Skip to main content
Eukaryotic Cell logoLink to Eukaryotic Cell
. 2010 Feb;9(2):266–277. doi: 10.1128/EC.00295-09

Candida albicans PEP12 Is Required for Biofilm Integrity and In Vivo Virulence

Suresh K A Palanisamy 1,2, Melissa A Ramirez 3, Michael Lorenz 3, Samuel A Lee 1,2,*
PMCID: PMC2823007  PMID: 20023068

Abstract

To investigate the role of the prevacuolar secretion pathway in biofilm formation and virulence in Candida albicans, we cloned and analyzed the C. albicans homolog of the Saccharomyces cerevisiae prevacuolar trafficking gene PEP12. C. albicans PEP12 encodes a deduced t-SNARE that is 28% identical to S. cerevisiae Pep12p, and plasmids bearing C. albicans PEP12 complemented the abnormal vacuolar morphology and temperature-sensitive growth of an S. cerevisiae pep12 null mutant. The C. albicans pep12 Δ null mutant was defective in endocytosis and vacuolar acidification and accumulated 40- to 60-nm cytoplasmic vesicles near the plasma membrane. Secretory defects included increased extracellular proteolytic activity and absent lipolytic activity. The pep12Δ null mutant was more sensitive to cell wall stresses and antifungal agents than the isogenic complemented strain or the control strain DAY185. Notably, the biofilm formed by the pep12Δ mutant was reduced in overall mass and fragmented completely upon the slightest disturbance. The pep12Δ mutant was markedly reduced in virulence in an in vitro macrophage infection model and an in vivo mouse model of disseminated candidiasis. These results suggest that C. albicans PEP12 plays a key role in biofilm integrity and in vivo virulence.


In Saccharomyces cerevisiae, distinct secreted marker proteins are trafficked differentially through a prevacuolar compartment (PVC) prior to exocytosis (14). Furthermore, prevacuolar protein sorting genes play an important role in cargo transport in the prevacuolar branch of the exocytic pathway in S. cerevisiae (13, 15). By isolating dense- and light-vesicle populations in S. cerevisiae vps1 sec6-4, vps4 sec6-4, and pep12 sec6-4 mutants, it was observed that mutants blocked in this prevacuolar pathway missort marker proteins that are normally found in high-density post-Golgi compartment vesicles into low-density vesicles (15). Gurunathan et al. (13) also demonstrated these findings for vps1 and pep12 mutants with a late secretory mutant (snc1) background similar to that of the sec6-4 strains. These results indicate that some exocytic cargo, including the conditionally regulated soluble secretory proteins invertase and acid phosphatase, are differentially sorted through a PVC prior to exocytosis in the model yeast S. cerevisiae.

To study the prevacuolar branch of exocytosis in Candida albicans and its role in virulence, we have previously cloned and analyzed the C. albicans prevacuolar trafficking genes VPS1 and VPS4. We demonstrated that C. albicans VPS4 is required for extracellular secretion of Sap2p and Sap4-6p and for virulence in an in vivo model of disseminated candidiasis (19, 20). C. albicans VPS1 is required for Sap2p secretion and biofilm formation (4). Interestingly, although the C. albicans null mutant lacking VPS4 forms a biofilm that is denser than that formed by the isogenic reintegrant strain, the conditional mutant lacking VPS1 expression forms a patchy biofilm of reduced density (4, 34). Thus, it appears that interference with normal prevacuolar trafficking affects both the secretion of virulence-associated proteins and biofilm formation.

S. cerevisiae PEP12 encodes a 288-amino-acid syntaxin which regulates docking of Golgi compartment-derived transport vesicles at the PVC (3). Pep12p interacts with the v-SNARE Vti1p, and overexpression of Pep12p suppresses extracellular missorting of carboxypeptidase in the vti1 mutant (37). The S. cerevisiae pep12 null mutant displays a temperature-sensitive growth defect and is characterized by an enlarged vacuole with morphology defined as class D (3). A search of the C. albicans genome database identified a structural homolog of S. cerevisiae PEP12. Thus, the experiments described below were designed to determine whether the C. albicans PEP12 homolog is functionally homologous to S. cerevisiae PEP12 and to investigate its role in secretion, biofilm formation, and virulence.

MATERIALS AND METHODS

Strains and media.

The S. cerevisiae pep12 null mutant strain (ATCC 4001812; YOR036W BY4741) was purchased from the American Type Culture Collection (ATCC, Manassas, VA). C. albicans strains used in this study are listed in Table 1. Strains were grown at 30°C in YPD (1% yeast extract, 2% peptone, 2% glucose) supplemented with uridine (80 μg ml−1) or in minimal glucose medium (0.67% yeast nitrogen base without amino acids [YNB], 2% glucose) supplemented with appropriate amino acids according to auxotrophic requirements. Filamentation was assayed on Spider agar medium (21), medium 199 (M199) containing Earle's salts (Invitrogen) supplemented with l-glutamine and buffered with 150 mM HEPES to pH 7.5, and 10% (vol/vol) fetal calf serum (FCS) in YPD. Biofilms were assayed in liquid RPMI 1640 supplemented with l-glutamine (Gibco BRL). Liquid complete synthetic medium (CSM) supplemented with uridine and buffered to pH 4.0 with 150 mM HEPES was used for growth in acidic medium. YPD agar supplemented with uridine and buffered to pH 8.0 with 50 mM sodium succinate–50 mM NaH2PO4 was used for growth in alkaline medium. Solid medium was prepared by adding 2% agar.

Table 1.

C. albicans strains used in this study

Strain Genotype Reference
DAY185 ura3Δ::λimm434/ura3Δ::λimm434his1::hisG/HIS1::his1::hisG arg4::hisG/ARG4::URA3::arg4::hisG PEP12/PEP12 9
BWP17 ura3Δ/ura3Δ arg4Δ/arg4Δ his1Δ/his1Δ PEP12/PEP12 39
APSK5 ura3Δ/ura3Δ arg4Δ/arg4Δ his1Δ/his1Δ PEP12/pep12Δ::dpl200-URA3-dpl200 This study
APSK5-8 ura3Δ/ura3Δ arg4Δ/arg4Δ his1Δ/his1Δ pep12Δ::dpl200-URA3-dpl200/pep12Δ::ARG4 This study
APSK5-8H ura3Δ/ura3Δ arg4Δ/arg4Δ his1Δ/his1Δ::HIS1 pep12Δ::dpl200-URA3-dpl200/pep12Δ::ARG4 This study
APSK5-8R ura3Δ/ura3Δ arg4Δ/arg4Δ his1Δ/his1Δ::HIS1::PEP12 pep12Δ::dpl200-URA3-dpl200/pep12Δ::ARG4 This study

Preparation of plasmid and genomic DNA.

Plasmids were expanded in Escherichia coli DH5α cells grown in Luria-Bertani medium with ampicillin (100 μg ml−1) at 37°C. Plasmid DNA was prepared from E. coli strains using a FastPlasmid minikit according to the instructions of the manufacturer (Eppendorf). Genomic DNA was extracted from fungal cells using a MasterPure yeast DNA purification kit (Epicentre Biotechnologies) according to the manufacturer's instructions, with the exception of a further incubation step (1 h on ice) performed after the addition of the MasterPure Complete protein precipitation reagent.

Isolation and analysis of C. albicans PEP12.

The C. albicans homolog of S. cerevisiae PEP12 was identified by searching the Candida Genome Database (http://www.candidagenome.org/) and CandidaDB (http://genolist.pasteur.fr/CandidaDB). The coding sequence and 603 bp of upstream and 556 bp of downstream flanking sequences were amplified from C. albicans BWP17 genomic DNA by using Platinum Taq high-fidelity DNA polymerase (Invitrogen) and primers SacI-5PEP12 and MluI-3PEP12 (Table 2), and the amplified products were cloned using the TOPO-TA cloning kit (Invitrogen). PCR mixtures were typically heated to 94°C for 3 min and subjected to 35 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 2 min 30 s, with a 10-min final extension at 72°C. DNA sequencing of the forward and reverse strands confirmed that no mutations had been introduced into the cloned gene's open reading frame compared to the sequence in the Candida Genome Database. Next, the C. albicans PEP12 gene was ligated into the yeast shuttle vector pRS316, and the S. cerevisiae pep12 null mutant strain was transformed with the resulting plasmid. S. cerevisiae PEP12 was also amplified by PCR and subcloned into vector pRS316 for use as a positive control in the complementation experiments. Standard methods were used for restriction mapping, subcloning, DNA sequencing, and lithium acetate transformation of S. cerevisiae mutants (2).

Table 2.

Primer sequences used in this study

Primer name Primer sequence (5′ → 3′)
ScPEP12RI-5EcoRI GAATTCAAAATCGCACCTCCTTGAAAT
ScPEP12RI-3HindIII AAGCTTTACGTGTTATTCGGGAACTGG
PEP12-5DR CATTTATTTGTTGATCAGAAGCAATATTTGGTGTGAACTATCCCCAACTTCTATAGCCAACCACCGTCTCTATCGTTTTCCCAGTCACGACGTT
PEP12-3DR ATTTTTGTAAATATACATATAATTACATTCACTAATAAAGAGCAAACTTCTCCTCTGTACATTTATTTTTGTGGAATTGTGAGCGGAT
PEP12-5DET GGAATGTCGTTGATGCTATCG
PEP12-3DET AAAAAGGGAAATGGGTGATTG
SacI-5PEP12 TCGTCTGAGCTCGGGTTATTCTACGCCATTGGTC
MluI-3PEP12 TAGTGTACGCGTTGGACATGAAGTACTGTTTGG
GEMHISR CTCCCGGCCGCCATGGCC
HIS3AMP GTTGGTGTGGCCCAGAGAC
PEP12-5Sou2 AGAACACCAAACAGTACCTTCATGT
PEP12-3Sou2 TTAGGTGGTGCTGATACTCCTAAAC

Targeted deletion of C. albicans PEP12.

A C. albicans pep12Δ null mutant of background strain BWP17 was generated by disrupting both chromosomal alleles of PEP12 by a PCR-based gene disruption strategy (38, 39). PCR-generated amplicons were produced using primers PEP12-5DR and PEP12-3DR (Table 2) and plasmid pDDB57 (from A. P. Mitchell, Carnegie Mellon University) as the template. C. albicans BWP17 was transformed directly with the PCR mixtures by the lithium acetate method. Homologous integration of the gene disruption cassette was verified by allele-specific PCR using primers PEP12-5DET (located 161 bp upstream of the PEP12 open reading frame) and PEP12-3DET (located 216 bp downstream of the PEP12 open reading frame) (Table 2). To disrupt the second allele, selected PEP12/pep12Δ::dpl200-URA3-dpl200 mutants were transformed with the PCR-generated gene disruption cassette by using pRS-ARG4ΔSpeI as the template. Homologous integration of the gene disruption cassette into the second allele was again verified with primers PEP12-5DET and PEP12-3DET. Histidine prototrophy was restored after transforming the pep12Δ null mutant strain with NruI-linearized pGEM-HIS1 (39). An isogenic PEP12 reintegrant strain was generated by PCR-based cloning of the C. albicans PEP12 gene along with 603 bp upstream and 556 bp downstream of the open reading frame, and SacI and MluI restriction sites were added to the 5′ and 3′ ends, respectively. The PCR product was cloned into pGEM-HIS1, and selected pep12Δ::dpl200-URA3-dpl200/pep12Δ::ARG4 null mutant strains were transformed with the plasmid construct after linearization of the construct with NruI. Correct integration of pGEM-HIS1 and pGEM-HIS1-PEP12 was confirmed by allele-specific PCR using primers GEMHISR and HIS3AMP (Table 2) by the strategy described by Palmer et al. (23).

Correct strain construction was subsequently confirmed by Southern blotting. In brief, genomic DNA prepared from candidate strains was digested with EcoRI and HindIII (New England Biolabs) and run on a 0.8% (wt/vol) agarose gel. A digoxigenin-labeled probe was prepared from genomic DNA isolated from strain SC5314 with primers PEP12-5Sou2 and PEP12-3Sou2 (Table 2) and reagents supplied in the PCR digoxigenin probe synthesis kit (Roche); Southern blotting was carried out by following standard protocols (2).

Analysis of growth and stress tolerance.

Growth in liquid CSM with uridine (80 μg ml−1) was assessed by measuring the optical density at 600 nm (OD600) at fixed intervals. The strains were grown overnight at 30°C in YPD, washed, transferred into fresh CSM, and diluted to a starting OD600 of 0.1. Cultures of each strain (400 μl) were grown in triplicate in a microtiter plate at 30, 37, or 40°C for 30 h in an automated Bioscreen C analyzer (Thermo Labsystems). Shaking of the microcultures was performed at high intensity with irregular rotation every 3 min for 20 s, and ODs were measured every half hour. Growth curves were generated automatically using BioLINK software (Thermo Labsystems).

Strains were analyzed under conditions of high osmolar stress (in the presence of 2.5 M glycerol or 1 M NaCl) or under acidic (pH 4.0) or alkaline (pH 8.0) growth conditions on YPD agar plates supplemented with uridine (80 μg ml−1) at 30°C. Strains were also grown on YPD agar plates supplemented with uridine (80 μg ml−1) and subinhibitory concentrations of the antifungal agents amphotericin B, caspofungin, fluconazole, and flucytosine (5FC) and the cell wall-stressing agents Congo red, calcofluor white, and sodium dodecyl sulfate (SDS).

Visualization of vacuolar morphology.

The fluorescent dye FM4-64 (Molecular Probes) was used to visualize endocytic and vacuolar membranes, as described previously (36). Following incubation with FM4-64, the cells were harvested by 5 s of centrifugation, washed with CSM, and viewed directly by phase-contrast and fluorescence microscopy using a Nikon epifluorescence microscope equipped with a Hamamatsu camera with a 60× PlanApo oil immersion objective. Red fluorescence filters (excitation filter, 533 to 588 nm; barrier, 608 to 683 nm [Chroma]) were used to visualize structures stained with FM4-64. To assess vacuolar acidification, a 500-μl sample of cells from an overnight culture was processed, stained, and visualized after quinacrine staining according to published methods (29).

Enzyme and adhesion assays.

Extracellular protease expression by C. albicans was assayed using bovine serum albumin (BSA) plate assays, as described previously (7). Lipase activity was assessed on YNB agar containing 2.5% (vol/vol) Tween 80 or on 10% egg yolk agar (10). Adhesion to polystyrene was assessed as described previously (31) with slight modifications. An inoculum of 1.0 ×107 cells ml−1 in phosphate-buffered saline (PBS) or RPMI 1640 was prepared, and 150-μl aliquots were added to individual wells of a 96-well microtiter plate. Samples of each strain identical to those in the wells of the plate were dispensed into individual microcentrifuge tubes for use as the unwashed controls to indicate the total number of adherent and nonadherent cells. Following a 2-h incubation period at 37°C, nonadherent cells were removed by washing the wells of the microtiter plate, while cells incubated in microcentrifuge tubes were pelleted at high speed on a benchtop centrifuge. The 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino)carbonyl]-2H-tetrazolium hydroxide (XTT) reduction assay (26) was then used to determine the amount of adhered cells and the total amount of cells in each well and microcentrifuge tube, respectively. After incubation with the XTT-menadione substrate at 37°C for 3 h, 75 μl of colored formazan was transferred into a fresh microtiter plate and absorbance at 490 nm was read. The adherence capacity of each strain was calculated as the mean XTT value for the washed cells relative to the mean XTT value for the unwashed cells. Experiments were performed at least twice, each with eight replicates per strain tested. Statistical significance was assessed with an analysis of variance (ANOVA) among all strains, compared using Prism 5.0 (GraphPad Software, Inc.).

Analysis of fungal biofilms.

Analysis of the formation of C. albicans biofilms and the XTT reduction assay were performed as described previously (26). C. albicans biofilm mass was measured according to previously published methods, with slight modifications (6, 18). In brief, cells in 5-ml aliquots of RPMI 1640 containing 106 cells ml−1 were grown in a six-well culture plate at 37°C for 24 h. The biofilms were scraped using a sterile scraper and transferred onto preweighed cellulose nitrate filters (pore size, 0.45 μm; diameter, 25 mm). The biofilms were washed three times with 1× PBS, dried at 37°C for 48 h, and weighed. Biofilms (dry weights) were measured in four separate experiments, each performed in quadruplicate.

Visualization of fungal biofilms.

C. albicans biofilms were formed as described above on 15-mm-diameter sterile coverslips (Thermanox; Nalge Nunc International) in a six-well plate. After incubation at 37°C for 24 h, the coverslips were gently washed twice with 2% d-(+)-glucose and 10 mM Na-HEPES (pH 7.2), stained with 10 μM FUN 1 (Molecular Probes), and visualized using an LSM 510 confocal laser scanning microscope (Carl Zeiss, Inc.). Serial sections in the xy plane were obtained along the z axis. Three-dimensional reconstructions of imaged biofilms were obtained using associated software (SlideBook 5.0; Leeds Precision Instruments, Inc.). The images were processed for display using Photoshop (Adobe Systems, Inc.).

Scanning electron microscopy analysis of biofilm samples formed on a coverslip (Thermanox; Nalge Nunc International) was performed after 24 h of incubation of a 0.5-ml inoculum containing 106 cells ml−1 according to previously described methods (27).

Macrophage and Candida survival assay.

The macrophage killing assay was performed as described by Palmer et al. (24). The murine macrophage cell line J774A.1 was purchased from the ATCC and propagated in high-glucose Dulbecco's modified Eagle's medium supplemented with 10% FCS. Next, 2.0 × 105 J774A.1 cells in a volume of 0.75 ml were seeded into Lab-Tek chambered slides (Nalge Nunc) and incubated overnight at 37°C with 5% CO2. C. albicans strains, diluted and grown as described previously (24), were coincubated with the adhered macrophages at a multiplicity of infection of 2 for specified time periods. Following coincubation, the cells were washed twice with PBS and viability was assessed using 0.2 μM calcein AM and 4 μM ethidium bromide homodimer from a LIVE/DEAD viability/cytotoxicity kit according to the instructions of the kit manufacturer (Invitrogen). Live macrophages from four fields of each chamber were counted, and statistical differences among the average values were assessed using ANOVA followed by Tukey's multiple comparison of means.

Candida survival was assessed using an end point dilution assay as described previously (24, 30). Results are presented as the values obtained by dividing the numbers of colonies in the presence of macrophages by the numbers of colonies in the absence of macrophages and multiplying by 100. Each experiment was set up in quadruplicate, and P values were determined using ANOVA.

Murine model of disseminated candidiasis.

In order to assess virulence in a standard mouse tail vein model of invasive candidiasis, C. albicans strains (DAY185, the pep12Δ null mutant, and the PEP12 reintegrant) were grown to mid-log phase in YPD at 30°C and yeast-phase cells were harvested, washed, counted, and resuspended in sterile 0.9% (wt/vol) NaCl. Next, groups of 10 BALB/c female mice (from Charles River Laboratories) were injected intravenously with 0.2 ml of each cell suspension at 1.0 × 106 cells per animal, and survival over 30 days was assessed.

RESULTS

Complementation of a S. cerevisiae pep12 mutant.

A search of the C. albicans genome database revealed an 831-bp intronless open reading frame (orf.19.4292) whose deduced protein product is a 276-amino-acid t-SNARE that is 28% identical to S. cerevisiae Pep12p. Further bioinformatic analysis suggested that C. albicans orf.19.4292 is a structural homolog of S. cerevisiae PEP12 (http://bioinformatics.mpibpc.mpg.de/snare/) (17). The open reading frame contains four CUG codons (corresponding to amino acid positions 52, 90, 152, and 162). To determine if the C. albicans PEP12 homolog is functionally homologous to S. cerevisiae PEP12, C. albicans PEP12 was subcloned into the low-copy-number yeast shuttle vector pRS316 to generate pCaPEP12. Since S. cerevisiae pep12 mutants display a temperature-sensitive growth phenotype, we next transformed an S. cerevisiae pep12 null mutant with pCaPEP12 or with a plasmid bearing S. cerevisiae PEP12 and assayed growth at permissive (30°C) and restrictive (40°C) temperatures. Strains bearing C. albicans PEP12 or wild-type S. cerevisiae PEP12 grew at the restrictive temperature, in contrast to strains bearing an empty vector alone, which did not (Fig. 1A).

Fig. 1.

Fig. 1.

Complementation of an S. cerevisiae pep12 null mutant. (A) C. albicans PEP12 complements the temperature sensitivity of an S. cerevisiae pep12 null mutant. S. cerevisiae pep12 mutant strains transformed with a vector bearing either C. albicans PEP12 (CaPEP12) or S. cerevisiae PEP12 (ScPEP12) or the vector alone were incubated for 48 h at 30 and 40°C. (B) C. albicans PEP12 complements the S. cerevisiae pep12 null mutant vacuolar phenotype. Overnight cultures of an S. cerevisiae pep12 null mutant transformed with empty vector pRS316 or a vector containing C. albicans PEP12 or S. cerevisiae PEP12 were shifted into fresh medium. Vacuolar morphology was examined by FM4-64 staining of live cells at exponential phase and observation by epifluorescence and light microscopy. S. cerevisiae wild-type strain BY4741 (WT) was used as a positive-control strain. (C) C. albicans PEP12 complements the S. cerevisiae pep12 null mutant vacuolar acidification defect. Vacuolar acidification was assessed by quinacrine staining of live cells.

The S. cerevisiae pep12 null mutant exhibits class D vacuolar morphology, characterized by an enlarged central vacuole. Thus, we next examined vacuolar morphology in these strains. S. cerevisiae pep12 mutants bearing either C. albicans or S. cerevisiae PEP12 displayed wild-type vacuolar morphology (Fig. 1B). In contrast, S. cerevisiae pep12 null mutants transformed with an empty vector retained class D vacuolar morphology (Fig. 1B). We also performed quinacrine staining to assess vacuolar acidification. The S. cerevisiae pep12 mutant with an empty vector alone did not fluoresce as expected (25); however, S. cerevisiae pep12 mutant strains transformed with plasmids bearing C. albicans or S. cerevisiae PEP12 stained normally, indicating complementation of the vacuolar acidification defect (Fig. 1C).

Taken together, these results suggest that C. albicans PEP12 complements the S. cerevisiae pep12 mutant and is functionally homologous to the corresponding S. cerevisiae gene.

Construction and phenotypic analysis of a C. albicans pep12Δ null mutant.

We next generated a C. albicans pep12Δ homozygous null mutant by PCR-mediated gene disruption and then constructed an isogenic complemented strain (data not shown). The C. albicans pep12Δ null mutant grew similarly to control strain DAY185 and the isogenic PEP12 reintegrant strain in rich medium at 30, 37, 40, or 42°C (Fig. 2A and data not shown). The mean doubling times ± standard deviations of DAY185, the pep12Δ null mutant, and the PEP12 reintegrant strain were 2.25 ± 0.03, 2.23 ± 0.02, and 2.19 ± 0.03 h, respectively, at 30°C.

Fig. 2.

Fig. 2.

Growth, vacuolar morphology, and vacuolar function of the C. albicans pep12Δ null mutant. (A) In vitro growth of the C. albicans pep12Δ mutant, wild-type (DAY185), and isogenic PEP12 reintegrant strains. Independent experiments were performed in triplicate three times; the mean OD600 values and corresponding error bars are indicated. (B) Characterization of vacuolar morphology. Vacuolar morphology was visualized by FM4-64 staining and bright-field and epifluorescence microscopy. (C) Ultrastructural vacuolar and cellular morphology. Thin-section transmission electron microscopy analysis of the pep12Δ null mutant demonstrated the accumulation of 40- to 60-nm secretory vesicles near the plasma membrane (arrows). Bars representing 10 μm are shown. (D) Functional assessment of endocytosis in the pep12Δ mutant. Investigation of the endocytic pathway using FM4-64 staining revealed that FM4-64 failed to stain the vacuole of the pep12Δ mutant, indicating a defect in endocytosis. (E) Assessment of vacuolar acidification in the pep12Δ mutant. Quinacrine staining revealed a defect in vacuolar acidification of the pep12Δ mutant.

Vacuolar morphology of the C. albicans pep12Δ null mutant.

Class D yeast vacuolar mutants are characterized by a single enlarged vacuole, abnormalities in mother-to-daughter vacuolar inheritance, and defects in vacuolar H+-ATPase assembly (28). Like other class D vacuolar mutants, the S. cerevisiae pep12 mutant has an enlarged class D vacuole which can be visualized using vacuolar staining and fluorescence microscopy (3). In contrast, the C. albicans pep12Δ null mutant did not have clearly enlarged vacuoles as observed by light microscopy and failed to stain with the membrane dye FM4-64 (Fig. 2B). Thin-section electron microscopy demonstrated that, near the plasma and vacuolar membranes, the C. albicans pep12Δ mutant accumulated vesicles of 40 to 60 nm (Fig. 2C), resembling the small, 40- to 50-nm vesicles present in the S. cerevisiae pep12 null mutant (3).

We next analyzed the endocytic pathway using FM4-64 staining. FM4-64 failed to stain the vacuole of the C. albicans pep12Δ mutant at any time point (Fig. 2D); in contrast, FM4-64 reached the vacuoles of the control strain DAY185 and the isogenic PEP12 reintegrant by 60 to 90 min. Functionally, the S. cerevisiae pep12 mutant's vacuolar pH is only slightly more alkaline than that of the wild-type strain, but unlike wild-type controls, the mutant vacuole fails to stain with quinacrine (25). Therefore, we performed quinacrine staining to assess vacuolar acidification. The vacuoles of the DAY185 and PEP12 reintegrant strains stained as expected, but that of the C. albicans pep12Δ mutant failed to stain, suggesting a defect in vacuolar acidification (Fig. 2E).

Response of the C. albicans pep12Δ mutant to cell wall synthesis inhibitors and antifungal agents.

When C. albicans pep12Δ and the corresponding control strains were grown at acidic or alkaline pH (pH 4 or 8, respectively) or under conditions of osmolar stress (in the presence of 2.5 M glycerol or 1 M NaCl), no differences in growth were observed. However, compared to DAY185 and the isogenic reintegrant strain, the pep12Δ null mutant grew poorly in the presence of agents interfering with cell wall integrity and/or synthesis, SDS (0.01%), Congo red (50 μg/ml), and calcofluor white (20 μg/ml) (Fig. 3A).

Fig. 3.

Fig. 3.

Cell wall integrity and antifungal susceptibility of the C. albicans pep12Δ null mutant. Serial dilutions (1 × 106, 2 × 105, 4 × 104, and 8 × 103 cells ml−1) of DAY185 (WT), the pep12Δ null mutant, and the PEP12 reintegrant strain were spotted onto agar containing the cell wall-stressing reagents SDS, Congo red, and calcofluor white (A) and the antifungal agents amphotericin B (AMB), caspofungin (CAS), fluconazole (FLU), and 5FC (B) and grown at 30°C for 2 days. The C. albicans pep12Δ mutant was more sensitive to cell wall-stressing agents than DAY185 or the isogenic PEP12 reintegrant strain. The pep12Δ mutant was also more sensitive to the cell wall-targeting agents amphotericin B and caspofungin and the ergosterol synthesis inhibitor fluconazole, but not the DNA synthesis inhibitor 5FC.

The C. albicans pep12Δ null mutant was more susceptible to caspofungin and amphotericin B than DAY185 or the PEP12 reintegrant strain. There was a modest increase in susceptibility to fluconazole but no difference in susceptibility to 5FC (Fig. 3B).

Secreted aspartyl protease and lipase secretion from the C. albicans pep12Δ mutant.

We next tested for extracellular secreted aspartyl protease by using a BSA plate assay. The C. albicans pep12Δ null mutant produced a large zone of extracellular proteolysis compared to control strain DAY185 and the PEP12 reintegrant strain (Fig. 4). We next tested lipolytic activity on Tween 80 agar plates and egg yolk agar plates; the C. albicans pep12Δ null mutant did not produce any extracellular lipolytic activity on Tween 80 agar, and there was substantial reduction of phospholipase activity on egg yolk agar compared to the activities of DAY185 and the reintegrant strain (Fig. 4). These results are similar to those obtained with the C. albicans vps4Δ mutant in previous studies (19), suggesting that prevacuolar secretion plays a role in the secretion of aspartyl proteases and lipases.

Fig. 4.

Fig. 4.

Secretion of proteolytic and lypolytic enzymes by the C. albicans pep12Δ null mutant. Overnight cultures were spotted onto BSA, Tween 80, and egg yolk agar plates, incubated at 30 and 37°C, and visualized on a daily basis. The relative amounts of extracellular protease and lypolytic activities are indicated by the halo or zone of precipitation surrounding the fungal colony. The C. albicans pep12Δ null mutant produced an increased zone of extracellular proteolysis compared to DAY185 or the isogenic PEP12 reintegrant strain on BSA agar. In contrast, the pep12Δ null mutant produced less phospholipase and extracellular lipase activities than the control strains on Tween 80 and egg yolk agars.

Filamentation of the C. albicans pep12Δ null mutant.

When the C. albicans pep12Δ null mutant strain and control strains were grown at 37°C in 10% FCS, there was a decrease in the percentage of cells of the pep12Δ mutant strain that had filamented at 60 min compared to those of the control strains (Fig. 5A). However, by 90 min there was no difference in the total percentage of filamented cells among the strains (Fig. 5B). When the strains were spotted onto M199 agar, hyphal structures were formed from each colony, but the C. albicans pep12Δ mutant also was delayed in filamentation on solid medium (Fig. 5C). Similar results were seen with Spider agar and 10% FCS plates (Fig. 5C).

Fig. 5.

Fig. 5.

Filamentation of the C. albicans pep12Δ null mutant. (A) Filamentation of the C. albicans pep12Δ null mutant was assessed by incubation in 10% FCS–YPD medium at 37°C with constant shaking at 200 rpm. The pep12Δ null mutant lagged in the degree of filamentation of cells at 60 min compared to control strains; however, it appeared to be comparable to the control strains at 90 min. (B) The percentage of filamentous cells at 60 min, but not that at 90 min, was reduced. (*, P < 0.0046 by ANOVA) (C) Overnight cultures of the DAY185, pep12Δ null mutant, and PEP12 reintegrant strains were spotted onto Spider medium, M199, and 10% FCS–YPD agar and incubated at 37°C for the times indicated. Filamentous structures emerging from the edges of each colony were observed for all the strains; however, the pep12Δ mutant appeared to filament slower than the control strains on M199 plates.

Adhesion and biofilm formation by the C. albicans pep12Δ null mutant.

We examined the adherence of the C. albicans pep12Δ null mutant by using a simple assay for adhesion to polystyrene. There was no statistically significant difference in adherence among DAY185, the pep12Δ mutant, and the PEP12 reintegrant strain (data not shown). Next, we examined the role of C. albicans PEP12 in biofilm formation in vitro. The C. albicans pep12Δ mutant formed a biofilm that was significantly reduced in metabolic activity compared to control biofilms when measured by the XTT assay (Fig. 6A) and, strikingly, was completely fragmented and detached from the underlying surface (Fig. 6B).

Fig. 6.

Fig. 6.

Biofilm formation by the C. albicans pep12Δ mutant. (A) Assessment of biofilm metabolic activity. Biofilms were formed in RPMI 1640 as described in the text, and biofilm metabolic activity was analyzed using the XTT reduction assay. Experiments were performed three times independently, and each experiment included eight replicates. Statistical significance was analyzed by ANOVA. Minimal XTT activity was observed in the pep12Δ mutant strain (*, P < 0.001), although this is likely an artifact due to loss of the fragmented, nonadherent biofilm during washing. (B) Characterization of biofilm gross morphology. Biofilm morphology was visualized after growing the inoculum at 37°C for 24 h in a six-well plate before and after gentle motion. Complete fragmentation of the pep12Δ biofilm occurred after gentle motion. (C) Measurement of biofilm dry mass. Biofilm dry mass was assessed by growing the biofilms for 24 h in a six-well plate. Quadruplicate experiments were performed independently four times. The biofilms were scraped, filtered using a 0.22-μm-pore-size nitrocellulose membrane, washed with PBS, and dried on the filter at 37°C for 48 h. Thus, loose fragments of the biofilm were collected along with the intact biofilm. A total reduction in the mass of the pep12Δ mutant biofilm compared to those of control biofilms was seen (*, P < 0.0002).

Because most of the biofilm of the pep12Δ mutant was fragmented and largely nonadherent to the polystyrene well, we next measured the dry weight of the entire biofilm (including the nonadherent fragments) collected onto filter paper. The biomasses from DAY185 (mean ± standard deviation, 0.0944 ± 0.0041 g), the pep12Δ mutant (0.0606 ± 0.00483 g), and the PEP12 reintegrant (0.0930 ± 0.0068 g) were measured, and the biofilm formed by the pepl2Δ null mutant had approximately one-third less biomass than that formed by DAY185 or the PEP12 reintegrant strain (Fig. 6C).

To characterize the kinetics of biofilm formation in the pep12Δ mutant, a time course experiment was conducted to identify when the biofilm fragments and detaches from the plate. The C. albicans pep12Δ null mutant strain biofilm detached from the plate at 6 h with gentle tapping of the microtiter plate, in contrast to DAY185 and PEP12 reintegrant strain biofilms, which remained firmly attached and intact as expected (Fig. 7). By 8 h, the biofilm of the pep12Δ mutant lifted off the polystyrene well without any disturbance. Taken together, these results suggest that PEP12 plays an important role in normal biofilm integrity.

Fig. 7.

Fig. 7.

Kinetics of biofilm formation. Control strain DAY185, the pep12Δ null mutant strain, and the PEP12 reintegrant strain were grown in duplicate in RPMI 1640 at 37°C in six-well plates. The plates were observed every 2 h and then disturbed by being tapped on the side. The pep12Δ biofilm was easily fragmented at 4 to 6 h with gentle physical disturbance by soft tapping of the plate. At 8 h, the pep12Δ biofilm detached from the bottom of the plate well and partially fragmented with minimal physical disturbance (lifting of the plate for imaging without tapping).

Visualization of C. albicans pep12Δ null mutant biofilm structure.

We next used confocal laser scanning microscopy (CLSM) to identify the structural characteristics of the pep12Δ biofilm compared to the biofilm of the control strain. The C. albicans pep12Δ mutant formed a biofilm that was much more disorganized than the biofilm formed by control strain DAY185 (Fig. 8A and B). Overall, the pep12Δ biofilm was much thicker (∼180 μm) than the DAY185 biofilm (84 μm) when analyzed by CLSM, although this finding is due most likely to an artifact of the detached, fragmented structure of the pep12Δ biofilm.

Fig. 8.

Fig. 8.

Structural analysis of the C. albicans pep12Δ null mutant biofilm. (A and B) Biofilms were examined using CLSM. Biofilms of control strain DAY185 and the pep12Δ null mutant were formed in RPMI 1640 as described previously, stained with FUN 1 (Invitrogen), and subsequently visualized using a Zeiss LSM 510 META confocal laser scanning microscope with a 20× objective. Images were processed to obtain a three-dimensional view by compilation of xy optical sections taken across the z axis to produce a lateral view in order to determine biofilm thickness (A) and a rotated view to present a global perspective (B). The C. albicans pep12Δ mutant produced a thicker and more disorganized biofilm than the wild type, although this outcome was due likely to an artifact of fragmentation of the biofilm. (C) Biofilm ultrastructure was examined using scanning electron microscopy. Biofilms were formed on a plastic coverslip and air dried overnight to leave the EPS intact. The biofilm formed by DAY185 was clearly encased in a dense matrix of EPS mixed with filamentous cells. In contrast, the biofilm formed by the pep12Δ mutant had very little EPS, despite having a dense network of filamentous cells.

Detailed comparison of air-dried biofilms using scanning electron microscopy, which preserves the biofilm extrapolymeric substance (EPS), revealed that the C. albicans pep12Δ mutant had a greatly reduced amount of EPS compared to control strain DAY185 (Fig. 8C).

Assessment of virulence of the C. albicans pep12Δ mutant in an in vitro macrophage model.

To determine whether deletion of PEP12 affects the virulence of C. albicans, we first used an in vitro macrophage model of virulence. At 24 h, most of the macrophages had been killed by control strain DAY185 and the isogenic PEP12 reintegrant strain; however, there was a 30-fold increase in the number of surviving macrophages when the cells were incubated with the pep12Δ null mutant (Fig. 9A and B). These survival data are similar to those obtained previously with a C. albicans vps11Δ mutant by using the same assay (24). We next measured Candida survival within the macrophages. Similarly, there was a statistically significant (P < 0.0001) reduction in the survival rate of the pep12Δ null mutant compared to those of the control strains (Fig. 9C).

Fig. 9.

Fig. 9.

In vitro macrophage model of C. albicans virulence. (A) Quantification of live macrophages after infection with C. albicans strains. The numbers of live macrophage cells per field (with four fields per strain) at 24 h were determined. The data indicate an average of the number of live macrophages from two individual experiments measuring live and dead macrophage cells after 24 h. A large number of macrophages remained alive when coincubated with the pep12Δ mutant, but most were nonviable when coincubated with the fully virulent control strain DAY185 or the isogenic reintegrant PEP12 strain (*, P < 0.0001). (B) The C. albicans DAY185, pep12Δ null mutant, and PEP12 reintegrant strains were coincubated with macrophage cells for 1 h, 5 h (data not shown), and 24 h and stained for analysis of macrophage viability. Viable macrophages are stained green, and dead cells are stained red. (C) C. albicans survival was assessed using an end point dilution assay. Results are presented as percentages of surviving C. albicans cells, and the significance of the data was calculated using Student's unpaired t test. The percentage of surviving C. albicans pep12Δ mutant cells is substantially reduced compared to those of DAY185 and PEP12 reintegrant cells (*, P < 0.0001).

Virulence of the C. albicans pep12Δ null mutant in a mouse model of disseminated candidiasis.

We next assessed the role of PEP12 in virulence in an in vivo mouse tail vein model of hematogenously disseminated candidiasis. Mice infected with control strain DAY185 and the PEP12 reintegrant had a 100% mortality rate by the fifth and sixth days, respectively. In contrast, 90% of the mice infected with the pep12Δ mutant survived at 30 days (P < 0.0001) (Fig. 10).

Fig. 10.

Fig. 10.

Assessment of virulence in a mouse model of disseminated candidiasis. The C. albicans DAY185, pep12Δ null mutant, and PEP12 reintegrant strains were tested in a mouse tail vein model of disseminated candidiasis. Survival of the mice infected with 106 cells of each Candida strain was monitored for 30 days. Mice infected with DAY185 and the PEP12 reintegrant strain had a 100% mortality rate by days 5 and 6, respectively. In contrast, mice infected with the pep12Δ null mutant had a 10% mortality rate at 30 days (*, P < 0.0001).

DISCUSSION

The major goals of this study were to determine the contribution of the C. albicans prevacuolar secretion pathway gene PEP12 to key pathogenesis-related phenotypes in vitro, biofilm formation, and virulence in vivo. When a search of the C. albicans genome database revealed a close structural homolog of the S. cerevisiae vacuolar protein sorting gene PEP12, we used a complementation approach to study gene function. First, the temperature sensitivity, vacuolar morphology, and vacuolar acidification phenotypes of a S. cerevisiae pep12 null mutant were corrected by plasmids bearing C. albicans PEP12 but not by an empty vector. Taken together, these observations suggested that the gene designated C. albicans PEP12 is both a structural and a functional homolog of S. cerevisiae PEP12. However, it should be noted that overexpression of S. cerevisiae PEP12 suppresses the mutant phenotypes of the S. cerevisiae vam3 null mutant and that overexpression of S. cerevisiae VAM3 suppresses the mutant phenotypes of the S. cerevisiae pep12 null mutant (8, 12, 33). Moreover, Pep12p is structurally similar to the related t-SNAREs Vam3p and Tlg2p, and all of these proteins have transmembrane domains containing 18 amino acids, with high degrees of sequence identity (1). Thus, it remains a possibility that our gene of interest is not the C. albicans homolog of S. cerevisiae PEP12 but instead a closely related t-SNARE gene. However, the C. albicans vam3Δ mutant has been identified and characterized previously (35), and we have generated a null mutant of the putative C. albicans TLG2 homolog (unpublished data).

The C. albicans pep12Δ mutant accumulated 40- to 60-nm vesicles, as seen in the S. cerevisiae pep12 mutant, but unlike its S. cerevisiae counterpart, did not appear to have a characteristic class D vacuole. Similar to the S. cerevisiae pep12 mutant, the C. albicans pep12Δ mutant was defective in vacuolar acidification.

Deletion of C. albicans PEP12 resulted in increased susceptibility to cell wall-stressing compounds such as Congo red and calcofluor white. The C. albicans pep12Δ null mutant had increased sensitivity to amphotericin B, caspofungin, and fluconazole, also suggesting a defect in cell wall or plasma membrane integrity. Overall, these results suggest that intact prevacuolar secretion may be required for normal cell wall and/or plasma membrane integrity. Despite increased sensitivity to cell wall-stressing agents and these specific antifungal agents, growth of the C. albicans pep12Δ mutant was not different from that of control strains in response to acidic or alkaline pH, general osmotic stress, or high temperature.

Like the C. albicans prevacuolar vps4Δ secretory mutant, the C. albicans pep12Δ null mutant produces an increased amount of extracellular proteolytic activity on BSA plates. Although we have not identified the origin of this increased extracellular proteolysis, this secretion phenotype is similar to that of the C. albicans vps4Δ mutant, an avirulent strain in a mouse tail vein model of disseminated candidiasis (20). Using a series of biochemical inhibitors to study the increased extracellular proteolytic activity of the vps4Δ mutant, we identified this activity as serine protease activity. Using a genetic approach, we demonstrated that this increased proteolysis is due likely to missorted vacuolar carboxypeptidase, as a vps4Δ prc1Δ mutant demonstrated wild-type extracellular proteolytic activity. In addition, the C. albicans pep12Δ null mutant had reduced phospholipase activity on Tween 80 and egg yolk agars, also similar to the vps4Δ mutant secretion phenotype (20).

The role of secretory genes in biofilm formation has been studied only in limited fashion. C. albicans VPS1 is important for adhesion and biofilm formation, as a VPS1 conditional mutant forms only a sparse biofilm composed predominantly of pseudohyphal and yeast cells when gene expression is repressed (4). In this study, the C. albicans pep12Δ null mutant appeared to adhere normally in the early stages of biofilm formation. However, by 6 h the pep12Δ biofilm detached from the surface of the plate and fragmented with minimal disturbance. In addition, there was an overall reduction in total biofilm mass. The mechanism of this markedly aberrant biofilm formation has not yet been defined, although findings from structural studies using scanning electron microscopy suggest that there may be a defect in extracellular matrix production.

Whether the observed biofilm phenotype of the pep12Δ mutant is related to the complex, poorly understood phenomenon of biofilm detachment is not known. In transcriptional profiling studies of biofilm detachment using an in vitro flow model, Sellam et al. (32) observed a clear phenotype of detachment at 6 h, with complete detachment at 8 h. However, no change in PEP12 expression was seen in their transcriptional profiling studies of this event.

A number of molecular studies have indicated a role for the vacuole in C. albicans virulence. For example, loss of Vps21p, Ypt72p, Vps11p, and Vps4p has led to attenuated virulence in mouse models of disseminated candidiasis (11, 16, 19, 23). The contribution of the vacuole to Candida virulence has also been assayed using an in vitro macrophage model (5, 22, 30). The importance of C. albicans PEP12 in virulence was apparent in our macrophage experiment using J774A.1 cells; the pep12Δ null mutant was clearly defective in macrophage killing. Next, we found that the pep12Δ null mutant was markedly hypovirulent in a mouse tail vein model of invasive candidiasis, thus providing additional data suggesting that normal vacuolar function is important for Candida virulence.

In these experiments, we have demonstrated that the C. albicans PEP12 homolog is important for normal endocytosis and vacuolar acidification. C. albicans PEP12 also appears to play a major role in biofilm integrity, although the mechanism of the dramatic phenotype of the pep12Δ mutant biofilm is unknown. Finally, it appears that C. albicans PEP12 is required for wild-type virulence in an in vitro macrophage model of pathogenesis and in a standard in vivo mouse model of disseminated candidiasis. We are currently pursuing further studies of PEP12 within a biofilm flow model, as well as genomic and proteomic analyses of the changes in the pep12Δ mutant biofilm, in order to help define the molecular mechanisms responsible for the dramatically fragmented biofilm phenotype.

ACKNOWLEDGMENTS

We thank William Fonzi (Georgetown University) for providing strain SC5314; Aaron P. Mitchell (Carnegie Mellon University) for providing strains DAY185 and BWP17 and plasmids pDDB57, pRS-ARG4ΔSpeI, and pGEM-HIS1; Stella Bernardo (University of New Mexico) for helpful advice; and Rebecca Lee and Genevieve Phillips (Cancer Center Fluorescence Microscopy Facility, University of New Mexico) for assistance with CLSM. We also thank Barbara Hunter (University of Texas Health Science Center at San Antonio) for assistance with scanning electron microscopy.

This work was supported by funding from the Department of Veterans Affairs and the Biomedical Research Institute of New Mexico (to S.A.L) and by NIH award R01 AI075091 (to M.L.).

Footnotes

Published ahead of print on 18 December 2009.

REFERENCES

  • 1.Abeliovich H., Grote E., Novick P., Ferro-Novick S. 1998. Tlg2p, a yeast syntaxin homolog that resides on the Golgi and endocytic structures. J. Biol. Chem. 273:11719–11727 [DOI] [PubMed] [Google Scholar]
  • 2.Ausubel F. M., Brent R., Kingston R. E., Moore D. D., Seidman J. G., Smith J. A., Struhl K. 1993. Current protocols in molecular biology. Wiley, New York, NY [Google Scholar]
  • 3.Becherer K. A., Rieder S. E., Emr S. D., Jones E. W. 1996. Novel syntaxin homologue, Pep12p, required for the sorting of luminal hydrolase to the lysosome-like vacuole in yeast. Mol. Biol. Cell 7:579–594 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bernardo S. M., Khalique Z., Kot J., Jones J. K., Lee S. A. 2008. Candida albicans VPS1 contributes to protease secretion, filamentation, and biofilm formation. Fungal Genet. Biol. 45:861–877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Borg-von Zepelin M., Beggah S., Boggian K., Sanglard D., Monod M. 1998. The expression of the secreted aspartyl proteinases Sap4 to Sap6 from Candida albicans in murine macrophages. Mol. Microbiol. 28:543–554 [DOI] [PubMed] [Google Scholar]
  • 6.Chandra J., Kuhn D. M., Mukherjee P. K., Hoyer L. L., McCormick T., Ghannoum M. A. 2001. Biofilm formation by the fungal pathogen Candia albicans: development, architecture, and drug resistance. J. Bacteriol. 183:5385–5394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Crandall M., Edwards J. E., Jr 1987. Segregation of proteinase-negative mutants from heterozygous Candida albicans. J. Gen. Microbiol. 133:2817–2824 [DOI] [PubMed] [Google Scholar]
  • 8.Darsow T., Rieder S. E., Emr S. D. 1997. A multispecificity syntaxin homologue, Vam3p, essential for autophagic and biosynthetic protein transport to the vacuole. J. Cell Biol. 138:517–529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Davis D., Wilson R. B., Mitchell A. P. 2000. RIM101-dependent and -independent pathways govern pH responses in Candida albicans. Mol. Cell. Biol. 20:971–978 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fu Y., Ibrahim A. S., Fonzi W., Zyou X., Ramos C. F., Ghannoum M. A. 1997. Cloning and characterization of a gene (LIP1) which encodes a lipase from the pathogenic yeast Candida albicans. Microbiology 143:331–340 [DOI] [PubMed] [Google Scholar]
  • 11.Gerrard S. R., Bryant N. J., Stevens T. H. 2000. VPS21 controls entry of endocytosed and biosynthetic proteins into the yeast prevacuolar compartment. Mol. Biol. Cell 11:613–626 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gotte M., Gallwitz D. 1997. High expression of the yeast syntaxin-related Vam3 protein suppresses the protein transport defects of a pep12 null mutant. FEBS Lett. 411:48–52 [DOI] [PubMed] [Google Scholar]
  • 13.Gurunathan S., David D., Gerst J. E. 2002. Dynamin and clathrin are required for the biogenesis of a distinct class of secretory vesicles in yeast. EMBO J. 21:602–614 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Harsey E., Bretscher A. 1995. Parallel secretory pathways to the cell surface in yeast. J. Cell Biol. 131:297–310 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Harsey E., Schekman R. 2002. A subset of yeast vacuolar protein sorting mutants is blocked in one branch of the exocytic pathway. J. Cell Biol. 156:271–285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Johnston D. A., Eberle K. E., Sturtevant J. E., Palmer G. E. 2009. Role for endosomal and vacuolar GTPase in Candida albicans pathogenesis. Infect. Immun. 77:2343–2355 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Klöpper T. H., Kienle C. N., Fasshauer D. 2007. An elaborate classification of SNARE proteins sheds light on the conservation of the eukaryotic endomembrane system. Mol. Biol. Cell 18:3463–3471 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kuhn D. M., Chandra J., Mukherjee P. K., Ghannoum M. A. 2002. Comparison of biofilms formed by Candida albicans and Candida parapsilosis on bioprosthetic surfaces. Infect. Immun. 70:878–888 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lee S. A., Jones J. H., Hardison S., Kot J., Khalique Z., Bernardo S. M., Monteagudo C., Lopez-Ribot J. 2009. Candida albicans VPS4 is required for secretion of aspartyl proteases and in vivo virulence. Mycopathologia 167:55–63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lee S. A., Jones J., Khalique Z., Kot J., Alba M., Bernardo S., Seghal A., Wong B. 2007. A functional analysis of the Candida albicans homolog of Saccharomyces cerevisiae VPS4. FEMS Yeast Res. 7:973–985 [DOI] [PubMed] [Google Scholar]
  • 21.Liu H., Kohler J., Fink G. R. 1994. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266:1723–1726 [DOI] [PubMed] [Google Scholar]
  • 22.Lorenz M. C., Bender J. A., Fink G. R. 2004. Transcriptional response of Candida albicans upon internalization by macrophages. Eukaryot. Cell 3:1076–1087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Palmer G. E., Cashmore A., Sturtevant J. 2003. Candida albicans VPS11 is required for vacuole biogenesis and germ tube formation. Eukaryot. Cell 2:411–421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Palmer G. E., Kelly M. N., Sturtevant J. E. 2005. The Candida albicans vacuole is required for differentiation and efficient macrophage killing. Eukaryot. Cell 4:1677–1686 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Preston R. A., Murphy R. F., Jones E. W. 1989. Assay of vacuolar pH in yeast and identification of acidification-defective mutants. Proc. Natl. Acad. Sci. U. S. A. 86:7027–7031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ramage G., Lopez-Ribot J. L. 2005. Techniques for antifungal susceptibility testing of Candida albicans biofilms. Methods Mol. Med. 118:71–79 [DOI] [PubMed] [Google Scholar]
  • 27.Ramage G., Saville S. P., Wickes B. L., Lopez-Ribot J. L. 2002. Inhibition of Candida albicans biofilm formation by farnesol, a quorum-sensing molecule. Appl. Environ. Microbiol. 68:5459–5463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Raymond C. K., Howald-Stevenson I., Vater C. A., Stevens T. H. 1992. Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell 3:1389–1402 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Roberts C. J., Raymond C. K., Yamashiro C. T., Stevens T. H. 1991. Methods for studying the yeast vacuole. Methods Enzymol. 194:644–661 [DOI] [PubMed] [Google Scholar]
  • 30.Rocha C. R., Schroppel K., Harcus D., Marcil A., Dignard D., Taylor B. N., Thomas D. Y., Whiteway M., Leberer E. 2001. Signalling through adenylyl cyclase is essential for hyphal growth and virulence in the pathogenic fungus Candida albicans. Mol. Biol. Cell 12:3631–3643 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rodier M. H., Imbert C., Kauffmann-Lacroix C., Daniault G., Jacquemin J. L. 2003. Immunoglobulins G could prevent adherence of Candida albicans to polystyrene and extracellular matrix components. J. Med. Microbiol. 52:373–377 [DOI] [PubMed] [Google Scholar]
  • 32.Sellam A., Al-Niemi T., McInnerney K., Brumfield S., Nantel A., Suci P. A. 2009. A Candida albicans early stage biofilm detachment event in rich medium. BMC Microbiol. 9:25–36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Srivastava A., Jones E. W. 1998. Pth1/Vam3p is the syntaxin homolog at the vacuolar membrane of Saccharomyces cerevisiae required for the delivery of vacuolar hydrolases. Genetics 148:85–98 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Thomas D. P., Lopez-Ribot J. L., Lee S. A. 2009. A proteomic analysis of secretory proteins of a pre-vacuolar mutant of Candida albicans. J. Proteomics 73:342–351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Veses V., Richards A., Gov N. 2009. Vacuolar inheritance regulates cell size and branching frequency of Candida albicans hyphae. Mol. Microbiol. 71:505–519 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Vida T. A., Emr S. D. 1995. A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J. Cell Biol. 128:779–792 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.von Mollard G. F., Nothwehr S. F., Stevens T. H. 1997. The yeast v-SNARE Vtilp mediates two vesicle transport pathways through interactions with the t-SNAREs Sed5p and Pep12p. J. Cell Biol. 137:1511–1524 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wilson R. B., Davis D., Enloe B. M., Mitchell A. P. 2000. A recyclable Candida albicans URA3 cassette for PCR product-directed gene disruptions. Yeast 16:65–70 [DOI] [PubMed] [Google Scholar]
  • 39.Wilson R. B., Davis D., Mitchell A. P. 1999. Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181:1868–1874 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Eukaryotic Cell are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES