Skip to main content
PLOS One logoLink to PLOS One
. 2010 Feb 12;5(2):e9191. doi: 10.1371/journal.pone.0009191

Evolution and Ecophysiology of the Industrial Producer Hypocrea jecorina (Anamorph Trichoderma reesei) and a New Sympatric Agamospecies Related to It

Irina S Druzhinina 1,*, Monika Komoń-Zelazowska 1, Lea Atanasova 1, Verena Seidl 1, Christian P Kubicek 1
Editor: Alfredo Herrera-Estrella2
PMCID: PMC2820547  PMID: 20169200

Abstract

Background

Trichoderma reesei, a mitosporic green mould, was recognized during the WW II based on a single isolate from the Solomon Islands and since then used in industry for production of cellulases. It is believed to be an anamorph (asexual stage) of the common pantropical ascomycete Hypocrea jecorina.

Methodology/Principal Findings

We combined molecular evolutionary analysis and multiple methods of phenotype profiling in order to reveal the genetic relationship of T. reesei to H. jecorina. The resulting data show that the isolates which were previously identified as H. jecorina by means of morphophysiology and ITS1 and 2 (rRNA gene cluster) barcode in fact comprise several species: i) H. jecorina/T. reesei sensu stricto which contains most of the teleomorphs (sexual stages) found on dead wood and the wild-type strain of T. reesei QM 6a; ii) T. parareesei nom. prov., which contains all strains isolated as anamorphs from soil; iii) and two other hypothetical new species for which only one or two isolates are available. In silico tests for recombination and in vitro mating experiments revealed a history of sexual reproduction for H. jecorina and confirmed clonality for T. parareesei nom. prov. Isolates of both species were consistently found worldwide in pantropical climatic zone. Ecophysiological comparison of H. jecorina and T. parareesei nom. prov. revealed striking differences in carbon source utilization, conidiation intensity, photosensitivity and mycoparasitism, thus suggesting adaptation to different ecological niches with the high opportunistic potential for T. parareesei nom. prov.

Conclusions

Our data prove that T. reesei belongs to a holomorph H. jecorina and displays a history of worldwide gene flow. We also show that its nearest genetic neighbour - T. parareesei nom. prov., is a cryptic phylogenetic agamospecies which inhabits the same biogeographic zone. These two species thus provide a so far rare example of sympatric speciation within saprotrophic fungi, with divergent ecophysiological adaptations and reproductive strategies.

Introduction

The holomorphic fungal genus Hypocrea/Trichoderma (Hypocreales, Ascomycota) contains several hundred species comprising both sexually propagating (Hypocrea) as well as apparently mitosporic (Trichoderma) taxa without observed ability to sexual reproduction. One species of Trichoderma -T. reesei - is particularly well known because it is used in the biotechnological industry for the production of cellulolytic and hemicellulolytic enzymes and recombinant proteins [1], [2]. This property, and strategies for its further improvement, have recently regained strong interest because of the attempts to produce second generation biofuels to combat carbon dioxide emission and dependence on fossil oil [3], [4].

T. reesei was originally isolated as in the Solomon Islands during WW II, where it destroyed canvas and other cellulose-containing material of the US army [5]. This species is unique among industrial fungi, as it was known only from this single wild-type isolate ( = QM 6a) for last 50 years, and all mutant strains used in biotechnology today have thus been derived from it. Kuhls et al. [6], however, used molecular characters (internal transcribed spacers 1 sequences of the rRNA gene cluster and RAPD fingerprinting) to conclude that T. reesei was indistinguishable from the pantropical ascomycete Hypocrea jecorina, and suggested that the latter species is its teleomorph. Yet, although H. jecorina is heterothallic [7], the authors were unable to mate T. reesei with wild type isolates of H. jecorina in vitro. Further, Kuhls et al. [6] noted small phenotypic differences between T. reesei QM 6a and wild-type strains of H. jecorina. Consequently, the authors suggested that T. reesei is a clonal derivate from H. jecorina but this argument was not considered in the taxonomic status of the first fungus. Seidl et al. [8] recently described that T. reesei can indeed be crossed with wild-type isolates of H. jecorina, thus rejecting at least one of the above arguments for the clonality of T. reesei.

The progress in molecular evolutionary tools and theoretical concepts for species recognition has recently led to the detection of a continuously increasing number of cryptic species within individual morphological or biological fungal taxa [9][13] including Hypocrea/Trichoderma [14][16]. Recent world-wide sampling has detected a putative anamorph of H. jecorina as being common in soils of South East Asia and particularly in South America [17][19]. The frequent occurence of these strains in soil led us to hypothesize that they may eventually be co-specific with T. reesei, and the latter in fact is not being an anamorph of but a cryptic species to H. jecorina. The attribution of T. reesei to holomorph of H. jecorina has so far been only claimed from identical ITS 1 and 2 sequences, but recent studies have shown that sequences from this locus are unable to distinguish between several closely related Hypocrea/Trichoderma species [15][17].

Here we will show that T. reesei sensu stricto ( = QM 6a) indeed belongs to the holomorphic species H. jecorina, and exhibits a history of recombination and world-wide gene flow, thus rejecting the hypothesis of being a genetically separated agamospecies derived from H. jecorina. In addition, we will also show that strains recently isolated from soils as putative anamorphs of H. jecorina in fact form two sibling species and that at least one of them (T. parareesei nom. prov.) reproduces asexually, and is the result of sympatric speciation in parallel to H. jecorina. Ecophysiological analyses reveal that this sympatric speciation is due to the adaptation to two different habitats.

Results

Sample Design and Genetic Markers

Our sample consisted of 34 strains from teleomorphs and anamorphs (Table 1, already sorted in relation to the results from phylogenetic analysis given below), which were originally identified as H. jecorina or T. reesei both by morphological analysis as well as ITS1 and 2 based oligonucleotide barcode (TrichOKey [17]; online at www.ISTH.info). They covered the whole geographic variability known for these species (South and Central America, Caribbean archipelago, Africa, South Pacific, South East Asia, Macro-and Micronesia and the Indian subcontinent).

Table 1. Strains of H. jecorina sensu lato used in this study.

Taxon C.P.K. strain Nr Other strain Nrs Substratum Origin Mating type (MAT locus) GeneBank Nr
MAT1-1-2/MAT1-1-3 or MAT1-2 tef1 cal1 las1
Hypocrea jecorina 160 G.J.S. 85-236, [6] arecoid palm Indonesia, North Sulawesi 12 GQ354342 GQ354276 GQ354308
1285 G.J.S. 86-408, [6] unknown Brazil, Para 11 n/a GQ354295 GQ354329
1286 G.J.S. 88–6, [6] unknown Brazil, Para 11 GQ354362 GQ354296 GQ354330
1274 C.T.R. 72–94, [6] wood Venezuela 11 GQ354357 GQ354292 GQ354325
170 G.J.S. 86–410, [6] bark French Guiana 11 GQ354346 GQ354280 GQ354312
1273 A.Y.R. 2896, [6] dead log French Guiana 12 GQ354356 GQ354291 GQ354324
1283 G.J.S. 86–403, [6] bark of recently dead tree French Guiana 11 GQ354360 GQ354294 GQ354328
282 G.J.S. 97–177, CBS 102271 [38] fallen twig of Theobroma French Guiana 11 GQ167152/GQ167152 GQ354347 GQ354281 GQ354313
283 G.J.S. 97–178, CBS 102270 [38] fallen twig of Theobroma French Guiana 11 GQ354348 GQ354282 GQ354314
1392 G.J.S. 86–401 unknown Puerto Rico 12 GQ354368 GQ354302 GQ354336
1380 G.J.S. 95–82, CBS 498.97 decorticated wood Puerto Rico n/a GQ354364 GQ354298 GQ354332
1386 G.J.S. 95–2081 bark Puerto Rico 11 GQ354365 GQ354299 GQ354333
1387 G.J.S. 95–2082 bark Puerto Rico 11 GQ354366 GQ354300 GQ354334
1388 G.J.S. 95–123 unknown Puerto Rico 11 GQ354367 GQ354301 GQ354335
1282 G.J.S. 85–249, [6] log Indonesia, North Sulawesi 11 GQ354359 GQ354293 GQ354327
158 G.J.S. 85–229, [6] unknown Indonesia, North Sulawesi 12 GQ354343 GQ354277 GQ354309
159 G.J.S. 85–230, [6] wood Indonesia, North Sulawesi 11 GQ354344 GQ354278 GQ354310
1407 CBS 881.96 unknown Papua New Guinea 11 GQ354369 GQ354303 GQ354337
1127 G.J.S. 93–23, 6] bark New Caledonia 12 GQ354355 GQ354290 GQ354323
1337 G.J.S. 93–22, [6] decorticated wood New Caledonia 12 GQ354363 GQ354297 GQ354331
917 CBS 383.78, QM 6a, [6] cellulose fabrics Solomon Islands 12 GQ167145 Z23012 n/a GQ354321
3418 G.J.S. 06–138 unknown Cameroon n/a GQ354370 GQ354304 GQ354338
3419 G.J.S. 06–140 unknown Cameroon n/a GQ354371 GQ354305 GQ354339
938 G.J.S. 89–7, CBS 836.91, [6] bark Brazil 12 GQ354354 GQ354289 GQ354322
155 G.J.S. 86–404, [6] unknown Brazil, Para 1–1 GQ354345 GQ354279 GQ354311
H.sp. G.J.S. 85–238 1281 G.J.S. 85–238, [6] wood Indonesia, North Sulawesi n/a GQ354358 n/a GQ354326
Trichoderma parareesei nom. prov. 3420 G.J.S. 04–41 soil Brazil n/a GQ354372 GQ354306 GQ354340
3426 G.J.S. 07–26 soil Ghana n/a GQ354373 GQ354307 GQ354341
661, [17] soil Argentina 1–2 GQ354286 GQ354318
665, [17] soil Argentina 1–1 GQ167143/GQ167148 GQ354352 GQ354287 GQ354319
717, [17] soil Mexico 11 GQ167144/GQ167149 GQ354353 GQ354288 GQ354320
634, [17] soil Sri Lanka 1–1 GQ167142/GQ167147 GQ354351 GQ354285 GQ354317
T. sp. nov. C.P.K. 524 523, [19] rotting wood Taiwan 1–1 GQ354349 GQ354283 GQ354315
524, [19] rotting wood Taiwan 1–1 GQ167141/GQ167146 GQ354350 GQ354284 GQ354316

bold font indicates strains isolated from fruiting bodies (teleomorphs), n/a corresponds to not available

A preliminary screening for phylogenetic markers, which were previously used with success in other studies on Hypocrea/Trichoderma (such as tef1, cal1, chi18-5, rpb2 or act1 [15][17], [20]), showed that only the 4th intron of tef1 and the 2nd and 3rd introns of cal1 provided sufficient phylogenetic information. Coding regions such as chi18-5 or act1 provided insufficient polymorphism (data not shown). We therefore searched for additional genes with long introns and tested their ability to differentiate within H. jecorina. One locus fulfilling this requirement is the las1 gene (fgenesh5_pg.C_scaffold_1000016), which encodes the orthologue of an essential nuclear protein regulating bud formation and morphogenesis in Saccharomyces cerevisiae [21]. It is interrupted by four introns, of which the second (307 nts) was selected as the phylogenetic marker (Fig. 1).

Figure 1. Structure of the las1 locus in H. jecorina/T. reesei.

Figure 1

Intron-exon structure of the las1 locus in H. jecorina/T. reesei and position of PCR primers as inferred for T. reesei QM 6a.

Sequencing of tef1, cal1 and las1 for the whole strain sample provided 1241 nts, of which 1098 were constant sites and 109 polymorphic characters were parsimony-informative (49 in tef1, 38 in las1 and 22 in cal1, respectively). Nucleotide characteristics of the three genes are shown in Table 2.

Table 2. Nucleotide properties of phylogenetic markers and MCMC parameters.

Parameters phylogenetic marker
tef1 las1 cal1 concatenated dataset
Fragment characterization intron exon/intron exon/intron not applicable
Number of sequences 33 33 33 33
Number of characters 509 377 355 1241
parsimony informative 18 9 7 34
constant 442 330 326 1098
Parameters of MCMC analysis
Mean nt frequencies* A/C/G/T 0.21/0.32/0.22/0.25 0.20/0.24/0.34/0.22 0.24/0.28/0.29/0.19 0.22/0.28/0.27/0.23
Substitution rates* A <-> C 0.02 0.09 0.08 0.09
A <-> G 0.89 0.22 0.17 0.29
A <-> T 0.01 0.19 0.16 0.1
C <-> G <0.01 0.08 0.06 0.04
C <-> T 0.03 0.37 0.40 0.31
G <-> T 0.04 0.06 0.13 0.17
alpha* 0.10 0.10 0.08 0.05
MCMC generations, million/number of runs 1/2 1/2 1/2 2/2
PSRF* 1.00 1.00 1.00 1
Number of chains/Temp (λ) 4/0.2 4/0.2 4/0.2 4/0.2
Sampling frequency 100 100 100 100
Number of discarded first generations 600 400 500 800
Total tree length 3.19 5.79 6.05 0.43

*as estimated after GTR MCMC sampling and burning.

Molecular Phylogeny of H. jecorina Sensu Lato

We used Bayesian phylogenetic analysis of both the concatenated as well as individual gene data sets to test for a phylogenetic structure within H. jecorina sensu lato (Fig. 2 and Fig. S1). One single teleomorph isolate from North Sulawesi, Indonesia (C.P.K. 1281 =  G.J.S. 85–238 - CBS 638.92), which was described as H. jecorina by Kuhls et al. [6] and Samuels et al. [22], consistently formed a single branch separated from all other clades in the tef1, las1 and cal1 trees (data not shown) indicating that it represents a still undescribed species outside the H. jecorina sensu lato clade. Thus, we named it as H. sp. nov. G.J.S. 85–238 and excluded it from further analyses. The remaining 33 isolates formed three significantly supported clades in all single gene trees as well as in the combined phylogram, thus fulfilling the criteria of the genealogical concordance phylogenetic species recognition concept [23], [24] which recognizes a clade as an evolutionary lineage if its separation is supported by at least two gene trees and not contradicted by the others. One of the obtained clades contained all the teleomorph isolates and also the original isolate of T. reesei. As the type strain of H. jecorina (specimen No. 989 of the Berkeley and Broom collection from Ceylon at Kew, UK) is not available for molecular analysis, we rely on the attribution of all these strains to the above taxon by Samuels et al. [22] and recognize this clade as a holomorph H. jecorina/T. reesei sensu stricto.

Figure 2. Molecular phypogeny of H. jecorina sensu lato.

Figure 2

Bayesian circular phylogram inferred from the concatenated dataset of tef1, cal1 and las1 phylogenetic markers. Symbols at nodes correspond to posterior probabilities (PP) >95%. Filled circles correspond to PP in the concatenated tree, open stars, squares and polygons to PP in las1, cal1 and tef1 gene trees, respectively. The corresponding phylograms are given in Figure S1. The color code indicates the geographic region from which the isolates were obtained, as explained in the right top inset.

The next large clade contained all strains that were isolated from soil as anamorphs (Fig. 2). Since T. reesei was not clustered in this clade we call it T. sp. nov. ‘parareesei nom. prov.’ (for simplicity T. parareesei nom. prov.) throughout the manuscript, assuming that its formal taxonomic description will soon be published elsewhere. Two isolates (C.P.K. 523 and C.P.K. 524), collected from tree bark in Taiwan formed a separate branch in all of these trees and are therefore recognized as another phylogenetic species T. sp. nov. C.P.K. 524, whose formal description will be possible when additional isolates become available.

Geographic Distribution of H. jecorina and T. parareesei Nom. Prov

Our sample shows that both H. jecorina and T. parareesei nom. prov. are cosmopolitan species (Fig. 2), yet restricted to a narrow latitudinal belt around the equator (±20°). They must therefore be considered to be sympatric species, particularly in Central and South America. In order to test, whether the gene sequences would reveal some intraspecific geographic separation within H. jecorina, we determined the FST values for pairwise combinations of strains from different locations (e.g. Caribbean vs. Indopacific, South American vs. Africa etc.). However, the FST values were within 0.011–0.024 for all combinations (data not shown), thus documenting a high rate of exchange of genetic material over these wide geographic distances, and no evidence for geographic segregation.

In vitro Mating between and within H. jecorina and T. parareesei Nom. Prov

The mating type loci of the heterothallic species H. jecorina have recently been identified and conditions for successful mating have been established [8]. We thus tested whether the two newly recognized species would contain one of the two mating types of H. jecorina. Using primers within conserved regions of the genes mat1-1-1, mat1-1-2, mat1-1-3 (indicative for a MAT1-1 mating type locus, Fig. 3A) and mat1-2-1 (indicative for a MAT1-2 locus, Fig. 3A), we in fact identified that all isolates of T. parareesei nom. prov. have a MAT1-1 locus except C.P.K. 661 from northern Argentina, which has a MAT1-2 locus (Table 1). Both isolates of T. sp. C.P.K. 524 also possess a MAT1-1 locus. RFLP of the complete mating type loci in comparison with H. jecorina confirmed the segregation of all three species in three and two different haplotypes of MAT1-1 and MAT1-2 respectively (Fig. 3B). Although most of the SNPs of the mating type loci of T. parareesei nom. prov. and T. sp. C.P.K. 524 were silent mutations, only the amino acid sequence of MAT1-1-2 of T. parareesei nom. prov. was identical to that from H. jecorina, whereas it was polymorphic in three positions in T. sp. C.P.K. 524. The amino acid sequence of the MAT1-1-3 protein of T. parareesei nom. prov. differed in two residues from that of H. jecorina including one case where the helix breaker P was exchanged by a polar S residue. The most significant difference was observed in MAT1-2-1, which contained a PS insertion (Fig. S2). Thus these data demonstrate that the mating type proteins from T. parareesei nom. prov. have undergone alterations which may have affected their functionality.

Figure 3. The mating type loci of H. jecorina.

Figure 3

(A) Schematic presentation of the mating type loci MAT1-1 and MAT1-2 and their flanking regions based on the H. jecorina data [8]. Primers used to amplify the complete MAT-loci are indicated by gray arrows and primers for fragments of the mating type genes (Table 4) by black arrows. Numbers correspond to the respective proteins IDs in the T. reeesei genome database. (B) Restriction fragment patterns of the mating type loci, amplified with primers aF and aR (Table 4) and digested with PstI. MM, molecular marker (GeneRuler 1 kb ladder, Fermentas). The strains and their respective mating types are indicated as C.P.K. numbers. Small colored arrows show either present (filled) or absent (open) bands in RFLP profiles of C.P.K. strains in respect to the reference strains of H. jecorina for MAT1-1 and MAT1-2 [8].

The availability of two mating types for T. parareesei nom. prov. provided us with the possibility to test whether these isolates already developed an infertility barrier to H. jecorina, and if they would still be able to mate with each other. Therefore, selected isolates of H. jecorina and T. parareesei nom. prov. carrying the MAT1-1 and MAT1-2 locus respectively, were subjected to pairwise crossing experiments on plates under daylight conditions (indicated by arrows on Fig. 4). Only the heterothallic strain pairs belonging to H. jecorina indeed produced either mature fruiting bodies or primordia within 6–12 weeks of incubation, whereas all other combinations did not mate, even after further prolonged incubation time. These data are consistent with the conclusion that – at least in vitro - T. parareesei nom. prov. is unable to cross with H. jecorina, and is also not capable of sexual reproduction with the opposite mating partner of itself.

Figure 4. Recombination analysis of H. jecorina and T. parareesei nom. prov.

Figure 4

Reconstruction of possible recombination networks build using the split decomposition method applied to the concatenated dataset (tef1 + cal1 + chi18-5). Upper shape: H. jecorina, low shape: T. parareesei nom. prov. Open and filled symbols at OTUs indicate MAT1-1 and MAT1-2 mating types respectively. Gaps were treated as missing characters throughout. All networks have been calibrated to fit one scale. The color scheme shows geographic origin of the strain as indicated in Fig. 2. Results from the PHT and Phi tests are shown by arrows and the respective P values, ‘rec +’ specifying positive recombination result and ‘rec -’specifying no recombination detected. PHT indicates the result of partition homogeneity test, Phi corresponds to results of Phi test. Double ended arrow lines show successful (solid line) and failed (dashed line) crossings.

In silico Analysis of Reproduction Strategies of H. jecorina and T. parareesei Nom. Prov

The results of mating experiments, the visual inspection of tree topologies (Fig. 2 and Fig. S1) and eventually the origin of strains (as teleomorph or anamorph, respectively) lead to the assumption that only H. jecorina performs sexual reproduction, whereas T. parareesei nom. prov. would be a clonal taxon ( = agamospecies). In order to investigate this by means of sequence analysis we first used the split decomposition method [25], [26] to test for the presence of network relationships in H. jecorina and T. parareesei nom. prov., using a concatenated dataset of tef1, cal1 and las1. This method presents conflicting phylogenetic data, presumably arising from recombination, as an interconnected network of lineages. As shown in Fig. 4, such a network was evident within H. jecorina ( = the strains isolated as teleomorphs and T. reesei) whereas it was absent within T. parareesei nom. prov. We especially note that the ex-type strain of T. reesei was tightly linked to the H. jecorina network, thus arguing against its origin as a clonally separated isolate.

We then used the partition homogeneity test (PHT; [27], [28]) to examine the congruence between individual gene trees. This test produces artificial datasets by multiple (10 000) re-sampling and random swapping of observed datasets and subsequent construction of maximum-parsimony trees for every newly sampled ‘gene’ sequence. For clonally reproducing populations ( =  no sexual recombination), the sums of the lengths of the gene trees for the observed and re-sampled data should be similar. However, under recombination the sums of the tree lengths should be longer than those for the actual data because of introduction of homoplasy into unlinked sites. This test confirmed our analysis of topologies of single locus trees - the clades containing T. parareesei nom. prov. showed congruence of all three loci suggesting the clonality of this species (Fig. 4). The topologies of H. jecorina subclades appeared to be not concordant between individual trees, providing the evidence for recombination (Fig. 4).

As another means, we used the index of association (IA) test on a subset of ‘clone corrected’ data (i.e. individuals with identical alleles of the three loci were excluded so that each haplotype was represented only once; cf. [29]). In this test, complete panmixia (sexual compatibility resulting in recombination) would be indicated by a value of 0 ( = the null hypothesis). This value was neither obtained with the complete dataset nor with any of the individual clades (data not shown).

Consistent with the occurrence of teleomorphs H. jecorina clade gave a significantly lower value (0.014, P = 0.006), whereas strains of T. parareesei nom. prov. completely rejected the null hypothesis of recombination (1.060, P = 0.126).

Finally we applied the Phi-test, which uses the pairwise homoplasy index (PHI, Φ) to detect refined incompatibility [30]. This method assumes the infinite sites model of evolution in which the detection of incompatibility for a pair of sites indicates recombination. Application of this test to H. jecorina did find statistically significant evidence for recombination (P≪0.001) while it was not the case for T. parareesei nom. prov. (P = 1). Since the Phi-test is a very robust means which can detect recombination even in the presence of recurrent mutation, we decided to use this method to define the borders of recombining populations. To this end, we first detected a non-recombining subsample consisting of six most terminal strains of H. jecorina (C.P.K. 160 and 1282 from Indonesia, C.P.K. 155 and 938 from Brazil, C.P.K. 3419 from Cameroon and C.P.K. 1273 from Pacific; P = 0.34), and then gradually added strains from two other phylogenetic species until evidence for recombination was detected (P<0.05). No recombination was detected between T. parareesei nom. prov. and H. jecorina. In contrast, a positive recombination signal (P = 0.012) was obtained when both strains of T. sp. C.P.K. 524 were tested together with the above listed subset of H. jecorina. It suggests that T. sp. C.P.K. 524 may also reproduce sexually but the current sample is too small to reveal it.

Thus the four alternative tests suggest that T. parareesei nom. prov. is an agamospecies which did not undergo sexual recombination in its recent evolutionary history.

Ecological Specialization of H. jecorina and T. parareesei Nom. Prov

The fact that H. jecorina and T. parareesei nom. prov. evolved in sympatry raises the question about the differences in their ecological niches. Since both fungi are saprotrophs, we tested whether they would differ in their carbon metabolism, response to environmental stimuli or antagonistic ability against other fungi.

Carbon utilization

With respect to carbon metabolism, H. jecorina and the two new species exhibited qualitatively very similar carbon source utilization profiles. The full scale profile will be published elsewhere alone with the formal description of the new species; the list of carbon sources is in Table S1 and in Druzhinina et al. [31]. On a quantitative basis, T. parareesei nom. prov. and T. sp. C.P.K. 524 generally exhibited faster growth rates on so-called “Cluster I” carbon sources, i.e. the ones which provide fastest growth (such the chitin monomer n-acetyl-β-d-glucosamine or the hemicellulose monomers l-arabinose, d-xylose, d-galactose and corresponding polyols; cf. [31]), and also displayed a broader intraspecific variation (Fig. 5A). In contrast, the majority of H. jecorina strains showed a much more conserved quantitative pattern of growth on these carbon sources, yet with a significantly lower growth rate (except C.P.K. 938 and C.P.K. 160). Thus, we conclude that T. parareesei nom. prov. has become more versatile and efficient in the utilization of its preferred carbon sources.

Figure 5. Carbon source utilization by H. jecorina, T. parareesei nom. prov. and production of extracellular cellulases.

Figure 5

(A) Results of the single linkage cluster analysis (Pearson distance) applied to strains and based on growth on 95 carbon sources and water (Biolog FF MicroPlate ™) inferred from optical density values at 750 nm after 48 hours of incubation (linear growth stage) under ambient illumination conditions. (B) Volumetric cellulase activity of H. jecorina and T. parareesei nom. prov. Bars correspond to the average values per species and control strains with standard deviations (vertical lines), circles show the values obtained for individual strains. Control corresponds to cellulase overproducing and cellulase negative mutant strains QM 9414 and QM 9978 respectively, both derived from T. reesei QM 6a.

Consistent results were obtained when the experiment was repeated with carbon sources typical for soil (EcoPlate™; Biolog Inc., Hayward, CA, USA, see Table S1 for individual carbon sources). Although the growth of both species on EcoPlates was slower than in the experiment above, the results confirm that in general T. parareesei nom. prov. is more competent in utilizing these carbon sources (ANOVA, F(1, 133) = 38.32, P = 0.000).

Since the only known anamorphic strain of H. jecorina - T. reesei QM 6a is a model fungus for cellulase formation, we tested whether the superiority of T. parareesei nom. prov. in carbon assimilation would also be reflected in this trait. We therefore tested 10 randomly chosen strains of H. jecorina and five strains of T. parareesei nom. prov., and included the cellulase twofold-overproducing and the cellulase negative mutants QM 9414 and QM 9978 respectively (Fig. 5B). The results show that both species contain extremely efficient cellulase producing strains which gave values close to that of QM 9414. For H. jecorina these were two strains isolated from Brazil (C.P.K. 938 and C.P.K. 155); for T. parareesei nom. prov. these are also South American C.P.K. 661 and C.P.K. 665 isolated from northern Argentina. Interestingly, three strains of H. jecorina showed no cellulase activity, while all strains of T. parareesei nom. prov. were efficient producers. Analysis of variance, however, did not detect any statistically significant difference between two species (ANOVA, P>0.05). This suggests that the ability to produce cellulases for the degradation of cellulose in the environment has been maintained in both species.

Photosensitivity

Light sensing is an important mechanism in the ecophysiological adaptation of fungi as it is strongly involved in regulation of their reproduction. Seidl et al. [6] reported that light is important for formation of perithecia of H. jecorina. Friedl et al. [32] demonstrated that light plays the role in the conidiation of H. atroviridis. Our recent studies have shown that light influences the mycelial growth of Hypocrea but the effect varies depending on the species: temperate H. atroviridis is strongly stimulated by illumination [33] while mutant strains derived from tropical T. reesei are frequently photoinhibited [34]. Thus, photosensitivity may reflect the ecological niche of the fungus.

Because of the differences in carbon assimilation, we reasoned that the response to light may also be different in H. jecorina and T. parareesei nom. prov. We thus incubated Biolog FF MicroPlates either in complete darkness or under the conditions of day light (May-June, N 48°) for 72 hours and compared the data (Fig. 6). Indeed, all strains of H. jecorina show their best growth rates in darkness, which is basically not changed by exposure to light. We have detected about 10 cases of photoinhibition (on individual carbon sources, see Fig. 6), which were strain- but not species-specific. Growth of only one strain, C.P.K. 160, was considerably stimulated by light on several carbon sources (for example, d-cellobiose, d-mannitol, gentiobiose, d-trehalose, maltotriose and l-fucose). In contrast, the best growth of the majority of T. parareesei nom. prov. (all possessing the MAT1-1) was under illumination indicating that this species is not capable of normal growth in darkness (Fig. 6). No cases of photoinhibition were detected for T. parareesei nom. prov. These data show a striking difference in physiological adaptation of two species and confirm that although they are sympatric they have different ecological niches. The detection of photostimulation in T. parareesei nom. prov. is particularly interesting as all its strains were isolated from soil.

Figure 6. Photosensitivity map of H. jecorina and T. parareesei nom. prov.

Figure 6

Photosensitivity map of H. jecorina and T. parareesei nom. prov. constructed based on the two way joining cluster analysis. Framed squares show growth under conditions of sun light: white, black and grey frames correspond to photoinhibition, photostimulation and neutral photoresponse respectively. Bold font used for carbon sources indicates those which supported conidiation of H. jecorina (left list) and T. parareesei nom. prov. (right list) respectively.

Conidiation

H. jecorina has a complete holomorphic life cycle and forms both conidia and ascospores, while propagation of T. parareesei nom. prov. is dependent on the distribution of its mitospores. A visual inspection of cultures indicated that T. parareesei nom. prov. conidiates essentially more intensively than the mycelial forms of H. jecorina which leads to the striking difference in culture morphology (data not shown). Since conidiation is carbon source dependent [33], we tested it on 95 carbon sources. The results show that in total H. jecorina conidiates only on 7 out of 95 carbon sources (6 of those shown on Fig. 6, see the corresponding legend) while T. parareesei nom. prov. forms mitospores on 62 carbon sources (36 of those shown on Fig. 6). A quantification of conidial density per cm2 of a MEA plate showed that on an average H. jecorina formed 3.6 (±1.78)×106 per 10 tested strains, while the six available strains of T. parareesei nom. prov. produced an average of 16.05 (±4.8)×106 conidia under the same conditions.

Antagonistic potential against soil competent and epigeal plant pathogens

Species of Hypocrea/Trichoderma are renowned for their mycoparasitic behaviour [1]. In order to test whether the two species may also differ in their antagonistic abilities, we have selected five plant pathogenic fungi which differ in their primary habitat: Sclerotinia sclerotiorum and Fusarium oxysporum (FOX, F. oxysporum species complex) representing soil competent mycobionts; and F. xylarioides, Alternaria alternata and Botrytis cinerea representing pathogens of green plant tissue and thus predominantly epigeal fungi. Fig. 7 shows the summary of dual confrontation tests assessed after 10 days of co-cultivation on MEA medium. H. jecorina is able to considerably inhibit growth of S. sclerotiorum, A. alternata and B. cinerea. The latter plant pathogen was so completely combated by H. jecorina C.P.K. 160 and C.P.K. 1127 that its mycelium was overgrown and killed. No antagonism to both Fusarium species by H. jecorina was detected. Strains of T. parareesei nom. prov. showed a conserved pattern of mycoparasitic activity with almost no variation among strains, and they also exhibited a superior antagonistic potential against S. sclerotiorum, B. cinerea and particularly A. alternata. T. sp. C.P.K. 524 behaved similar to T. parareesei nom. prov. except that it was the most resistant strain against the isolate of FOX used. We should like to stress that the in vitro dual confrontation tests are only an indirect means to assess antagonistic potential of the fungus. However, the significant difference shown between H. jecorina and T. parareesei nom. prov. suggests that the former is only a moderate mycoparasite with significant variation among isolates, whereas the latter species may exhibit a stronger antagonistic potential against all epigeal fungi tested (Fig. 7).

Figure 7. Mycoparasitic ability of H. jecorina and T. parareesei nom. prov.

Figure 7

Results of dual confrontation tests between Trichoderma strains (inoculated on the left side) and the plant pathogenic fungi (inoculated on the right side): Sc–Sclerotinia sclerotiorum, FOX–Fusarium oxysporum complex, Fx–F. xylarioides, Alt–Alternaria alternata, Bot–Botrytis cinerea. Roman numbers indicate the weak (I), moderate (II), strong (III) and very strong (IV) ability of Trichoderma to inhibit the growth of the prey fungus. The ability to overgrow the mycelium of prey fungi is given in Arabic numbers on the similar scale. Antagonistic potential is calculated as the mean value for a strain to combat all five pathogens. The dashed lines correspond to the center position between confronted fungi.

Discussion

T. reesei QM 6a has been a taxonomic riddle. Originally isolated in 1942, it was a victim of then almost undeveloped taxonomy for Trichoderma. Therefore it was first determined to be T. viride (because the genus was in that time believed to consist only of this single species [35]), and later on recognized as a unique species and named in honor of its detector Elwyn T. Reese T. reesei [36]. Bissett [37] then revised it as being co-specific with T. longibrachiatum. Finally, it was recognized to be identical to the pantropical ascomycete H. jecorina [6], which was itself just distinguished as a separate tropical species closely related to H. schweinitzii [22]. Yet small morphological differences and the inability of these authors to cross it with other H. jecorina isolates in the lab led Kuhls et al. [6] to assume that it is actually a clonally derived asexual form of H. jecorina.

The present data have clearly rejected this hypothesis: our analysis shows that the original isolate T. reesei QM 6a reveals a history of recombination similar to that of the teleomorphic isolates of H. jecorina. These findings are also supported by our recent discovery that T. reesei QM6a is a MAT1-2 idiotype and can indeed be crossed with MAT1-1 partners of H. jecorina [8]. Previous failures to obtain crossing is therefore likely due to the use of the incorrect mating type partner or inappropriate experimental conditions. T. reesei clearly is an isolate identical to H. jecorina, and the minor differences in anamorph morphology [6] and nutrient assimilation [38] to other (more recent) isolates of H. jecorina are likely the result of its maintenance in the laboratory for the last 65 years.

A large number of studies have shown that fungal taxa which were defined on the basis of consistent invariant morphological features in fact contain multiple, well differentiated phylogenetic species [9], [12][15]. Here we provide a further example for this growing list, the pantropical ascomycete H. jecorina, and show that the 33 strains that were available for this study actually consist of not less than four different species, i.e. H. jecorina, T. parareesei nom. prov., T. sp. nov. C.P.K. 524 and H. sp. nov. G.J.S. 85–238. The formal taxonomic description of T. parareesei nom. prov. will be published elsewhere (L. Atanasova, W.J. Jaklitsch, C.P. Kubicek, and I.S. Druzhinina, manuscript in preparation) but we will refrain from describing the other two phylogenetic taxa based on the small number of strains. Taxonomies with arbitrarily named fungal species (T. parareesei nom. prov. in the present case) have frequently been published [11][14] and enable researchers to communicate effectively before the formal species nomenclature has been established [9].

H. jecorina yielded evidence for sexual recombination even via a large distance and geographic barriers, thus indicating the presence of a very efficient system for transfer of spores, and/or of the fungus itself (e.g. via wood logs, insects etc.). On the other hand, the same tests clearly rejected this possibility for T. parareesei nom. prov. Thus, these two species represent a diverged species pair, similar to H. orientalis and T. longibrachiatum [15].

Our findings show that those strains of H. jecorina, which were recently isolated as anamorphs from soil and litter and identified as H. jecorina by morphological analysis and molecular barcodes [17] are in fact a cryptic agamospecies, T. parareesei nom. prov. It is very intriguing in this regard that this sibling anamorphic sister species of H. jecorina is similarly restricted to the same narrow belt of±20° altitude around the equator, and otherwise similarly pantropical. It consequently represents a rare example of sympatric speciation (i.e. the evolution of reproductive isolation between co-distributed populations) of a saprotrophic fungus [39].

One of the most obvious reasons for such a divergent speciation resulting in formation of an agamospecies would be a mutation in a gene required for sexual reproduction. In such a scenario T. parareesei nom. prov. would have arisen from its ancestor because of a loss of a subpopulation ability to mate. However, our data reject this hypothesis as in such a case all strains of the anamorphic population should have the same mating type. The possession of both MAT1-1 and MAT1-2 loci, although unevenly distributed in our (small) sample, suggest the operation of other speciation mechanisms. The other indirect argument against altered mating mechanism as the driving force for speciation comes from the analysis of topologies of phylogenetic trees. If T. parareesei nom. prov. would have arisen as an agamospecies by a sudden loss of its ability to sexually recombine, its gene sequences should display lower evolutionary rates compared to H. jecorina. In other words the length of the branch leading to T. parareesei nom. prov. from the hypothetical ancestor of both species should be then shorter than the one leading to H. jecorina. However, the individual trees presented here as well as the analysis of an exon of the gene coding for RNA polymerase subunit B II (C.P. Kubicek, I.S. Druzhinina, unpublished data) revealed similar genetic distances between H. jecorina and T. parareesei nom. prov. from their hypothetical ancestor respectively.

The currently most favored explanation for reproductive isolation postulates that hybrid inferiority is caused by antagonistic epistasis between incompatible alleles at interacting loci [40][42]. Theoretical models have shown that sympatric speciation may occur when the same genes control both mating and habitat preference or fitness [43]. Our data would be compatible with this hypothesis: growth and conidiation of MAT1-1 strains of T. parareesei nom. prov.–in contrast to H. jecorina - are stimulated by intensive illumination, whereas the MAT1-2 strain behaves similarly to H. jecorina. Evidence for regulation of both mating and carbon source utilization by the blue light has previously been obtained [32][34] demonstrating that sexual reproduction and carbon assimilation may indeed share the same regulatory circuits. The availability of further MAT1-2 strains of T. parareesei nom. prov. will help to differentiate between the effect of mating type loci and ecophysiological divergence of two species.

Sympatric speciation is well known from the evolution of plant and human pathogenic fungi [39], but has not been reported for non-pathogenic saprotrophs like Hypocrea/Trichoderma. In this work we applied a bioinformatic sequence analyses and ecophysiological characterization to obtain some insights into the forces thriving speciation in H. jecorina and T. parareesei nom. prov. We have analyzed the global versatility of their carbon metabolism, response to light, conidiation intensity and mycoparasitic potential (for a summary see Table 3). The differences detected are indeed striking and reveal that T. parareesei nom. prov. and H. jecorina occupy different ecological niches in the vertical profile of the tropical forest. T. parareesei nom. prov. displays all the properties of an environmental opportunist: it shows faster growth on a wider spectrum of carbon sources than H. jecorina, and produces a much higher number of propagules on a greater variety of carbon sources. The species is also able to strongly compete with other mycobionts and is mycoparasitic on the epigeal plant pathogenic fungi tested. The latter fact, combined with its profound photostimulation of conidiation, allows us to speculate that T. parareesei nom. prov. might occupy an ecological niche connected with photosynthesizing parts of higher plants, i.e. the canopy of the tropical forest.

Table 3. Comparative ecophysiology of H. jecorina and T. parareesei nom. prov.

H. jecorina T. parareesei nom. prov. Reference
Known substrata
teleomorph wood deris n. a. Table 1
anamorph unknown Soil Table 1
Phenetic profile
growth rate moderate Fast
carbon metabolism invariable variable Fig. 5A
cellulase secretion variable to high high Fig. 5B
soil competence low moderate
extracellular yellow pigmentation strong weak Fig. 7
photosensitivity reaction insensitive to inhibited stimulated Fig. 6
photoadaptation to darkness illumination
Conidiation
density (per cm2) (36±17.8)×105 (160.5±47.7)×105 n. a.
carbon sources supporting conidiation (out of 95) 7 62 Fig. 6
formation rate low High
Antagonistic potential
against soil fungi low to moderate moderate to strong Fig. 6
against epigeal fungi moderate strong

n.a. corresponds to not applicable

H. jecorina in turn seems to be a specialized on a narrow habitat, where its surviving strategy mainly relies on the advantages of sexual reproduction. The species has definitely reduced conidiation efficiency (compared for the general mean for the genus, I.S. Druzhinina, personal observations) and is less aggressive against potentially competing fungi. It is remarkable that the quantitative pattern of carbon metabolism of H. jecorina is highly conserved (with exception of two fast growing strains, Fig. 5A) which may indicate its nutritional specialization. The fact that its anamorph has only very rarely been found in its natural environment [38] further supports the hypothesis that this species is strongly specialized. In our own work on the assessment of the general Hypocrea/Trichoderma biodiversity, we failed to encounter H. jecorina in an asexual form in more than 1000 samples, collected worldwide from soil and litter. It is probable that asexual reproduction in H. jecorina - like it apparently occurred in the case of the original strain of T. reesei and the three strains described in [38] - can be observed only under certain conditions or in certain habitats. Yet the origin of the anamorphic strains G.J.S. 97–177 (CBS 102271) and G.J.S. 97–178 (CBS 102270) both found on dead cacao brooms in Brazil, and G.J.S. 97–38 (CBS 999.97), from soil at a storage lake in French Guiana [38] does not provide a hint towards ecological adaptation of the species. Moreover details of the environment at the US Army camp in Guadalcanal during WW II, where and when T. reesei QM 6a was originally isolated, are also not available. Further samplings in tropical regions may eventually disclose the habitat of one of the most prominent producer in biotechnology.

Methods

Material Studied

The strains, their origin and the sequence accession numbers used in this work are listed in Table 1. The isolates are stored at −80°C in 50% glycerol in the laboratory of Vienna University of Technology (TUW). Strains are grouped according to their identification in the present work. For convenience, TUW-lab codes (C.P.K.) are used for the strains throughout, but other collection numbers are also listed in Table 1.

Molecular Genetic Analysis

DNA extraction, PCR amplification and sequencing

Mycelia were harvested after 2–4 days of growth on MEA at 25°C and genomic DNA was isolated using QIAGEN DNeasy® Plant Mini Kit following the manufacturer's protocol. Amplification of nuclear rRNA gene cluster, containing the ITS1 and 2 and the 5.8S rRNA gene, and of fragments of tef1 (translation elongation factor 1-α) and cal1 (calmodulin) was performed as described previously [15]. The las1 gene (fgenesh5_pg.C_scaffold_1000016), which encodes the orthologue of an essential nuclear protein regulating bud formation and morphogenesis in S. cerevisiae [21] was amplified using primers given in Table 4. PCR amplification was carried out in an i-cycler (BIO-RAD, USA) for 30 cycles of 94°C for 1 min denaturing, 58°C for 1 min annealing, and 74°C for 50 sec extension. Initial denaturing was at 94°C for 1 min.and the final extension was at 74°C for 7 min. PCR amplification of the mating type loci and the mating type genes was carried out as described [8]. The primers used for MAT1 loci are listed in Table 4. PCR fragments were purified (PCR purification kit, Qiagen, Hilden, Germany), and sequenced at MWG (Ebersberg, Germany).

Table 4. Selected PCR primers used in this study.
Gene or locus Primer pair Sequence (5′-3′)
Las1 LAS1 fw CATCGACGTATGCTGTGAGG
LAS1 rev CTTGGCGATGGAGTACATGC
MAT1-1 and MAT1-2 aF CATCGAAGCATCTACCTACTTG
aR CGAAGCGAAACACACGAC
mat1-1-1 m1-1F TCCTCTCAATGCGTTCATGGC
m1-1R AGAAGATCATTCTCTGTGTTGGGA
mat1-1-2 m2-1F CTCGAGAGGGATATACACCAG
m2-1R CTTCCTACACGGATGCCAGA
mat1-1-3 m1-3F ATCTCCATGTCTTTATTCCCGAAG
m1-3R CTTGTAGTCGGGATATTTCTCC
mat1-2-1 m2-1F GCGCACCACGGTATTTCATTG
m2-1R ATTTGCGCGGCTTGTATTGG

Phylogenetic analysis

For the main phylogenetic analysis DNA sequences were aligned with Clustal X 1.81 [44] and then edited using GeneDoc 2.6 [45]. The possibility of intragenic recombination, which would prohibit the use of the respective loci for phylogenetic analysis, was tested by linkage disequilibrium based statistics as implemented in DnaSP 4.50.3 [46]. The neutral evolution of coding fragments (cal1 and las1) was tested by Tajima's test implemented in the same software. The interleaved NEXUS file was formatted using PAUP*4.0b10 [47]. The best nucleotide substitution model for the each locus was determined using jMODELTEST [48]. As Akaike and Bayesian Information criteria (AIC [49] and BIC [50] respectively) selected different nucleotide substitution models for every locus and due to the relatively small size of individual datasets (1242 characters per 34 sequences for the biggest) the unconstrained GTR + I + G substitution model was applied to all sequence fragments (Table 2). Metropolis-coupled Markov chain Monte Carlo (MCMC) sampling was performed using MrBayes v. 3.0B4 with two simultaneous runs of four incrementally heated chains that performed 5 million generations. The length of run (number of generations) for each dataset was determined using AWTY graphical system [51] to check the convergence of MCMC. Bayesian posterior probabilities (PP) were obtained from the 50% majority rule consensus of trees sampled every 100 generations after removing the first trees using the “burnin” command. Number of discarded generations was determined for each run based on visual analysis of the plot showing generation versus the log probability of observing the data. PP values lower than 0.95 were not considered significant while values below 0.9 are not shown on the resulting phylograms. Model parameters summaries after MCMC run and burning first samplings as well as nucleotide characteristics of used loci are collected in Table 2.

Detection of recombination

he congruence or incongruence of the three gene genealogies was used to infer recombination between isolates. To this end, three different tests were employed: the incongruence length difference/partition homogeneity test (ILD/PHT) [27], [28] using a score of P<0.05 to reject the null hypothesis of congruence between loci; the Index of Association (IA) test [29], in which the data were compared to the IAs of artificially recombined datasets; and the Phi-test implemented in SplitsTree [26], which uses the pairwise homoplasy index, PHI ( =  Φ) statistic, to detect refined incompatibility indicating recombination [30].

In addition we applied split decomposition implemented in the SplitsTree program, version 4.0 [25], [26], using pairwise distances under the Kimura 3ST model [52].

Mating type RFLP analysis

The ca. 10 kb large PCR fragments of the complete MAT-loci and their flanking regions were digested with PstI (Fermentas, Burlington, Canada). Sequences of H. jecorina MAT1-1 and MAT1-2, derived from strain C.P.K. 2189 (CBS 999.97, [6], [8], [38]) were used as reference strains in the mating experiments.

Ecophysiological Characterization

Phenotype profiling

The carbon assimilation patterns were investigated using Biolog FF MicroPlate™ and EcoPlate™ (Biolog Inc., Hayward, CA, USA) according to the protocol published recently [31]. The complete lists of carbon sources implemented in both plates are given in Table S1. Briefly, strains were grown on 3% malt extract agar (MEA), and 90 µl of a conidial suspension from them (75±2% transmission at 590 nm) was dispensed into each of the wells of a corresponding Biolog microplate. Inoculated microplates were incubated at 28°C, and optical density (O.D.) determined after 12, 18, 24, 36, 42, 48, 66 and 72 h at 750 nm. Analyses were repeated at least three times for each strain.

In order to estimate the effect of illumination on mycelial growth and conidiation the protocols of Friedl et al. [32], [33] were used respectively. Biolog FF MicroPlates were incubated either at natural day light (May-June, N 48°), while plates for darkness experiment were not exposed to any light source in between the measurements. Biolog EcoPlates were incubated in darkness.

Data exploratory statistical analyses were performed using Statistica 6.1 (StatSoft, Inc., Tulsa, OK, USA) data analysis software system.

Antagonistic potential

To assess the antagonistic potential of anamorphic cultures of H. jecorina five potential prey fungi have been selected: Sclerotinia sclerotiorum C.P.K. 3593 and FOX (Fusarium oxysporum species complex, strain C.P.K. 1842) to represent soil and rhizosphere competent pathogens and F. xylarioides C.P.K. 3453, Alternaria alternata C.P.K. 3594 and Botrytis cinerea C.P.K. 3592 to represent epigeal plant pathogens. Potential prey fungi were inoculated as agar blocks of the standard size always 1 cm from the edge of the Petri plate and pre-cultivated on 3% PDA in darkness at 25 C. Then similar agar blocks with Trichoderma cultures were introduced on the opposite side of the plate and cultivated for 10 days. Antagonistic potential was semi-quantified based on both ability to inhibit the growth of a pathogen and ability to overgrow the mycelium of the pathogenic fungus. One of 5 phases for each confrontation was recorded: 0–no inhibition; I - started to inhibit; II - clear signs of inhibition; III - mostly or strongly inhibited; IV - totally inhibited. The ability to overgrow was based on the same scale but recorded using Arabic numbers.

Quantitative and qualitative conidiation assessments

Quantitative assessment of conidiation was done by measuring conidia density per cm2 produced on Petri dishes on 3% MEA after 10 days of cultivation under natural light/darkness cycle. For this purpose the 6.2 cm2 fragment of an agar plate was cut and rinsed in 15 ml of water containing 0.1% of Tween-80 until visually all conidia were washed out. The concentration of conidia was estimated based on optical density at 540 nm (Biolog Turbidimeter) and transferred into density values based on the calibration curve inferred from the serial dilutions of the standard suspension. In addition the qualitative conidiation assessment when the ability to produce conidia was estimated in respect to carbon metabolism was done using Biolog FF Microplates. In this case conidiation intensity was estimated according to the nominative scale [32] after 72 and 168 hours of incubation. Values 0 and 1 were assigned to the cases when no aerial mycelium and no conidia were detected respectively. Values above 1 corresponded to different intensities of conidiation from single spores (2) to the full coverage of the microplate well by a thick conidial mat (4).

Cellulase production

Strains were grown in 1-liter Erlenmeyer flasks on a rotary shaker (250 rpm) at 28°C for 72 h in 250 ml of Mandels-Andreotti medium [53] containing 1% (wt/vol) Avicel microcrystalline cellulose as the sole carbon source. Conidia (final concentration, 108 per liter) were used as the inoculum. Cellulase activity in the extracellular culture supernatant was measured using 4-nitrophenyl-β-d-lactopyranoside as a substrate dissolved in a 50 mM sodium citrate buffer, pH 5.0. Other conditions for the assay were the same as used for β-glucosidase [54]. One unit (1 U) of enzyme activity is given as the amount of enzyme needed to liberate 1 µmole 4-nitrophenole from the substrate per min. under the conditions of the assay.

Mating Experiments

This was done as described by Seidl et al. [8]. Briefly, the two putative mating partners were placed onto 3% MEA plates 5 cm apart from each other, and incubated at 25°C for 7–10 days in the presence of a natural illumination cycle. In compatibility reactions fruiting bodies were formed at the interaction zone between the two cultures.

Supporting Information

Figure S1

Single loci phylograms. Bayesian circular phylogram inferred from the concatenated dataset of las1 (A), tef1 (B), cal1 (C) phylogenetic markers. Symbols at nodes correspond to posterior probabilities (PP) >95%.

(1.34 MB TIF)

Figure S2

Amino acid polymorphism of MAT1 sequences. The aa alignments of MAT1-1-2, Mat1-1-3 and MAT1-2 proteins for H. jecorina, T. parareesei nom. prov. and T. sp. nov. C.P.K. 524 respectively. Arrows indicate polymorphic sites.

(0.39 MB TIF)

Table S1

Carbon sources of BIOLOG FF microplates.

(0.10 MB DOC)

Acknowledgments

The authors thank John Bissett, George Szakacs and Gary J. Samuels for the gift of some of the strains studied in this work. The authors express special thanks to Benigno Aquino for his help during some of the experiments.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This research has been supported by the Austrian Science Fund grants FWF (www.fwf.ac.at) P-19340-MOB to C.P.K. and P17859-B06 to I.S.D. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Harman GE, Kubicek CP. London: Taylor & Francis; 1998. Trichoderma and Gliocladium Vol 2.393 [Google Scholar]
  • 2.Kubicek CP, Mikus M, Schuster A, Schmoll M, Seiboth B. Metabolic engineering strategies for improvement of cellulase production by Hypocrea jecorina. Biotechnol Biofuels. In press. 2009 doi: 10.1186/1754-6834-2-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Percival Zhang YH, Himmel ME, Mielenz JR. Outlook for cellulase improvement: screening and selection strategies. Biotechnol Adv. 2006;24:452–481. doi: 10.1016/j.biotechadv.2006.03.003. [DOI] [PubMed] [Google Scholar]
  • 4.Kumar R, Singh S, Singh OV. Bioconversion of lignocellulosic biomass: biochemical and molecular perspectives. J Ind Microbiol Biotechnol. 2008;35:377–391. doi: 10.1007/s10295-008-0327-8. [DOI] [PubMed] [Google Scholar]
  • 5.Reese ET, Levinsons HS, Downing M. Quartermaster culture collection. Farlowia. 1950;4:45–86. [Google Scholar]
  • 6.Kuhls K, Lieckfeldt E, Samuels GJ, Kovacs W, Meyer W, et al. Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal derivative of the ascomycete Hypocrea jecorina. Proc Natl Acad Sci U S A. 1996;93:7755–7760. doi: 10.1073/pnas.93.15.7755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Samuels GJ, Petrini O, Manguin S. Morphological and macromolecular characterization of Hypocrea schweinitzii and its Trichoderma anamorph. Mycologia. 1994;86:421–435. [Google Scholar]
  • 8.Seidl V, Seibel C, Kubicek CP, Schmoll M. Sexual development in the industrial workhorse Trichoderma reesei. Proc Natl Acad Sci U.S.A. In press. 2009 doi: 10.1073/pnas.0904936106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dettman JR, Jacobson DJ, Taylor JW. Multilocus sequence data reveal extensive phylogenetic species diversity within the Neurospora discreta complex. Mycologia. 2006;98:436–446. doi: 10.3852/mycologia.98.3.436. [DOI] [PubMed] [Google Scholar]
  • 10.O'Donnell K, Kistler HC, Tacke BK, Casper HH. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc Natl Acad Sci USA. 2000;97:7905–7910. doi: 10.1073/pnas.130193297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.O'Donnell K, Ward TJ, Geiser DM, Kistler HC, Aoki T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet Biol. 2004;41:600–623. doi: 10.1016/j.fgb.2004.03.003. [DOI] [PubMed] [Google Scholar]
  • 12.Rehner SA, Buckley E. A Beauveria phylogeny inferred from nuclear ITS and EF1-a sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia. 2005;97:84–98. doi: 10.3852/mycologia.97.1.84. [DOI] [PubMed] [Google Scholar]
  • 13.Steenkamp ET, Wingfield BD, Desjardins AE, Marasas WFO, Wingfield MJ. Cryptic speciation in Fusarium subglutinans. Mycologia. 2002;94:1032–1043. [PubMed] [Google Scholar]
  • 14.Chaverri P, Castlebury LA, Samuels GJ, Geiser DM. Multilocus phylogenetic structure within the Trichoderma harzianum/Hypocrea lixii complex. Mol Phylogenet Evol. 2003;7:302–13. doi: 10.1016/s1055-7903(02)00400-1. [DOI] [PubMed] [Google Scholar]
  • 15.Druzhinina IS, Komoń-Zelazowska M, Kredics L, Hatvani L, Antal Z, et al. Alternative reproductive strategies of Hypocrea orientalis and genetically close but clonal Trichoderma longibrachiatum, both capable of causing invasive mycoses of humans. Microbiology. 2008;154:3447–3459. doi: 10.1099/mic.0.2008/021196-0. [DOI] [PubMed] [Google Scholar]
  • 16.Samuels GJ, Dodd SL, Lu BS, Petrini O, Schroers HJ, et al. The Trichoderma koningii morphological species. Stud Mycol. 2006;56:67–135. doi: 10.3114/sim.2006.56.03. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Druzhinina IS, Kopchinskiy AG, Komon M, Bissett J, Szakacs G, et al. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet Biol. 2005;42:813–828. doi: 10.1016/j.fgb.2005.06.007. [DOI] [PubMed] [Google Scholar]
  • 18.Hoyos-Carvajal L, Orduz S, Bissett J. Genetic and metabolic biodiversity of Trichoderma from Colombia and adjacent neotropic regions. Fungal Genet Biol. In press.] 2009 doi: 10.1016/j.fgb.2009.04.006. [DOI] [PubMed] [Google Scholar]
  • 19.Kubicek CP, Bissett J, Kullnig-Gradinger CM, Druzhinina IS, Szakacs G. Genetic and metabolic diversity of Trichoderma: a case study on South-East Asian isolates. Fungal Genet Biol. 2003;38:310–317. doi: 10.1016/s1087-1845(02)00583-2. [DOI] [PubMed] [Google Scholar]
  • 20.Komoń-Zelazowska M, Bissett J, Zafari D, Hatvani L, Manczinger L, et al. Genetically closely related but phenotypically divergent Trichoderma species cause world-wide green mould disease in oyster mushroom farms. Appl Environ Microbiol. 2007;73:7415–7426. doi: 10.1128/AEM.01059-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Doseff AI, Arndt KT. LAS1 is an essential nuclear protein involved in cell morphogenesis and cell surface growth. Genetics. 1997;147:857–871. doi: 10.1093/genetics/141.3.857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Samuels GJ, Petrini O, Kuhls K, Lieckfeldt E, Kubicek CP. Hypocrea and Trichoderma sect. Longibrachiatum. Stud Mycol. 1998;41:1–54. [Google Scholar]
  • 23.Dettman JR, Jacobson DJ, Taylor JW. A multilocus genealogical approach to phylogenetic species recognition in the model eukaryote Neurospora. Evolution. 2003;57:2703–2720. doi: 10.1111/j.0014-3820.2003.tb01514.x. [DOI] [PubMed] [Google Scholar]
  • 24.Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, et al. Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol. 2000;31:21–32. doi: 10.1006/fgbi.2000.1228. [DOI] [PubMed] [Google Scholar]
  • 25.Huson DH, Bryant D. Application of phylogenetic networks in evolutionary studies. Mol Biol Evol. 2006;23:254–267. doi: 10.1093/molbev/msj030. [DOI] [PubMed] [Google Scholar]
  • 26.Huson DH. SplitsTree: a program for analyzing and visualizing evolutionary data. Bioinformatics. 1998;14:68–73. doi: 10.1093/bioinformatics/14.1.68. [DOI] [PubMed] [Google Scholar]
  • 27.Farris JS, Kallersjo M, Kluge AG, Bult C. Constructing a significance test for incongruence. Syst Biol. 1995;44:570–572. [Google Scholar]
  • 28.Huelsenbeck JP, Bull JJ, Cunningham CW. Combining data in phylogenetic analysis. Trends Ecol Evol 11: 152. 1996;157 doi: 10.1016/0169-5347(96)10006-9. [DOI] [PubMed] [Google Scholar]
  • 29.Maynard Smith J. Analyzing the mosaic structure of genes. J Mol Evol. 1992;35:126–129. doi: 10.1007/BF00182389. [DOI] [PubMed] [Google Scholar]
  • 30.Bruen TC, Philippe H, Bryant D. A simple and robust statistical test for detecting the presence of recombination. Genetics. 2006;172:2665–2681. doi: 10.1534/genetics.105.048975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Druzhinina IS, Schmoll M, Seiboth B, Kubicek CP. Global carbon utilization profiles of wild-type, mutant, and transformant strains of Hypocrea jecorina. Appl Environ Microbiol. 2006;72:2126–2133. doi: 10.1128/AEM.72.3.2126-2133.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Friedl MA, Kubicek CP, Druzhinina IS. Carbon source dependence of conidiation and its photostimulation in Hypocrea atroviridis. Appl Environ Microbiol. 2008;74:245–250. doi: 10.1128/AEM.02068-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Friedl MA, Schmoll M, Kubicek CP, Druzhinina IS. Photostimulation of Hypocrea atroviridis growth occurs due to a cross-talk of carbon metabolism, blue light receptors and response to oxidative stress. Microbiology. 2008;154:1229–1241. doi: 10.1099/mic.0.2007/014175-0. [DOI] [PubMed] [Google Scholar]
  • 34.Schuster A, Kubicek CP, Friedl MA, Druzhinina IS, Schmoll M. The PAS/LOV-domain protein Envoy of the fungus Hypocrea jecorina plays several light-dependent and–independent regulatory roles. BMC Genomics 4; 2007;8:449. doi: 10.1186/1471-2164-8-449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bisby GR. Trichoderma viride Pers. ex Fries, and notes on Hypocrea. Trans Brit Mycol Soc. 1939;23:149–168. [Google Scholar]
  • 36.Simmons EG. Classification of some cellulase-producing Trichoderma species. Abst Ind Mycol Congress. p. 1977;618 [Google Scholar]
  • 37.Bissett J. A revision of the genus Trichoderma I. Section Longibrachiatum sect. novum. Can J Bot. 1984;62:924–933. [Google Scholar]
  • 38.Lieckfeldt E, Kullnig CM, Samuels GJ, Kubicek CP. Sexually competent, sucrose- and nitrate-assimilating strains of Hypocrea jecorina (Trichoderma reesei, Hypocreales) from South American soils. Mycologia. 2000;92:374–380. [Google Scholar]
  • 39.Giraud T, Refrégier G, Le Gac M, de Vienne DM, Hood ME. Speciation in fungi. Fungal Genet Biol. 2008;45:791–802. doi: 10.1016/j.fgb.2008.02.001. [DOI] [PubMed] [Google Scholar]
  • 40.Dettman JR, Sirjusingh C, Kohn LM, Anderson JB. Incipient speciation by divergent adaptation and antagonistic epistasis in yeast. Nature. 2009;447:585–588. doi: 10.1038/nature05856. [DOI] [PubMed] [Google Scholar]
  • 41.Schluter D. Ecology and the origin of species. Trends Ecol Evol. 2001;16:372–380. doi: 10.1016/s0169-5347(01)02198-x. [DOI] [PubMed] [Google Scholar]
  • 42.Seehausen O. Hybridization and adaptive radiation. Trends Ecol Evol. 2004;19:198–207. doi: 10.1016/j.tree.2004.01.003. [DOI] [PubMed] [Google Scholar]
  • 43.Rice WR. Speciation via habitat specialization: the evolution of reproductive isolation as a correlated character. Evol Ecol. 1987;1:301–314. [Google Scholar]
  • 44.Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Nicholas KB, Nicholas HB., Jr Genedoc: a tool for editing and annotating multiple sequence alignments. 1997 Program Available: http://www.psc.edu/biomed/genedoc. Accessed 2009 Aug 21. [Google Scholar]
  • 46.Rozas J, Sanchez-DelBarrio JC, Messeguer X, Rozas R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 2003;19:2496–2497. doi: 10.1093/bioinformatics/btg359. [DOI] [PubMed] [Google Scholar]
  • 47.Swofford DL. PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4.0b10. Sinauer Associates, Sunderland, MA. 2002.
  • 48.Posada D. Using MODELTEST and PAUP* to select a model of nucleotide substitution. In: Baxevanis AD, Davison DB, Page RDM, Petsko GA, Stein LD, editors. Current Protocols in Bioinformatics. Hoboken, New Jersey: John Wiley & Sons; 2003. pp. 6.5.1–6.5.14. [DOI] [PubMed] [Google Scholar]
  • 49.Akaike H. A new look at the statistical model identification. IEEE Trans Automat Control. 1974;19:716–723. [Google Scholar]
  • 50.Schwarz G. Estimating the dimension of a model. The Ann Stat. 1978;6:461–464. [Google Scholar]
  • 51.Nylander JA, Wilgenbusch JC, Warren DL, Swofford DL. AWTY: A system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics. 2008;25:581–583. doi: 10.1093/bioinformatics/btm388. Program available: http://ceb.csit.fsu.edu/awty. Accessed 2009 Aug 21. [DOI] [PubMed] [Google Scholar]
  • 52.Kuhner MK. LAMARC 2.0: Maximum likelihood and Bayesian estimation of population parameters. Bioinformatics. 2006;22:768–770. doi: 10.1093/bioinformatics/btk051. [DOI] [PubMed] [Google Scholar]
  • 53.Mandels M. Applications of cellulases. Biochem Soc Trans. 1985;13:414–416. doi: 10.1042/bst0130414. [DOI] [PubMed] [Google Scholar]
  • 54.Kubicek CP. Release of carboxymethlycellulase and β-glucosidase from cell walls of Trichoderma reesei. Eur J Appl Microbiol Biotechnol. 1981;13:226–231. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Single loci phylograms. Bayesian circular phylogram inferred from the concatenated dataset of las1 (A), tef1 (B), cal1 (C) phylogenetic markers. Symbols at nodes correspond to posterior probabilities (PP) >95%.

(1.34 MB TIF)

Figure S2

Amino acid polymorphism of MAT1 sequences. The aa alignments of MAT1-1-2, Mat1-1-3 and MAT1-2 proteins for H. jecorina, T. parareesei nom. prov. and T. sp. nov. C.P.K. 524 respectively. Arrows indicate polymorphic sites.

(0.39 MB TIF)

Table S1

Carbon sources of BIOLOG FF microplates.

(0.10 MB DOC)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES