin; surface olivaceous-grey, with patches of iron-grey; reverse iron-grey, reaching 10 mm diam; on PDA similar, but on OA iron-grey, reaching 15 mm diam.

Host range and geographic distribution: Lagerstroemia indica, U.S.A., Louisiana.

Specimen examined: U.S.A., Louisiana, Baton Rouge, Cod & Cook Centre, N30°24'50.3” W91°10'6.6”, on Lagerstroemia indica, P.W. Crous & M.J. Wingfield, holotype CBS H-20341, culture ex-type CPC 14403 = CBS 125422.

Notes: Devriesia lagerstroemiae clusters close to D. hilliana. As far as we know, neither species is heat-resistant, nor forms chlamydospores, and hence the placement in Devriesia is more due to phylogenetic similarity than their ecology.

Devriesia strelitziicola Arzanlou & Crous, sp. nov. MycoBank MB514702. Fig. 10.

Fig. 10.

Fig. 10.

Devriesia strelitziicola. A. Strelitzia sp. with dead leaves. B. Colony on OA. C–G. Conidiophores giving rise to conidia. H–M. Conidia. Scale bars = 10 μm.

Etymology: Named after its host plant, Strelitzia.

Devriesiae strelitziae similis, sed conidiis majoribus, (7–)25–45(–100) × (2–)2.5(–3) μm.

Colonies sporulating on OA. Mycelium consisting of medium brown, smooth, septate, branched, 2–3 μm wide hyphae; chlamydospores not observed. Conidiophores dimorphic. Microconidiophores reduced to conidiogenous cells on hyphae, erect, cylindrical, medium brown, smooth with truncate ends, proliferating sympodially, 4–7 × 2–3 μm. Macroconidiophores erect, cylindrical, straight to geniculate-sinuous, medium brown, smooth, unbranched or branched above, 30–100 × 2.5–3 μm, 3–10-septate. Conidiogenous cells terminal or lateral on branched conidiophores, medium brown, smooth, cylindrical, proliferating sympodially, 7–15 × 2.5–3 μm; loci truncate, inconspicuous, 1–1.5 μm wide. Conidia medium brown, smooth, guttulate, subcylindrical to narrowly obclavate, apex obtuse to truncate, base truncate, occurring in branched chains, widest at the basal septum, (7–)25–45(–100) × (2–)2.5(–3) μm, (0–)3–6(–13)-septate; hila inconspicuous to somewhat darkened and thickened, not refractive, 1–1.5 μm wide.

Culture characteristics: On MEA erumpent, slow growing, with moderate aerial mycelium and smooth margins; surface mouse-grey, reverse iron-grey, reaching 8 mm diam after 2 wk; similar on PDA and OA.

Host range and geographic distribution: Strelitzia sp., South Africa.

Specimen examined: south Africa, KwaZulu-Natal, Durban, Botanical Garden near Reunion, on leaves of Strelitzia sp., 5 Feb. 2005, W. Gams & H. Glen, CBS H-20342, holotype, culture ex-type X1045 = CBS 122480.

Notes: Devriesia strelitziicola is the second Devriesia species to be described from this host (Arzanlou et al. 2008a). The genus Devriesia was originally established to accommodate a group of heat-resistant, Cladosporium-like fungi (Seifert et al. 2004), and it appears that a different generic name will have to be introduced to accommodate those taxa occurring on plants. Further collections are required, however, to clarify the generic boundaries of Devriesia (Crous et al. 2007b).

Hortaea thailandica Crous & K.D. Hyde, sp. nov. MycoBank MB514703. Fig. 11.

Fig. 11.

Fig. 11.

Hortaea thailandica. A. Cercosporoid leaf spots on Syzygium siamense, in which H. thailandica occurred. B. Colonies on OA. C–E. Hyphae with conidiogenous loci (arrows). F–H. Conidia. Scale bars = 10 μm.

Etymology: Named after the country where it was collected, Thailand.

Hortaeae werneckii similis, sed conidiis brunneis, verruculosis, majoribus, (9–)10–13(–15) × (4–)5–6(–7) μm.

Colonies sporulating on MEA. Mycelium consisting of pale brown, smooth, septate, branched, 3–4 μm wide hyphae that become darker and thick-walled in the conidiogenous region. Conidiogenous cells integrated, intercalary on hyphae, reduced to short cylindrical loci, 2–2.5 μm wide, 1–4 μm tall; collarettes inconspicuous to minute; proliferating 1–2 times percurrently at apex. Conidia ellipsoid, aseptate, pale to medium brown, (4–)5–7(–9) × (2.5–)3 μm, verruculose, apex obtuse, base subtruncate with minute collarette; becoming swollen and elongate at maturity, with 1–4 transverse and 1–2 oblique septa; (9–)10–13(–15) × (4–) 5–6(–9) μm; hila inconspicuous, up to 2 μm wide, frequently with visible marginal frill; microcyclic conidiation commonly observed on OA, MEA and PDA.

Culture characteristics: On MEA erumpent, spreading; surface irregular, folded, greenish black, with sparse olivaceous-grey aerial mycelium and smooth, lobed, margins; reverse greenish black; reaching 12 mm diam after 2 wk; similar on OA and PDA.

Host range and geographic distribution: Syzygium siamense, Thailand.

Specimen examined: Thailand, Khao Yai National Park, N14°14'42.6” E101°22'15.7”, on leaves of Syzygium siamense, in lesions with a cercosporoid fungus, 27 Mar. 2009, P.W. Crous & K.D. Hyde, holotype in BBH, isotype CBS H-20343, culture ex-type CPC 16652, 16651 = CBS 125423, also in BCC.

Notes: Similar to Hortaea werneckii, which is also frequently isolated from lesions in association with plant pathogenic fungi, H. thailandica occurred in leaf spots in association with a cercosporoid fungus. It is distinct from H. werneckii by forming larger conidia that turn medium brown and verruculose with age. Several other taxa are newly placed in the Teratosphaeriaceae in the present study that require further evaluation. Xenomeris juniperi, a bitunicate ascomycete on Jupinerus with pseudothecia associated with a stroma, and pigmented, 1-septate ascospores, clusters close to Teratosphaeria species occurring on Protea and Eucalyptus, where the ascomata are also associated with stromatic tissue (Taylor & Crous 2000, Crous et al. 2006c). Fresh collections of this fungus would be required, however, to resolve its status. The occurrence of Sporidesmium species in the Teratosphaeriaceae should be interpreted with care, as the genus is polyphyletic, and further studies are required to resolve its status (Shenoy et al. 2006, Crous et al. 2008a, Yang et al., in prep.).

Davidiellaceae C.L. Schoch, Spatafora, Crous & Shoemaker, Mycologia 98: 1048. 2006.

Type species: Davidiella tassiana (De Not.) Crous & U. Braun, Mycol. Progr. 3: 8. 2003.

Notes: The Davidiellaceae was introduced for the genus Davidiella, which has Cladosporium anamorphs. As shown in the present analysis, however, allied genera such as Toxicocladosporium, Verrucocladosporium, Rachicladosporium and Graphiopsis also belong in this family. Of interest is the position of Melanodothis caricis in Cladosporium s. str. This fungus, which infects florets of Carex and Kobresia, forms a stroma that gives rise to several immersed ascomata with bitunicate, oblong asci that are aparaphysate, and 0–(2)-septate, hyaline, 9–14.5 × 2–4 μm ascospores. In culture, a hyaline, Ramularia-like anamorph developed, with sympodial proliferation, catenulate conidia, with thickened, darkened loci (Arnold 1971). Although these characteristics are atypical of the Davidiella/Cladosporium species in this clade, the position of Melanodothis caricis in this family cannot simply be disregarded. However, the ex-type culture of this fungus (CBS 860.72) proved to be sterile.

A further unconfirmed sequence (CBS 354.29, culture sterile, but fast growing, grey-brown, Cladosporium-like), is that submitted as Sphaerulina polyspora. The culture was accessioned in 1929, deposited by A.E. Jenkins, and there is reason to believe that it was derived from BPI 623724!, which is authentic for the species, and collected by F.A. Wolf in May 1924. Wolf (1925) described this fungus from twigs of Oxydendron arboretum with die-back disease symptoms, collected in Raleigh, North Carolina. Sphaerulina polyspora (623723 = Type!) has pseudothecia with aparaphysate, bitunicate asci, and ascospores that are hyaline, 3–5-septate, 20–24 × 6–7 μm. On the host it was linked to a Phoma-like anamorph, which also grew similar in culture (yeast-like budding), and has hyaline conidia which are ellipsoidal, 7–8 × 3.8–4 μm.

Colonies were reported as slow-growing, grey, appressed, with germinating ascospores forming yeast-like budding cells, and rarely having hyphae that extended from the margin of the colonies. The link between Sphaerulina-like species, with Selenophoma and Aureobasidium synanamorphs was recently illustrated by Cheewangkoon et al. (2009). Although members of the Dothideomycetes, these taxa do not cluster in the Davidiellaceae, and hence it seems a fair assumption that CBS 354.29 is not representative of Sphaerulina polyspora.

Rachicladosporium cboliae Crous, sp. nov. MycoBank MB514704. Fig. 12.

Fig. 12.

Fig. 12.

Rachicladosporium cboliae. A. Front Royal collection site in Virginia. B–E, G. Conidiophores with branched conidial chains. F. Hyphal coil. H–I. Chlamydospores in chains. J. Conidia. Scale bars = 10 μm.

Etymology: Named after the Consortium for the Barcode of Life, CBOL, who organised a Fungal Barcoding Symposium, during which this fungus was collected.

Rachicladosporio americano similis, sed conidiophoris dense fasciculatis et conidiis minoribus.

Colonies sporulating on OA. Mycelium consisting of branched, septate hyphae, pale brown, smooth, 1.5–3 μm wide, frequently constricted at septa, forming hyphal coils, but characteristically also forming intercalary and terminal clusters of chlamydospores that are brown, thick-walled, up to 6 μm diam. Conidiophores forming laterally on creeping hyphae, erect, visible as densely branched tufts on agar surface; conidiophores medium brown, smooth, thick-walled with bulbous base, lacking rhizoids, cylindrical, unbranched, flexuous, up to 250 μm long, 4–6 μm wide, 10–20-septate. Conidiogenous cells terminal, medium brown, smooth, polyblastic, subcylindrical, 10–20 × 3–4 μm; loci terminal, thickened, darkend, refractive, 1 μm diam. Ramoconidia 0(–1)-septate, subcylindrical, medium brown, smooth, 7–12 × 3–4 μm. Conidia 0(–1)-septate, in branched chains of up to 10, ellipsoid, pale brown, smooth, (6–)7–8(–10) × (2–)2.5(–3) μm; hila thickened, darkened and refractive, up to 1 μm diam.

Culture characteristics: On MEA spreading with sparse aerial mycelium and smooth margins; surface folded, centre pale mouse-grey to mouse-grey, margin iron-grey; reverse greenish black, reaching 15–20 mm diam after 2 wk; on PDA spreading with moderate aerial mycelium and smooth margins; surface olivaceous-grey, margin mouse-grey, reverse olivaceous-grey; reaching 30 mm diam; on OA spreading, folded with moderate aerial mycelium; surface pale mouse-grey (centre) to olivaceous-grey at margin, reaching 20 mm diam.

Host range and geographic distribution: Twig litter, Virginia, U.S.A.

Specimen examined: U.S.A., Virginia, Front Royal, N38°53'35” W78°10'50”, on twig debris, 14 May 2007, P.W. Crous, holotype CBS H-20344, cultures ex-type CPC 14034 = CBS 125424, CPC 14035, 14036.

Notes: Rachicladosporium cboliae is a cryptic species close to R. americanum, which was collected at the same site. They can be distinguished on the litter in that R. cboliae has conidiophores with densely branched tufts of conidia, in contrast to the more sparsely branched conidiophores of R. americanum. Furthermore, R. cboliae also forms prominent chains of chlamydospores in culture, which lacks in R. americanum. Finally, R. cboliae has smaller ramoconidia and conidia than those found in R. americanum (ramoconidia 13–23 × 3–4 μm; conidia 10–18 × 3–4 μm; Cheewangkoon et al. 2009).

DISCUSSION

The class Dothideomycetes incorporates fungal taxa exhibiting a wide range of nutritional modes, and results in these fungi being found in many diverse niches (Fig. 13). The two largest orders Pleosporales (Zhang et al. 2009; this volume) and Capnodiales encapsulate this diversity. Here we continue to expand sampling within the Capnodiales in order to provide a well founded phylogenetic scaffold for taxonomic classification, informative genomic sampling, ecological studies and evolutionary evaluations.

Fig. 13.

Fig. 13.

Members of Capnodiales exhibiting different ecological growth habits. A–C. Mycosphaerella marksii (plant pathogen). A. Leaf spot on Eucalyptus. B. Homothallic colony on MEA. C. Asci. D. Conidiophore of Cladosporium sphaerospermum (saprobe). E–G. Ascomata and asci of Davidiella macrocarpa (saprobe). H–J. Dissoconium dekkeri (plant pathogen, commensalist). H. Colony sporulating on MEA, with discharged conidia at the margin. I. Asci. J. Primary and secondary conidia attached to conidiophore. K–L. Dissoconium proteae (commensalist). K. Sporulation on MEA with microsclerotia. L. Two conidial types attached to conidiophore (arrow). M–Q. Conidioxyphium gardeniorum (sooty mold). M. Sporulation on MEA. N–P. Elongated, branched conidiomata with apical ostiolar hyphae. Q. Conidia. R–T. Leaf spot, ascus and verruculose ascospores of Teratosphaeria fibrillosa (plant pathogen). U–X. Schizothyrium pomi (epiphyte). U. Thyrothecia occurring on a Rhus stem. V. Ascomatal initials forming on OA. W. Asci. X. Conidiophore and conidia in vitro. Scale bars: E = 200 μm, M–O = 50 μm, all others = 10 μm.

Capnodiales

The Capnodiales currently contain nine families (Lumbsch & Huhndorf 2007, Kirk et al. 2008), a selection of which are included in this study, namely Capnodiaceae, Davidiellaceae, Mycosphaerellaceae, Piedraiaceae, and Teratosphaeriaceae. Unfortunately, no cultures were available of the Antennulariellaceae and Metacapnodiaceae, while Coccodiniaceae was again shown to cluster outside the order, in Chaetothyriales (Crous et al. 2007a). Families supported within Capnodiales (Fig. 1) include Capnodiaceae, Davidiellaceae, Teratosphaeriaceae, Dissoconiaceae, Schizothyriaceae and Mycosphaerellaceae. No support was obtained for Piedraiaceae, which appeared to cluster within Teratosphaeriaceae.

One of the main aims of the present study was to resolve the status of the Capnodiales and Mycosphaerellales. Although we were able to distinguish a clear, well resolved node for the Mycosphaerellales (incl. Mycosphaerellaceae), this node was not well supported, and elevating it to ordinal level would mean that additional orders need to be introduced to accommodate several families outside the Capnodiales s. str. This finding led us to conclude that it is best to retain all families within a single, diverse order, namely the Capnodiales.

Evolution of nutritional modes and ecological growth habits

The ancestral state of the present assemblage of taxa is likely to be saprobic, as Phaeotheca (Sigler et al. 1981, de Hoog et al. 1997, Tsuneda et al. 2004), and Comminutispora (Ramaley 1996) represent the earliest diverging lineages. This was similarly found for a majority of lineages in the larger context of Ascomycota (Schoch et al. 2009a, b). These taxa were not only all isolated from dead materials or substrates, but they also share the same unique mode of conidiogenesis, namely endoconidia, and a “black-yeast” appearance in culture. Phaeotheca, which is strongly halophilic (Zalar et al. 1999) is closely related to the lichen Racodium rupestre, which forms an association with Trentepohlia algae, in which the filamentous algae is enclosed by melanised hyphae of the fungus. This feature is also shared by another lichen, namely Cystocoleus ebeneus (Teratosphaeriaceae) (Muggia et al. 2008). The Capnodiaceae (sooty molds) that also cluster in a basal position in the tree are epiphytes, growing on insect exudates (honey dew). The Capnodiaceae are related to the Davidiellaceae, which represent Cladosporium and allied genera. This family contains a wide range of ecological adaptations, from primary plant pathogens, such as Graphiopsis chlorocephala on Paeonia (Schubert et al. 2007a, Braun et al. 2008), “Mycosphaerella” iridis on Iris (David 1997), to taxa opportunistic on humans, Cladosporium bruhnei (Schubert et al. 2007b), to halotolerant taxa, Cladosporium sphaerospermum (Zalar et al. 2007, Dugan et al. 2008), to saprobes, C. herbarum, C. cladosporioides (Schubert et al. 2007b).

The Teratosphaeriaceae contains several disjunct elements, many of which may still eventually be removed from the family as more taxa and additional sequence data are added, providing a better resolution to some of these clades. In its widest sense, the family contains lichens (Anisomeridium, Cystocoleus), saprobes (Catenulostroma spp.), and halophilic, hyperhydrotic or lipophilic species that have been reported from humans (Piedraia, Hortaea, Penidiella, Stenella) (de Hoog et al. 2000, Bonifaz et al. 2008, Plemenitaš et al. 2008), with the most derived clades tending to contain plant pathogens (Readeriella, Teratosphaeria).

Dissoconiaceae is an early diverging lineage to the Mycosphaerellaceae and Schizothyriaceae. Whereas most members of Dissoconiaceae appear to be commensalists, there is evidence that some species could be plant pathogenic (Jackson et al. 2004), while the Schizothyriaceae contains epiphytes (Batzer et al. 2007). The Mycosphaerellaceae contains species that are biotrophic (Polythrincium; Simon et al. 2009), necrotrophic plant pathogens (Brunneosphaerella, Cercospora, Dothistroma, Pseudocercospora, Pseudocercosporella, Ramularia, and Septoria), as well as some species that are saprobic (Passalora, Pseudocercospora, Ramichloridium and Zasmidium; Arzanlou et al. 2007), or endophytic (Pseudocercosporella endophytica; Crous 1998).

Within the Capnodiales, the positioning of saprobes such as Phaeotheca and Comminutispora and the sooty moulds (Capnodiaceae) may represent the more primitive state, from where transitions occurred to more lichenised, saprobic, biotrophic and nectrotrophic, plant pathogenic members of the order (Fig. 13). This appears to mirror the other large and diverse order in the class, the Pleosporales (Zhang et al. 2009; this volume). Lichenisation, as well as the ability to be saprobic or plant pathogenic evolved more than once, though the taxa in the later diverging clades of the tree tend to be strictly nectrotrophic plant pathogens. This should be interpreted with care, however, as Polythrincium is presently the only biotrophic member included in this analysis, and other biotrophic members of the Capnodiales may end up clustering here, among the presently dominant nectrotropic plant pathogens. One important and recent addition to Capnodiales diversity is the rock-inhabiting fungi (Ruibal et al. 2008, 2009; this volume). Although so far mainly isolated from sources in Antarctica and the Mediterranean area, it is clear that they are a ubiquitous group of fungi likely found throughout the globe. Their genetic diversity is underscored by the fact that rock inhabiting fungi of convergent morphology are also placed in other ascomycotan classes and orders (Gueidan et al. 2008). The fact that many of these species have reduced morphologies and are slow growers make their taxonomy challenging, but their phylogenetic placement within Teratosphaeriaceae and several other lineages within Capnodiales makes their inclusion in subsequent phylogenetic assessments of this order essential.

For this study, we designed novel primers to supplement primers presently available in literature. Although primers are usually designed for the genus or family of interest, they frequently tend to have a wider application. Therefore, we attempted to design our primers using a wide range of sequences from the GenBank sequence database, in the hope that these primers will eventually find application outside of the Capnodiales as well. Although this remains to be tested, we expect it to be the case. Our sequencing of the complete SSU and LSU for the selected members of the Capnodiales had a surprisingly large number of insertions present for numerous strains. Although some of these insertions were anticipated based on data already present in GenBank's database, the insertions in the LSU were not expected based on the sequences used for primer design. However, this could be a result of the fewer complete LSU sequences available in the database rather than a deviation on the part of members of the Capnodiales. More complete LSU sequences are needed from diverse orders to test whether this is the case or not. Some of the taxa sequenced during this study had insertions present at almost all of the possible insertion positions, e.g. Mycosphaerella latebrosa, Septoria quercicola and Teratosphaeria mexicana. These taxa are distributed throughout the tree, and do not only cluster in a basal position, and therefore it is difficult to predict why so many insertions were present. If these insertions were all present in a basal position, it would have been possible to argue that the higher number of insertions represents the ancestral condition, and that these insertions are lost during evolution. However, this proved not to be the case, and it could be that these taxa accumulated these insertions.

Although the present study adds significantly to our knowledge of the Capnodiales, the Capnodiaceae are still underrepresented, and probably consist of numerous diverse lineages that can be elevated to family level once our phylogenies become more resolved. Regardless of this fact, the Mycosphaerellaceae clade appears to be quite robust. It seems likely that further sampling of the diverse Teratosphaeriaceae will necessitate further taxonomic changes. The fact that the saprobic and plant pathogenic and endophytic modes have evolved several times in different families, suggest that many taxa can still easily adapt to changing environments. A focus on adding more lichenicolous taxa, and taxa occurring on non-plant substrates is crucial to provide further insight into the ecological adaptations occurring in the Capnodiales.

Acknowledgments

Several colleagues have helped to collect material studied here, without which this work would not have been possible. Drs E.H.C. Mckenzie and S.R. Pennycook (Landcare New Zealand) are specifically thanked for recollecting Phaeophleospora atkinsonii. We are grateful to BIOTEC and Dr Lily Eurwilaichitr (Director, Bioresources unit, BIOTEC) for assisting with a collection trip in Thailand under the collaborative BIOTEC-CBS memorandum of understanding. We thank Miss Marjan Vermaas for preparing the photographic plates, and M. Starink-Willemse, and A. van Iperen, for assistance with DNA sequencing and fungal cultures. Work performed for this paper by the second author after 2008 was supported in part by the Intramural Research Program of the NIH, National Library of Medicine. Before 2008 work was funded by a grant from NSF (DEB-0717476). We are grateful to Drs Roland Kirschner, Alan J. Phillips and Treena I. Burgess for their critical comments on this script. The views expressed, however, are those of the authors.

Taxonomic novelties: Brunneosphaerella Crous, gen. nov., B. jonkershoekensis (Marinc., M.J. Wingf. & Crous) Crous, comb. nov., B. protearum (Syd. & P. Syd.) Crous, comb. nov., Devriesia hilliana Crous & U. Braun, sp. nov., D. lagerstroemiae Crous & M.J. Wingf., sp. nov., D. strelitziicola Arzanlou & Crous, sp. nov., Dissoconiaceae Crous & de Hoog, fam. nov., Hortaea thailandica Crous & K.D. Hyde, sp. nov., Passalora ageratinae Crous & A.R. Wood, sp. nov., P. armatae Crous & A.R. Wood, sp. nov., Rachicladosporium cboliae Crous, sp. nov.

References

  1. Andjic V, Barber PA, Carnegie AJ, Hardy GEStJ, Wingfield MJ, Burgess TI (2007). Phylogenetic reassessment supports accommodation of Phaeophleospora and Colletogloeopsis from eucalypts in Kirramyces. Mycological Research 111: 1184–1198. [DOI] [PubMed] [Google Scholar]
  2. Aptroot A (2006). Mycosphaerella and its Anamorphs: 2. Conspectus of Mycosphaerella. CBS Biodiversity Series 5, Utrecht, The Netherlands.
  3. Arnold RH (1971). Melanodothis caricis, n. gen., n. sp. and “Hyalodothis? caricis”. Canadian Journal of Botany 49: 2187–2196. [Google Scholar]
  4. Arzanlou M, Crous PW (2006). Phaeosphaeriopsis musae. In: Fungal Planet – A Global Initiative to promote the Study of Fungal Biodiversity (Crous PW, Seifert KA, Samson RA, Hawksworth DL eds). CBS, Utrecht, Netherlands. Fungal Planet No. 9.
  5. Arzanlou M, Crous PW, Groenewald JZ (2008a). Devriesia strelitziae. In: Fungal Planet – A Global Initiative to promote the Study of Fungal Biodiversity (Crous PW, Seifert KA, Samson RA, Hawksworth DL eds). CBS, Utrecht, Netherlands. Fungal Planet No. 22.
  6. Arzanlou M, Groenewald JZ, Fullerton RA, Abeln ECA, Carlier J, et al. (2008b). Multiple gene genealogies and phenotypic characters differentiate several novel species of Mycosphaerella and related anamorphs on banana. Persoonia 20: 19–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Arzanlou M, Groenewald JZ, Gams W, Braun U, Shin H-D, Crous PW (2007). Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera. Studies in Mycology 58: 57–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Auld BA (1969). Incidence of damage caused by organisms which attack crofton weed in the Richmond-Tweed region of New South Wales. Australian Journal of Science 32: 163. [Google Scholar]
  9. Barr ME (1987). Prodomus to class Loculoascomycetes. Published by the author, Amherst, Massachusetts.
  10. Batzer JC, Gleason ML, Harrington TC, Tiffany LH (2005). Expansion of the sooty blotch and flyspeck complex on apples based on analysis of ribosomal DNA gene sequences and morphology. Mycologia 97: 1268–1286. [DOI] [PubMed] [Google Scholar]
  11. Batzer JC, Mercedes Diaz Arias M, Harrington TC, Gleason ML, Groenewald JZ, Crous PW (2007). Four species of Zygophiala (Schizothyriaceae, Capnodiales) are associated with the sooty blotch and flyspeck complex on apple. Mycologia 100: 246–258. [DOI] [PubMed] [Google Scholar]
  12. Beilharz V, Pascoe I (2002). Two additional species of Verrucisporota, one with a Mycosphaerella teleomorph, from Australia. Mycotaxon 82: 357–365. [Google Scholar]
  13. Belding RD, Sutton TB, Blankenship SM, Young E (2000). Relationship between apple fruit epicuticular wax and growth of Peltaster fructicola and Leptodontidium elatius, two fungi that cause sooty blotch disease. Plant Disease 84: 767–772. [DOI] [PubMed] [Google Scholar]
  14. Bess HA, Haramoto FH (1958). Biological control of pamakani, Eupatorium adenophorum, in Hawaii by a tephritid gall fly, Procecidochares utilis. 1. The life history of the fly and its effectiveness in the control of the weed. In: Proceedings of the Tenth International Congress of Entomology, Vol. 4 (Becker EC, ed.). Canada, Ottawa, Mortimer: 543–548. [Google Scholar]
  15. Bonifaz A, Badali H, Hoog GS de, Cruz M, Araiza J, et al. (2008). Tinea nigra by Hortaea werneckii, a report of 22 cases from Mexico. Studies in Mycology 61: 77–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Braun U, Crous PW, Dugan F, Groenewald JZ, Hoog GS de (2003). Phylogeny and taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov., the teleomorph of Cladosporium s.str. Mycological Progress 2: 3–18. [Google Scholar]
  17. Braun U, Crous PW, Schubert K (2008). Taxonomic revision of the genus Cladosporium s. lat. 8. Reintroduction of Graphiopsis (= Dichocladosporium) with further reassessments of cladosporioid hyphomycetes. Mycotaxon 103: 207–216. [Google Scholar]
  18. Carnegie AJ, Keane PJ (2003). Variation in severity of target spot, caused by Aulographina eucalypti, in a eucalypt species and provenance trial in Victoria. Australasian Plant Pathology 32: 393–402. [Google Scholar]
  19. Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, To-anan C (2008). Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. Persoonia 21: 77–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Cheewangkoon R, Groenewald JZ, Summerell BA, Hyde KD, To-anun C, Crous PW (2009). Myrtaceae, a cache of fungal biodiversity. Persoonia 23: 55–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Cortinas M-N, Burgess T, Dell D, Xu D, Crous PW, Wingfield BD, Wingfield MJ (2006b). First record of Colletogloeopsis zuluense comb. nov., causing a stem canker of Eucalyptus in China. Mycological Research 110: 229–236. [DOI] [PubMed] [Google Scholar]
  22. Cortinas M-N, Crous PW, Wingfield BD, Wingfield MJ (2006a). Multi-gene phylogenies and phenotypic characters distinguish two species within the Colletogloeopsis zuluensis complex associated with Eucalyptus stem cankers. Studies in Mycology 55: 133–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Crous PW (1998). Mycosphaerella spp. and their anamorphs associated with leaf spot diseases of Eucalyptus. Mycologia Memoir 21: 1–170. [Google Scholar]
  24. Crous PW (2009). Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal Diversity 38: 1–24. [Google Scholar]
  25. Crous PW, Aptroot A, Kang JC, Braun U, Wingfield MJ (2000). The genus Mycosphaerella and its anamorphs. Studies in Mycology 45: 107–121. [Google Scholar]
  26. Crous PW, Braun U (2003). Mycosphaerella and its anamorphs. 1. Names published in Cercospora and Passalora. CBS Biodiversity Series 1: 1–571. [Google Scholar]
  27. Crous PW, Braun U, Groenewald JZ (2007a). Mycosphaerella is polyphyletic. Studies in Mycology 58: 1–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Crous PW, Braun U, Schubert K, Groenewald JZ (2007b). Delimiting Cladosporium from morphologically similar genera. Studies in Mycology 58: 33–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Crous PW, Denman S, Taylor JE, Swart L, Palm ME (2004a). Cultivation and diseases of Proteaceae: Leucadendron, Leucospermum and Protea. CBS Biodiversity Series 2: 1–228. [Google Scholar]
  30. Crous PW, Ferreira FA, Sutton BC (1997). A comparison of the fungal genera Phaeophleospora and Kirramyces (coelomycetes). South African Journal of Botany 63: 111–115. [Google Scholar]
  31. Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004b). MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology 50: 19–22. [Google Scholar]
  32. Crous PW, Groenewald JZ, Mansilla JP, Hunter GC, Wingfield MJ (2004c). Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. Studies in Mycology 50: 195–214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Crous PW, Groenewald JZ, Summerell BA, Wingfield BD, Wingfield MJ (2009a). Co-occurring species of Teratosphaeria on Eucalyptus. Persoonia 22: 38–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Crous PW, Groenewald JZ, Wingfield MJ, Aptroot A (2003). The value of ascospore septation in separating Mycosphaerella from Sphaerulina in the Dothideales: a Saccardoan myth? Sydowia 55: 136–152. [Google Scholar]
  35. Crous PW, Groenewald JZ, Wood AR (2008a). Sporidesmium knawiae. In: Fungal Planet – A Global Initiative to promote the Study of Fungal Biodiversity (Crous PW, Seifert KA, Samson RA, Hawksworth DL eds). CBS, Utrecht, Netherlands. Fungal Planet No. 29.
  36. Crous PW, Kang JC, Braun U (2001). A phylogenetic redefinition of anamorph genera in Mycosphaerella based on ITS rDNA sequence and morphology. Mycologia 93: 1081–1101. [Google Scholar]
  37. Crous PW, Knox-Davies PS, Wingfield MJ (1989). A summary of fungal leaf pathogens of Eucalyptus and the diseases they cause in South Africa. South African Forestry Journal 149: 9–16. [Google Scholar]
  38. Crous PW, Liebenberg MM, Braun U, Groenewald JZ (2006a). Re-evaluating the taxonomic status of Phaeoisariopsis griseola, the causal agent of angular leaf spot of bean. Studies in Mycology 55: 163–173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Crous PW, Palm ME (1999). Systematics of selected foliicolous fungi associated with leaf spots of Proteaceae. Mycological Research 103: 1299–1304. [Google Scholar]
  40. Crous PW, Schroers HJ, Groenewald JZ, Braun U, Schubert K (2006b). Metulocladosporiella gen. nov. for the causal organism of Cladosporium speckle disease of banana. Mycological Research 110: 264–275. [DOI] [PubMed] [Google Scholar]
  41. Crous PW, Summerell BA, Carnegie AJ, Mohammed C, Himaman W, Groenewald JZ (2007c). Foliicolous Mycosphaerella spp. and their anamorphs on Corymbia and Eucalyptus. Fungal Diversity 26: 143–185. [Google Scholar]
  42. Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Groenewald JZ (2009b). Novel species of Mycosphaerellaceae and Teratosphaeriaceae. Persoonia 23: 119–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, et al. (2009c). Unravelling Mycosphaerella: do you believe in genera? Persoonia 23: 99–118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Crous PW, Summerell BA, Mostert L, Groenewald JZ (2008b). Host specificity and speciation of Mycosphaerella and Teratosphaeria species associated with leaf spots of Proteaceae. Persoonia 20: 59–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) (2009d). Fungal Biodiversity. CBS Laboratory Manual Series. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands.
  46. Crous PW, Wingfield MJ (1996). Species of Mycosphaerella and their anamorphs associated with leaf blotch disease of Eucalyptus in South Africa. Mycologia 88: 441–458. [Google Scholar]
  47. Crous PW, Wingfield MJ, Mansilla JP, Alfenas AC, Groenewald JZ (2006c). Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs occurring on Eucalyptus. II. Studies in Mycology 55: 99–131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Crous PW, Wingfield MJ, Park RF (1991). Mycosphaerella nubilosa a synonym of M. molleriana. Mycological Research 95: 628–632. [Google Scholar]
  49. Crous PW, Wood AR, Okada G, Groenewald JZ (2008c). Foliicolous microfungi occurring on Encephalartos. Persoonia 21: 135–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. David JC (1997). A contribution to the systematics of Cladosporium. Revision of the fungi previously referred to Heterosporium. Mycological Papers 172: 1–157. [Google Scholar]
  51. Dodd AP (1961). Biological control of Eupatorium adenophorum in Queensland. Australian Journal of Science 23: 356–365. [Google Scholar]
  52. Dugan FM, Braun U, Groenewald JZ, Crous PW (2008). Morphological plasticity in Cladosporium sphaerospermum. Persoonia 21: 9–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Ellis MB (1976). More dematiaceous hyphomycetes. CAB, International Mycological Institute, Surrey, Kew, U.K.
  54. Gardes M, Bruns TD (1993). ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118. [DOI] [PubMed] [Google Scholar]
  55. Gargas A, Taylor JW (1992). Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84: 589–592. [Google Scholar]
  56. Gueidan C, Ruibal Villaseñor C, Hoog GS de, Gorbushina AA, Untereiner WA, Lutzoni F (2008). A rock-inhabiting ancestor for mutualistic and pathogen-rich fungal lineages. Studies in Mycology 61: 111–119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Hawksworth DL, Kirk PM, Sutton BC, Pegler DN (1995). Ainsworth and Bisby's Dictionary of the Fungi, 8th edn. CAB International, Wallingford, U.K.
  58. Hernández-Gutiérrez A, Dianese JC (2009). New cercosporoid fungi from the Brazilian Cerrado 2. Species on hosts of the subfamilies Caesalpinioideae, Faboideae and Mimosoideae (Leguminosae s. lat.). Mycotaxon 107: 1–24. [Google Scholar]
  59. Hijwegen T, Buchenauer H (1984). Isolation and identification of hyperparasitic fungi associated with Erysiphaceae. Netherlands Journal of Plant Pathology 90: 79–84. [Google Scholar]
  60. Hoog GS de, Beguin H, Batenburg-van de Vegte WH (1997). Phaeotheca triangularis, a new meristematic black yeast from a humidifier. Antonie van Leeuwenhoek 71: 289–295. [DOI] [PubMed] [Google Scholar]
  61. Hoog GS de, Gerrits van den Ende AHG (1998). Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41: 183–189. [DOI] [PubMed] [Google Scholar]
  62. Hoog GS de, Guarro J, Gené J, Figueras MJ (2000). Atlas of Clinical Fungi. 2nd Edn. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands, and Universitat Rovira I Virgili, Reus, Spain.
  63. Hoog GS de, Oorschot CAN van, Hijwegen T (1983). Taxonomy of the Dactylaria complex. II. Proceedings van de Koninklijke Nederlandse Akademie van Wetenschappen, Series C, 86(2): 197–206. [Google Scholar]
  64. Hughes SJ. 1976. Sooty molds. Mycologia 68: 451–691. [Google Scholar]
  65. Hunter GC, Wingfield BD, Crous PW, Wingfield MJ (2006). A multi-gene phylogeny for species of Mycosphaerella occurring on Eucalyptus leaves. Studies in Mycology 55: 147–161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Jackson SL, Maxwell A, Neumeister-Kemp HG, Dell B, Hardy GEStJ (2004). Infection, hyperparasitism and conidiogenesis of Mycosphaerella lateralis on Eucalyptus globulus in Western Australia. Australasian Plant Pathology 33: 49–53. [Google Scholar]
  67. Kirk PM, Cannon PF, David JC, Stalpers JA (2001). Ainsworth and Bisby's Dictionary of the Fungi, 9th edn. CAB International, Wallingford, U.K.
  68. Kirk PM, Cannon PF, Minter DW, Stalpers JA (2008). Ainsworth and Bisby's Dictionary of the Fungi, 10th edn. CAB International, Wallingford, U.K.
  69. Kluge RL (1991). Biological control of crofton weed, Ageratina adenophora (Asteraceae), in South Africa. Agriculture, Ecosystems & Environment 37: 187–191. [Google Scholar]
  70. Knox-Davies PS, Wyk PS van, Marasas WFO (1987). Diseases of Protea, Leucospermum and Leucadendron recorded in South Africa. Phytophylactica 19: 327–337. [Google Scholar]
  71. Kretzer A, Li Y, Szaro T, Bruns TD (1996). Internal transcribed spacer sequences from 38 recognized species of Suillus sensu lato: phylogenetic and taxonomic implications. Mycologia 88: 776–785. [Google Scholar]
  72. Kruys A, Eriksson OE, Wedin M (2006). Phylogenetic relationships of coprophilous Pleosporales (Dothideomycetes, Ascomycota), and the classification of some bitunicate taxa of unknown position. Mycological Research 110: 527–536. [DOI] [PubMed] [Google Scholar]
  73. Lumbsch HT, Huhndorf S (2007). Outline of Ascomycota. Myconet 13: 1–99. [Google Scholar]
  74. Marincowitz S, Crous PW, Groenewald JZ, Wingfield MJ (2008). Microfungi occurring on Proteaceae in the fynbos. CBS Biodiversity Series 7: 1–166. [Google Scholar]
  75. Masuka J, Cole DL, Mguni C (1998). List of Plant Diseases in Zimbabwe. Department of Research Specialist Services, Ministry of Lands and Agriculture, Harare, Zimbabwe.
  76. Moncalvo J-M, Rehner SA, Vilgalys R (1993). Systematics of Lyophyllum section Difformia based on evidence from culture studies and ribosomal DNA sequences. Mycologia 85: 788–794. [Google Scholar]
  77. Morris MJ (1989). Host specificity studies of leaf spot fungus, Phaeoramularia sp. for the biological control of crofton weed (Ageratina adenophorum) in South Africa. Phytophylactica 21: 281–283. [Google Scholar]
  78. Moura MF, Rodrigues PF (2001). Fungal diseases on Proteas identified in Maderia Island. Acta Horticulturae 545: 265–268. [Google Scholar]
  79. Muggia L, Hafellner J, Wirtz N, Hawksworth DL, Grube M (2008). The sterile microfilamentous lichens Cystocoleus ebeneus and Racodium rupestre are relatives of clinically important dothidealean fungi. Mycological Research 112: 50–56. [DOI] [PubMed] [Google Scholar]
  80. Muniappan R, Raman A, Reddy GVP (2009) Ageratina adenophora (Sprengel) King and Robinson (Asteraceae). In: Biological control of tropical weeds using arthropods. (Muniappan R, Reddy GVP, Raman A, eds). Cambridge University Press, Cambridge: 1–16.
  81. Park RF, Keane PJ, Wingfield MJ, Crous PW (2000). Fungal diseases of eucalypt foliage. In: Diseases and pathogens of eucalypts. (Keane PJ, Kile GA, Podger FD, Brown BN, eds). CSIRO publishing, Australia: 153–239.
  82. Parsons WT, Cuthbertson EG (1992). Noxious Weeds of Australia. Melbourne: Inkata Press.
  83. Pennycook SR, McKenzie EHC (2002). Scoleciasis atkinsonii, an earlier name for Phaeophleospora hebes; and a note on G.H. Cunningham's epithets hebe and pseudopanax. Mycotaxon 82: 145–146. [Google Scholar]
  84. Plemenitaš A, Vaupotič T, Lenassi M, Kogej T, Gunde-Cimerman N (2008). Adaptation of extremely halotolerant black yeast Hortaea werneckii to increased osmolarity: a molecular perspective at a glance. Studies in Mycology 61: 67–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Ramaley AW (1996). Comminutispora gen. nov. and its Hyphospora gen. nov. anamorph. Mycologia 88: 132–136. [Google Scholar]
  86. Rayner RW (1970). A mycological colour chart. CMI and British Mycological Society. Kew, Surrey, England.
  87. Rehner SA, Samuels GJ (1994). Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625–634. [Google Scholar]
  88. Ruibal C, Platas G, Bills GF (2008). High diversity and morphological convergence among melanised fungi from rock formations in the Central Mountain System of Spain. Persoonia 21: 93–110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Ruibal C, Gueidan C, Selbmann L, Gorbushina A, Crous PW, et al. (2009). Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in Mycology 64: 123–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW (2006). A multigene phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98: 1041–1052. [DOI] [PubMed] [Google Scholar]
  91. Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, et al. (2009a). A class-wide phylogenetic assessment of Dothideomycetes. Studies in Mycology 64: 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Schoch CL, Sung GH, Lopez-Giraldez F, Townsend JP, Miadlikowska J, et al. (2009b). The Ascomycota Tree of Life: A Phylum-wide Phylogeny Clarifies the Origin and Evolution of Fundamental Reproductive and Ecological Traits. Systematic Biology 58: 224–239. [DOI] [PubMed] [Google Scholar]
  93. Schubert K, Braun U, Groenewald JZ, Crous PW (2007a). Cladosporium leaf-blotch and stem rot of Paeonia spp. caused by Dichocladosporium chlorocephalum gen. nov. Studies in Mycology 58: 95–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  94. Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, et al. (2007b). Biodiversity in the Cladosporium herbarum complex (Davidiellaceae, Capnodiales), with standardisation of methods for Cladosporium taxonomy and diagnostics. Studies in Mycology 58: 105–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Seifert KA, Nickerson NL, Corlett M, Jackson ED, Louis-Seize G, Davies RJ (2004). Devriesia, a new hyphomycete genus to accommodate heat-resistant, cladosporium-like fungi. Canadian Journal of Botany 82: 914–926. [Google Scholar]
  96. Sharma KC, Chhetri GKK (1977). Reports on studies on the biological control of Eupatorium adenophorum. Nepalese Journal of Agriculture 12: 135–157. [Google Scholar]
  97. Shenoy BD, Jeewon R, Wu WP, Bhat DJ, Hyde KD (2006). Ribosomal and RPB2 DNA sequence analyses suggest that Sporidesmium and morphologically similar genera are polyphyletic. Mycological Research 110: 916–928. [DOI] [PubMed] [Google Scholar]
  98. Sigler L, Tsuneda A, Carmichael JW (1981). Phaeotheca and Phaeosclera, two new genera of dematiaceous hyphomycetes and a redescription of Sarcinomyces Lindner. Mycotaxon 12: 449–467. [Google Scholar]
  99. Simon UK, Groenewald JZ, Crous PW (2009). Cymadothea trifolii, an obligate biotrophic leaf parasite of Trifolium, belongs to Mycosphaerellaceae as shown by nuclear ribosomal DNA analyses. Persoonia 22: 49–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  100. Singh SK, Chaudhary RK, Morgan-Jones G (1995). Notes on Hyphomycetes: LXVII. Three new species of Phaeoramularia from Nepal. Mycotaxon 54: 57–66. [Google Scholar]
  101. Spatafora JW, Mitchell TG, Vilgalys R (1995). Analysis of genes encoding for small-subunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens. Journal of Clinical Microbiology 33: 1322–1326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  102. Stamatakis A (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. [DOI] [PubMed] [Google Scholar]
  103. Stamatakis A, Hoover P, Rougemont J (2008). A Rapid Bootstrap Algorithm for the RAxML Web Servers. Systematic Biology 57: 758–771. [DOI] [PubMed] [Google Scholar]
  104. Taylor JE, Cannon PF, David JC, Crous PW (2001a). Two new Phaeophleospora species associated with leaf spots of Proteaceae. South African Journal of Botany 67: 39–43. [Google Scholar]
  105. Taylor JE, Crous PW (1998). Leptosphaeria protearum. IMI Descriptions of Fungi and Bacteria No. 1343.
  106. Taylor JE, Crous PW (2000). Fungi occurring on Proteaceae. New anamorphs for Teratosphaeria, Mycosphaerella and Lembosia, and other fungi associated with leaf spots and cankers of Proteaceous hosts. Mycological Research 104: 618–636. [Google Scholar]
  107. Taylor JE, Crous PW, Palm ME (2001b). Foliar and stem fungal pathogens of Proteaceae in Hawaii. Mycotaxon 78: 449–490. [Google Scholar]
  108. Thomma BPHJ, van Esse PH, Crous PW, Wit PJGM de (2005). Cladosporium fulvum (syn. Passalora fulva), a highly specialized plant pathogen as a model for functional studies on plant pathogenic Mycosphaerellaceae. Molecular Plant Pathology 6: 379–393. [DOI] [PubMed] [Google Scholar]
  109. Tsuneda A, Tsuneda I, Currah RS (2004). Endoconidiogenesis in Endoconidioma populi and Phaeotheca fissurella. Mycologia 96: 1134–1140. [PubMed] [Google Scholar]
  110. Vilgalys R, Hester M (1990). Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  111. Wagner WL, Herbst DR, Sohmer SH (1999). Manual of the Flowering Plants of Hawaii. Revised edition. Honolulu, HI: University of Hawaii Press.
  112. Walker J, Sutton BC, Pascoe IG (1992). Phaeoseptoria eucalypti and similar fungi on Eucalyptus with description of Kirramyces gen. nov. (coelomycetes). Mycological Research 96: 911–924. [Google Scholar]
  113. Wang F, Summerell BA, Marshall D, Auld BA (1997). Biology and pathology of a species of Phaeoramularia causing a leaf spot of crofton weed. Australasian Plant Pathology 26: 165–172. [Google Scholar]
  114. White TJ, Bruns T, Lee S, Taylor J (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications (Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds). Academic Press, San Diego, California: 315–322.
  115. Wolf FA (1925). Some undescribed fungi on sourwood, Oxydendron arboretum (L.) DC. Journal of the Elisha Mitchell Scientific Society 41: 94–99. [Google Scholar]
  116. Wu W, Sutton BC, Gange AC (1996). Revision of Septoria species on Hebe and Veronica and description of Kirramyces hebes sp. nov. Mycological Research 100: 1207–1217. [Google Scholar]
  117. Yen JM, Lim G (1980). Cercospora and allied genera of Singapore and the Malay Peninsula. Gardens' Bulletin Singapore 33: 151–263. [Google Scholar]
  118. Zalar P, Hoog GS de, Gunde-Cimerman N (1999). Ecology of halotolerant dothideaceous black yeast. Studies in Mycology 43: 38–48. [Google Scholar]
  119. Zalar P, Hoog GS de, Schroers H-J, Crous PW, Groenewald JZ, Gunde-Cimerman N (2007). Phylogeny and ecology of the ubiquitous saprobe Cladosporium sphaerospermum, with descriptions of seven new species from hypersaline environments. Studies in Mycology 58: 157–183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  120. Zhang Y, Schoch CL, Fournier J, Crous PW, Gruyter J de, et al. (2009). Multi-locus phylogeny of the Pleosporales: a taxonomic, ecological and evolutionary reevaluation. Studies in Mycology 64: 85–102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  121. Zhu L, Sun OJ, Sang W, Li Z, Ma K (2007). Predicting the spatial distribution of an invasive plant species (Eupatorium adenophorum) in China. Landscape Ecology 22: 1143–1154. [Google Scholar]

Articles from Studies in Mycology are provided here courtesy of Westerdijk Fungal Biodiversity Institute

RESOURCES