Skip to main content
PLOS Genetics logoLink to PLOS Genetics
. 2010 Feb 19;6(2):e1000851. doi: 10.1371/journal.pgen.1000851

Analysis of the Legionella longbeachae Genome and Transcriptome Uncovers Unique Strategies to Cause Legionnaires' Disease

Christel Cazalet 1,#, Laura Gomez-Valero 1,#, Christophe Rusniok 1, Mariella Lomma 1, Delphine Dervins-Ravault 1, Hayley J Newton 2, Fiona M Sansom 2, Sophie Jarraud 3, Nora Zidane 4, Laurence Ma 4, Christiane Bouchier 4, Jerôme Etienne 3, Elizabeth L Hartland 2, Carmen Buchrieser 1,*
Editor: Ivan Matic5
PMCID: PMC2824747  PMID: 20174605

Abstract

Legionella pneumophila and L. longbeachae are two species of a large genus of bacteria that are ubiquitous in nature. L. pneumophila is mainly found in natural and artificial water circuits while L. longbeachae is mainly present in soil. Under the appropriate conditions both species are human pathogens, capable of causing a severe form of pneumonia termed Legionnaires' disease. Here we report the sequencing and analysis of four L. longbeachae genomes, one complete genome sequence of L. longbeachae strain NSW150 serogroup (Sg) 1, and three draft genome sequences another belonging to Sg1 and two to Sg2. The genome organization and gene content of the four L. longbeachae genomes are highly conserved, indicating strong pressure for niche adaptation. Analysis and comparison of L. longbeachae strain NSW150 with L. pneumophila revealed common but also unexpected features specific to this pathogen. The interaction with host cells shows distinct features from L. pneumophila, as L. longbeachae possesses a unique repertoire of putative Dot/Icm type IV secretion system substrates, eukaryotic-like and eukaryotic domain proteins, and encodes additional secretion systems. However, analysis of the ability of a dotA mutant of L. longbeachae NSW150 to replicate in the Acanthamoeba castellanii and in a mouse lung infection model showed that the Dot/Icm type IV secretion system is also essential for the virulence of L. longbeachae. In contrast to L. pneumophila, L. longbeachae does not encode flagella, thereby providing a possible explanation for differences in mouse susceptibility to infection between the two pathogens. Furthermore, transcriptome analysis revealed that L. longbeachae has a less pronounced biphasic life cycle as compared to L. pneumophila, and genome analysis and electron microscopy suggested that L. longbeachae is encapsulated. These species-specific differences may account for the different environmental niches and disease epidemiology of these two Legionella species.

Author Summary

Legionella longbeachae, found in potting soil, and L. pneumophila, present in aquatic environments, are opportunistic human pathogens that cause Legionnaires' disease, a severe and often fatal pneumonia. The analysis and comparison of the genome sequences of four L. longbeachae genomes together with the study of its gene expression program and virulence pattern in different infection models provides important new insight on the organism's lifestyle and virulence strategies. L. longbeachae harbors a unique repertoire of secreted substrates, many of which encode eukaryotic like domains that may help the pathogen to subvert host functions and cause disease. Curiously, L. longbeachae may also be able to interact with plants. Several proteins present mainly in plants and phytopathogenic bacteria and several enzymes that might confer the ability to degrade plant material were identified in its genome. Interestingly, L. longbeachae encodes a chemotaxis system but no flagella, in contrast L. pneumophila encodes flagella but no chemotaxis system. It will be an interesting aspect of future research to understand these peculiarities. Finally, the genome sequence and analysis reported here will aid in understanding how L. longbeachae causes disease and will open new possibilities to develop tools for rapid identification and risk prediction of L. longbeachae infection.

Introduction

Legionella longbeachae is one species of the family Legionellaceae that causes legionellosis, an atypical pneumonia that can be fatal if not promptly treated. While Legionella pneumophila is the leading cause of legionellosis in the USA and Europe, and is associated with around 91% of the cases worldwide, L. longbeachae is responsible for approximately 30% of legionellosis cases in Australia and New Zealand and nearly 50% in South Australia [1] and Thailand [2]. Two serogroups (Sg) are distinguished within L. longbeachae but most of the human cases of legionellosis are due to Sg1 strains [3],[4]. Interestingly, unlike L. pneumophila, which inhabits aquatic environments, L. longbeachae is found predominantly in potting soil and is transmitted by inhalation of dust from contaminated soils [4],[5].

Little is known about the biology and the genetic basis of virulence of L. longbeachae but a few studies suggest considerable differences with respect to L. pneumophila. In contrast, the intracellular life cycle of L. pneumophila is well characterized (for recent reviews see [6][8]). L. pneumophila replicates within alveolar macrophages inside a unique phagosome that excludes both early and late endosomal markers, resists fusion with lysosomes and recruits endoplasmic reticulum and mitochondria. Within this protected vacuole L. pneumophila replicates and down-regulates the expression of virulence factors. It has been proposed that nutrient limitation then leads to the transition to transmissive phase bacteria that express many virulence-associated traits allowing the release and infection of new host cells [9]. This biphasic life cycle is observed both in vitro and in vivo as exponential phase bacteria do not express virulence factors and the bacteria fail to evade the destructive lysosomes and are delivered to the endocytic network and destroyed [9],[10]. The ability of L. pneumophila to replicate intracellularly is triggered at the post-exponential phase together with other virulence traits. Less is known about the intracellular life cycle of L. longbeachae and its virulence factors. Unlike L. pneumophila the ability of L. longbeachae to replicate intracellularly is independent of the bacterial growth phase [11]. Phagosome biogenesis is also different. Like L. pneumophila, the L. longbeachae phagosome is surrounded by endoplasmic reticulum and evades lysosome fusion but in contrast to L. pneumophila containing phagosomes the L. longbeachae vacuole acquires early and late endosomal markers [12].

Efficient formation of the L. pneumophila replication vacuole requires the Dot/Icm type IV secretion system (T4SS) [13][16] and probably more than 100 translocated effector proteins that modulate different host cell processes, in particular vesicle trafficking [17][19]. While L. longbeachae possesses all genes necessary to code a Dot/Icm T4SS [20], it is not known whether it is also essential for virulence and whether L. pneumophila and L. longbeachae share common effectors.

Another interesting difference between these two species is their ability to colonize the lungs of mice. While only A/J mice are permissive for replication of L. pneumophila, A/J, C57BL/6 and BALB/c mice are all permissive for replication of L. longbeachae [12],[21]. Resistance of C57BL/6 and BALB/c mice to L. pneumophila has been attributed to polymorphisms in Nod-like receptor apoptosis inhibitory protein 5 (naip5) allele [22][24]. The current model states that L. pneumophila replication is restricted due to flagellin dependent caspase-1 activation through Naip5-Ipaf and early macrophage cell death by pyroptosis. Why L. longbeachae, in contrast to L. pneumophila, is able to replicate in macrophages of all three different mouse strains is still not understood.

In this study we report the complete genome sequencing and analysis of a clinical L. longbeachae Sg1 strain isolated in Australia and compare this genome to three L. longbeachae draft genome sequences (one Sg1 and two Sg2 strains) and the published genome sequences of four L. pneumophila strains [25][27]. In addition, we performed transcriptome analysis and virulence studies of a T4SS mutant of L. longbeachae. This has allowed us to propose answers for the questions raised above and brings exciting new insight into the varying adaptation to different ecological niches and different intracellular life cycles of Legionella species.

Results/Discussion

The L. longbeachae genomes are highly conserved and are 500 kb larger than those of L. pneumophila

The L. longbeachae NSW150 genome consists of a 4,077,332-bp chromosome and a 71,826-bp plasmid with an average GC content of 37.11% and 38.19%, respectively (Table 1). A total of 3512 protein-encoding genes are predicted, 2046 (58.3%) of which have been assigned a putative function (Table S1, Figure S1). The L. longbeachae chromosome is about 500 kb larger than that of L. pneumophila and has a significantly different organization as seen in the synteny plot in Figure 1 and Figure S2. Moreover only 2290 (65.2%) L. longbeachae genes are orthologous to L. pneumophila genes, whereas 1222 (34.8%) are L. longbeachae specific with respect to L. pneumophila Paris, Lens, Philadelphia and Corby (defined by less than 30% amino acid identity over 80% of the length of the smallest protein, s Table S2). It was previously suggested that plasmid-encoded functions such as a two-component system, are important for L. longbeachae virulence [28]. Although no similarity was detected between the L. longbeachae plasmid here characterized and the 9kb partial plasmid sequence reported of strain L. longbeachae A5H5 [28], similar plasmids seem to circulate among different Legionella species, as 30 kb of the plasmid of strains Paris, Lens and NSW150, 18 kb of which encode transfer genes (traI – traA), encoded ORFs showing high amino acid sequence similarity (Figure S3).

Table 1. General features of the completely sequenced L. pneumophila and L. longbeachae genomes.

L. longbeachae L. pneumophila
NSW 150 Paris Lens Philadelphia Corby
Chromosome size (kb)a 4077 (71) 3504 (131.8) 3345 (59.8) 3397 3576
G + C content (%) 37.1 (38.2) 38.3 (37.4) 38.4 (38) 38,27 38
G + C content of CDS (%) 37,4 39,1 39,4 38,6 38,6
No. of genesa 3660 (75) 3136 (142) 3001 (60) 3002 3259
No. of protein coding genesa 3512 (67) 2878 (140) 2878 (60) 2942 3206
Percentage of CDS (%) 84,5 87,9 88 90,2 86,8
Average length of CDS (pb) 1015,2 994,6 935,9 960,7 959,4
No. of 16S/23S/5S 4/4/4 3/3/3 3/3/3 3/3/3 3/3/3
No. transfer RNA 46 44 43 43 43
Plasmids 1 1 1 0 0

a Updated annotation; CDS  =  coding sequence; in parenthesis data from plasmids.

Figure 1. Whole-genome synteny map of L.longbeachae strain NSW150 and L. pneumophila strain Paris.

Figure 1

The linearized chromosomes were aligned and visualized by Lineplot in MAGE. Syntenic relationships comprising at least 8 genes are indicated by green and red lines for genes found on the same strand or on opposite strands, respectively. IS elements (pink), ribosomal operons (blue) and tRNAs (green) are also indicated.

With the aim of gaining further information on genome content and diversity of L. longbeachae we selected three additional strains, two isolated in the USA one in Australia for genome sequencing and analysis. L. longbeachae strain ATCC39642 (Sg1), strain 98072 (Sg2) and strain C-4E7 (Sg2) were deep sequenced using the Illumina technology and then compared to the genome of strain NSW150. We obtained a coverage of 93–96% for each genome with respect to the NSW150 genome (Table 2). The sequences were assembled into 93, 106 and 89 contigs larger than 0.5kbs that were further analyzed regarding gene content and single nucleotide polymorphisms (SNP). High quality SNPs were detected by mapping the Illumina reads on the finished NSW150 genome sequence. This revealed a high conservation in genome size, content, organization and a low SNP number among the four L. longbeachae genomes (Table 2). Interestingly, in contrast to L. pneumophila where strains of the same Sg may have very different gene content [25],[29], the two strains of L. longbeachae each belonging to Sg1 or Sg2, respectively, showed highly conserved genomes. Comparison of the two Sg1 genomes identified 1611 SNPs of which 1426 are located in only seven chromosomal regions mainly encoding putative mobile elements, whereas the remaining 185 SNPs were evenly distributed around the chromosome (Figure S4). In contrast, the SNP number between two strains of different Sg was higher, with about 16 000 SNPs present between Sg1 and Sg2 strains (Table 1, Figure S4). This represents an overall polymorphism of less than 0.4%, which is significantly lower than the polymorphism of about 2% between L. pneumophila Sg1 strains Paris and Philadelphia. The low SNP number and relatively homogeneous distribution of the SNPs around the chromosome (Figure S4) suggest recent expansion for the species L. longbeachae.

Table 2. General features of the L. longbeachae draft genomes obtained by new generation sequencing.

L. longbeachae
NSW 150 ATCC39462 98072 C-4E7
Chromosome size (Kb) 4077 (71) 4096 4018 (133.8) 3979 (133.8)
No. of 16S/23S/5S 4/4/4 4/4/4 4/4/4 4/4/4
G + C content (%) 37.1 (38.2) 37.0 37.0 (37.8) 37 (37.8)
No. of contigs >0.5-300 kb complete 64 65 63
N50 contig size* complete 138 kb 129 kb 134 kb
Percentage of coverage** 100% 96.3 93.4 93.1
Number of SNP with NSW150 1611 16 853 16 820
Plasmids 1 0 1 1

*N50 contig size, calculated by ordering all contig sizes and then adding the lengths (starting from the longest contig) until the summed length exceeds 50% of the total length of all contigs (half of all bases reside in a contiguous sequence of the given size or more);

**for SNP detection

The dot/icm type IVB secretion system is highly conserved, and many other secretion systems are present

L. pneumophila has a rather exceptional number and wide variety of secretion systems for efficient and rapid delivery of effector molecules into the phagocytic host cell underlining the importance of protein secretion for this pathogen. This also holds true for L. longbeachae. We identified the genes coding the Lsp type II secretion machinery, however, 45% of the type II secretion system substrates described for L. pneumophila [30],[31] are absent from L. longbeachae. Furthermore, the twin arginine translocation system (TAT) and three putative type I secretion systems (T1SS) are present. However, the Lss T1SS might not be functional in L. longbeachae as only LssXYZA are conserved (55 to 82% identity with strain Paris) and the two essential components LssB (ABC transporter-ATP binding) and LssD (HlyD family secretion protein) are missing. In contrast, the two additional putative T1SS, encoded by the genes llo2283-llo2288 and llo0441-llo0444 appeared to be functional. Furthermore, two HlyD-like proteins (Llo2901 and Llo0979) localized next to ABC transporters (Llo2900 and Llo0980-Llo0981) were present, but no contiguous outer membrane protein was found. However, these proteins could also be part of T1SS and function together with a genetically unlinked outer membrane component, similar to what is seen for the Hly T1SS of Escherichia coli and may thus constitute two additional T1SS. Finally, L. longbeachae encodes four type IV secretion systems (T4SS). The Lvh T4ASS of L. pneumophila is absent from L. longbeachae but we identified three other type-IVA secretion systems. One T4ASS is present on the plasmid and the other two are embedded on putative mobile genomic islands (GI) in the chromosome. llo1819-llo1929 (GI-1) of around 120 kb is bordered by Ser and Arg tRNAs and carries a gene coding for a phage integrase (llo1819). The second cluster (GI-2) of 106 kb spans from the integrase coding gene llo2859 to llo2960ab and is also bordered by a Met tRNA. Most of the proteins encoded on GI-2 are of unknown function. However both islands code for several proteins, which may be dedicated to stress response. On GI-1, Llo1862 and Llo1863llo1863 are homologous to DNA polymerase IV subunit C and D respectively, involved in the SOS repair pathway. On GI-2 are the OsmC-like protein Llo2923, the putative universal stress proteins Llo2926, Llo2927, Llo2929 and the predicted trancriptional regulator Llo2913 with S24 peptidase domain. Indeed, the S24 peptidase family includes LexA, a transcriptional repressor of SOS response genes to DNA damage. Several transporters were also identified on GI-2: Llo2918 of the MFS superfamily, the Na/H exchange protein Llo2930 and the putative T1SS proteins Llo2900 and Llo2901 discussed above. It possesses in addition a putative restriction/modification system encoded by llo2865, llo2866 and llo2867.

Central to the establishment of the intracellular replicative niche and to L. pneumophila virulence is the Dot/Icm type IV secretion system. This T4BSS is also present in L. longbeachae and the general organization of the genomic region encoding it is conserved with protein identities of 47 to 92% with respect to that of L. pneumophila. This is similar to what has been reported previously for other Legionella species [20]. In L. longbeachae the icmR gene is replaced by the ligB gene, however, the encoded proteins have been shown to perform similar functions [32],[33]. Here we found that IcmE/DotG of L. longbeachae is 477 amino acids larger than that of L. pneumophila. DotG is part of the core transmembrane complex of the secretion system and it is composed of three domains: a transmembrane N-terminal domain, a central region composed of 42 repeats of 10 amino acid and a C-terminal region homologous to VirB10. The central region of DotG from L. longbeachae comprises approximately 90 repeats. It will be challenging to understand the possible impact of this modification on the function of the type-IV secretion system.

The dot/icm type IV secretion system of L. longbeachae is essential for virulence in Acanthamoeba castellanii and in pulmonary mouse infection

To test whether the Dot/Icm T4SS is essential for virulence of L. longbeachae we constructed a deletion mutant in the L. longbeachae NSW150 gene llo0364, homologous to dotA of L. pneumophila and tested its ability to replicate compared to the wild type strain in A. castellanii and the lungs of A/J mice. We found that L. longbeachae NSW150 infects A. castellanii in a comparable manner to L. pneumophila and that the dotA mutant was strongly attenuated for intracellular growth in A. castellanii, similar to what is seen for a L. pneumophila dotA mutant (Figure 2A). Recently Gobin and colleagues established an experimental model of intratracheal L. longbeachae infection in A/J mice [21]. Here we compared the ability of the L. longbeachae dotA mutant to compete with wild type L. longbeachae in the lungs of A/J mice. In mixed infections, we observed that the dotA mutant was outcompeted by the wild type strain 24 h and 72 h after infection (Figure 2B). The competitive index of the dotA mutant was calculated by dividing the ratio of mutant to wild type bacteria after infection with the ratio of mutant to wild type bacteria in the inoculum. A competitive index of less than 0.5 is considered a significant attenuation [34]. The competitive index was less than 0.5 at both time-points indicating rapid loss of the dotA mutant following infection. In single infections, the L. longbeachae dotA mutant was also dramatically attenuated for replication (Figure 2C). Thus, the Dot/Icm secretion system was essential for the virulence of L. longbeachae.

Figure 2. Intracellular growth of the wild-type and the dotA mutant strain in mouse and amoeba infection.

Figure 2

(A) Intracellular replication of L. longbeachae in Acanthamoeba castellanii. Blue, wild-type L. longbeachae strain NSW150; Red, dotA::Km mutant. Results are expressed as log10 CFU. Each time point (in hours, x-axis) represents the mean ± SD of two independent experiments. Infections were performed at 37°C. (B) CI values from mixed infections of A/J mice. Mice were inoculated with approximately 106 CFU of each strain under investigation and were sacrificed at 24 h or 72 h after infection to examine the bacterial content of their lungs. Competition experiment between L. longbeachae and the dotA::Km mutant representative of 2 independent experiments. (C) Single infections of A/J mice with L. longbeachae wt and the dotA::Km mutant strain. Results are expressed as log10 CFU. Note: to maintain numbers in the lung L. longbeachae must be replicating Non-replicating bacteria are cleared in this infection model over 72 h (eg. dotA mutant) [21].

L. longbeachae and L. pneumophila encode different sets of secreted Dot/Icm substrates and virulence genes

Despite the high degree of conservation of the Dot/Icm T4SS components between L. pneumophila and L. longbeachae the Dot/Icm substrates were not highly conserved. Indeed 66% of reported L. pneumophila Dot/Icm substrates were absent from L. longbeachae (Table 3 and Table S3). Instead, we predicted 51 new putative Dot/Icm substrates specific for L. longbeachae that encode eukaryotic-like domains and all but one contained the secretion signal described by Nagai and colleagues [35] and many also the additional criteria defined by Kubori and colleagues [36] (Table 4). Interestingly, the distribution of both, the conserved and the newly identified substrates of L. longbeachae among the four sequenced strains was highly conserved (Table 3 and Table 4). Both L. pneumophila and L. longbeachae replicate within a vacuole that recruits endoplasmic reticulum. Several effector proteins have been shown to contribute to the ability of L. pneumophila to manipulate host cell trafficking events resulting in this association. The effector proteins SidJ, RalF, VipA, VipF, SidC, YlfA and LepB which contribute to trafficking or recruitment and retention of vesicles to L. pneumophila vacuoles were conserved in L. longbeachae, but VipD, SidM/DrrA and LidA which interfere also with these events are absent from the L. longbeachae genome; however VipD and SidM/DrrA are also not present in all the L. pneumophila genomes sequenced.

Table 3. Distribution of selected Dot/Icm substrates of L. pneumophila in the L. longbeachae genomes.

L. pneumophila L. longbeachae Name Description
Phila-1 Paris Lens Corby NSW150 A B C
lpg0012 lpp0012 lpl0012 lpc0013 llo0432 + + + cegC1 Ankyrin repeat
lpg0038 lpp0037 lpl0038 lpc0039 ankQ/legA10 Ankyrin repeat
lpg0103 lpp0117 lpl0103 lpc0122 llo3312 + + + vipF GNAT family
lpg0171 lpp0233 lpl0234 legU1 F-box motif
lpg0234 lpp0304 lpl0288 lpc0309 llo0425 + + + sidE/laiD Unknown
lpg0257 lpp0327 lpl0310 lpc0334 llo2362 + + + sdeA Multidrug resistance protein
lpg0276 lpp0350 lpl0328 lpc0353 llo0327 + + + legG2 Ras guanine nucleotide exchange
lpg0376 lpp0443 lpl0419 lpc2967 sdhA GRIP, coiled-coil
lpg0390 lpp0457 lpl0433 lpc2954 llo2824 + + + vipA Unknown
lpg0402 ankY/legA9 Ankyrin, STPK
lpg0403 lpp0469 lpl0445 lpc2941 ankG/ankZ/ legA7 Ankyrin
lpg0436 lpp0503 lpl0479 lpc2906 ankJ/legA11 Ankyrin
lpg0483 lpp0547 lpl0523 lpc2861 llo2705 + + + ankC/legA12 Ankyrin
lpg0621 lpp0675 lpl0658 lpc2673 sidA Unknown
lpg0642 lpp0696 lpl0679 lpc2651 wipB Unknown
lpg0695 lpp0750 lpl0732 lpc2599 ankN/ankX legA8 Ankyrin
lpg0940 lpp1002 lpl0971 lpc2349 lidA Unknown
lpg1227 lpp1235 lpl1235 lpc0696 vpdB Acyl transferase/hydrolase
lpg1328 lpp1283 lpl1282 lpc0743 legT Thaumatin domain
lpg1355 lpp1309 sidG Coiled-coil
lpg1488 lpp1444 lpl1540 lpc0903 lgt3/legc5 Coiled-coil
lpg1588 lpp1546 lpl1437 lpc1013 legC6 Coiled-coil
lpg1642 lpp1612* lpl1384 lpc1071 llo1144 + + + sidB Rtx toxin, lipase
lpg1701 lpp1666 lpl1660 lpc1130 ppeA/legC3 Coiled-coil
lpg1718 lpp1683 lpl1682 lpc1152 ankI/legAS4 Ankyrin
lpg1884 lpp1848 lpl1845 lpc1331 ylfB/legC2 Coiled-coil
lpg1950 lpp1932 lpl1919 lpc1423 llo1397 + + + ralF Sec-7 domain
lpg1953 lpp1935 lpl1922 lpc1426 legC4 Coiled-coil
lpg1978 lpp1961 lpl1955 lpc1464 setA Putative Glycosyltransferase
lpg2137 lpp2076 lpl2066 lpc1586 legK2 STPK
lpg2144 lpp2082 lpl2072 lpc1593 ankB/legAU13ceg27 Ankyrin, F-box
lpg2155 lpp2094 lpl2083 lpc1604 llo3096 + + + sidJ Unknown
lpg2157 lpp2096 lpl2085 lpc1618 sdeC Unknown
lpg2176 lpp2128 lpl2102 lpc1635 legS2 Sphingosine-1-phosphate lyase 1
lpg2222 lpp2174 lpl2147 lpc1689 lpnE Sel-1 repeats
lpg2298 lpp2246 lpl2217 lpc1763 llo1707 + + + ylfA/legC7 Coiled-coil
lpg2300 lpp2248 lpl2219 lpc1765 llo0584 + + + ankH/legA3/ankW Ankyrin, NFkappaB inhibitor
lpg2322 lpp2270 lpl2242 lpc1789 llo0570 + + + ankK/legA5 Ankyrin
lpg2452 lpp2517 lpl2370 lpc2026 ankF/legA14/ceg31 Ankyrin
lpg2456 lpp2522 lpl2375 lpc2020 llo0365 + + + ankD/legA15 Ankyrin
lpg2464 lpl2384 sidM/drrA Unknown
lpg2465 lpl2385 sidD Unknown
lpg2490 lpp2555 lpl2411 lpc1987 llo0796 + + + lepB Coiled-coil, Rab1 GAP
lpg2508 lpp2576 lpl2430 lpc1963 sdjA Unknown
lpg2511 lpp2579 lpl2433 lpc1959 llo3098 + + + sidC PI(4)P binding domain
lpg2556 lpp2626 lpl2481 lpc1906 llo2218 + + + legK3 STPK
lpg2584 lpp2637 lpl2507 lpc0561 sidF Unknown
lpg2718 lpp2775 lpl2646 lpc0415 wipA Unknown
lpg2793 lpp2839 lpl2708 lpc3079 lepA Coiled-coil
lpg2829 lpp2883 sidH Unknown
lpg2830 lpp2887 lubX/legU2 U-box motif
lpg2831 lpp2888 lpl4276 VipD Patatin-like phospholipase
Lpg2999 lpp3071 lpl2927 lpc3315 legP Astacin protease

*pseudogene, lpp1612a et 1612b; A: L. longbeachae strain ATCC39462; B: 98072; C: C-4E7.

Table 4. Putative new type IV secretion substrates specific for L. longbeachae.

NSW150 ATCC39462 98072 c-4E7 Motif A B C
llo0037 + + + ankyrin + 42,86 60,00
llo0087 + + + ankyrin + 57,14 53,33
llo0115 + + + ankyrin + 28,57 53,33
llo0246 + + + ankyrin + 28,57 66,67
llo0990 + --- --- ankyrin + 28,57 46,67
llo1043 + + + ankyrin + 28,57 46,67
llo1142 + + + ankyrin + 28,57 53,33
llo1168 + + + ankyrin + 28,57 53,33
llo1371 + + + ankyrin, coiled-coil + 28,57 66,67
llo1395 + + + ankyrin + 42,86 53,33
llo1618 + + + ankyrin + 28,57 66,67
llo1646 + + + ankyrin + 28,57 40,00
llo1651 + + + ankyrin + 14,29 60,00
llo1715 + + * + * ankyrin + 28,57 40,00
llo1742 + + + ankyrin + 57,14 46,67
llo1894 + + + ankyrin + 28,57 66,67
llo2133* + + + ankyrin + 0,00 33,33
llo2476 + + + ankyrin + 14,29 46,67
llo2668 + + + ankyrin + 14,29 46,67
llo3081 + + + ankyrin, patatin-like phospholipase + 28,57 60,00
llo3093 + + + ankyrin, STPK + 0,00 66,67
llo3343 + + + ankyrin + 14,29 33,33
llo3353 + + + ankyrin, NUDIX hydrolase + 28,57 53,33
llo0114 + + + LRR + 14,29 40,00
llo1314 + + + LRR + 0,00 40,00
llo2165 + + + LRR + 42,86 66,67
llo2494 + + + LRR + 28,57 66,67
llo3116 --- --- --- LRR + 57,14 26,67
llo3118 --- --- --- LRR + 28,57 66,67
llo1139 + + + STPK + 14,29 33,33
llo1681 + + + STPK + 42,86 73,33
llo2132 + + + STPK, coiled-coil - 14,29 73,33
llo2984 + + + STPK + 14,29 53,33
llo3049 + + + STPK + 14,29 66,67
llo1984 + + + STPK + 14,29 33,33
llo1427 + + + F-Box + 14,29 66,67
llo2109 + + + F-Box + 28,57 60,00
llo0448 + + + U-Box + 28,57 73,33
llo1404 + + + PPR + 28,57 20,00
llo2643 + + + PPR, coiled-coil + 28,57 46,67
llo2200 + + + TTL + 14,29 53,33
llo2327 + + + SH2 + 28,57 73,33
llo2352 + + + PAM2 + 42,86 60,00
llo1196 + + + Snare + 0,00 73,33
llo2381 + + + Snare + 42,86 60,00
llo0793 + + + Phosphatidylinositol-4-phosphate 5-kinase + 28,57 66,67
llo3288 + + + Ras-related small GTPase domain + 14,29 60,00
llo2329 + + + Ras-related small GTPase, Miro-like domain + 28,57 60,00
llo2249 + + + Miro-like domains + 57,14 80,00
llo1716 + + + Ras-related small GTPase, Miro-like domain + 28,57 73,33
llo1892 + + + Putative Immunoglobulin I-set domain + 14,29 40,00

(A) Presence of a hydrophobic residue or a proline in positions -3 or -4 according to [35]. (B) Enrichment in amino acids that have small side-chains (alanine, glycine, serine and threonine) at positions -8 to -2 according to [36]. (C) Percentage of Polar aminoacids that are favored at positions −13 to +1 according to [36].

Although L. pneumophila also communicates with early and late endosomal vesicle trafficking pathways [37][39], a major difference in the phagosome maturation of the two species is that the L. longbeachae phagosome acquires early and late endocytic markers. Several proteins identified specifically in the genome of L. longbeachae may contribute to these differences. First, L. longbeachae encodes a family of Ras-related small GTPases (Llo3288, Llo2329, Llo1716 and Llo2249) (Figure S5), which may also be involved in vesicular trafficking and account for the specificities of the L. longbeachae life cycle. Remarkably, Llo3288, Llo2329 and Llo1716 are the first small GTPases of the Rab subfamily described in a prokaryote. L. pneumophila is also known to exploit monophosphorylated host phosphoinositides (PI) to anchor the effector proteins SidC, SidM/DrrA, LpnE and LidA to the membrane of the replication vacuole [34], [40][44]. L. longbeachae may employ an additional strategy to interfere with the host PI as Llo0793 is homologous to a mammalian PI metabolizing enzyme phosphatidylinositol-4-phosphate 5-kinase and it is tempting to speculate that this protein allows direct modulation of the host cell PI levels.

As another strategy to alter host trafficking pathways, L. pneumophila is able to target microtubule-dependent vesicular transport. AnkX/AnkN, for example, prevents microtubule-dependent vesicular transport interfering with the fusion of the L. pneumophila-containing vacuole with late endosomes [45]. AnkX/AnkN is absent from L. longbeachae, however L. longbeachae did encode a putative tubulin-tyrosine ligase (TTL) Llo2200, which adds to the 19 bacterial TTL identified to date. TTL catalyzes the ATP-dependent post-translational addition of a tyrosine to the carboxy terminal end of detyrosinated alpha-tubulin. Although the exact physiological function of alpha-tubulin has so far not been established, it has been linked to altered microtubule structure and function [46]. Besides AnkX/AnkN, a large family of ankyrin repeat constitutes L. pneumophila Dot/Icm substrates. Interestingly, 23 of the 29 ankyrin proteins identified in the L. pneumophila strains are absent from the L. longbeachae genome, however L. longbeachae encodes 23 specific ankyrin repeat proteins (Table 4).

L. pneumophila is also able to interfere with the host ubiquitination pathway. The U-box protein LubX, which possesses in vitro ubiquitin ligase activity specific for the eukaryotic Cdc2-like kinase Clk1 [36], is absent from L. longbeachae. However, llo0448 encodes a predicted U-box protein. None of the three L. pneumophila F-box proteins, which may also exploit this pathway, are conserved in L. longbeachae, but we identified two new putative F-box proteins Llo1427 and Llo2109 (Table 4). Thus, although the specific proteins may not be conserved, the eukaryotic-like protein-protein interaction domains found in L. pneumophila are also present in L. longbeachae.

L. longbeachae also encodes several proteins with eukaryotic domains that are not present in L. pneumophila. One is the above-mentioned protein Llo2200 encoding a TTL domain. A second is Llo2327, the first bacterial protein that encodes an Src Homology 2 (SH2) domain. SH2 domains, in eukaryotes, have regulatory functions in various intracellular signaling cascades. Furthermore, L. longbeachae encodes two proteins (Llo1404 and Llo2643) with pentatricopeptide repeat (PPR) domains. This family seems to be greatly expanded in plants, where they appear to play essential roles in organellar RNA metabolism [47][49]where they appear to play essential roles in RNA/DNA metabolism, where. Only 12 bacterial PPR domain proteins have been identified to date, all encoded by two species, the plant pathogens Ralstonia solanacearum and the facultative photosynthetic bacterium Rhodobacter sphaeroides.

L. longbeachae encodes putative toxins

Recently, a family of cytotoxic glucosyltransferases produced by L. pneumophila (Lgt) and related to the group of clostridial glucosylating cytotoxins has been described [50],[51]. The three studied enzymes Lgt1/2/3 target one host molecule, eEF1A, and have been implicated in inhibition of eukaryotic protein synthesis and target-cell death [52]. L. longbeachae encodes two putative specific cytotoxic glucosyltransferases Llo1721 and Llo1578. They share only low homology with the L. pneumophila Lgt proteins with 23% protein identity over 62% of the protein length and 36% protein identity over 32% of the length, respectively. However, the DXD motif that is critical for enzymatic activity of clostridial enzymes is conserved suggesting that these enzymes might also be active in L. longbeachae. We also identified Llo3231 as another putative specific glucosyltransferase with a DXD motif, distantly related to the L. pneumophila SetA protein (23% protein identity over 67% of the protein length). SetA is known to cause delay in vacuolar trafficking [53], however its glucosylating activity remains to be established. In contrast, L. longbeachae does not encode a homologue of the L. pneumophila structural toxin protein RtxA, however we identified a homolog of the TcaZ toxin (Llo1558) present in the insect pathogen Photorhabdus luminescens [54].

Many metabolic features of the genome of L. longbeachae reflect its soil habitat

L. longbeachae encodes a variety of proteins probably devoted to the metabolism of compounds present in plant cell walls, going in hand with the fact that that bacterium can be isolated from composted plant material. The main components of the plant cell wall are cellulose, hemicellulose and pectin. Cellulose utilization by microorganisms involves endo-1,4-beta-glucanases, cellobiohydrolases and β-glucosidases, that act synergically to convert cellulose to glucose. Examination of the L. longbeachae genome sequence revealed the presence of twelve such cellulolytic enzymes. Five glucanases, four cellobiohydrolases and three β-glucosidases are present. Interestingly, L. pneumophila also encodes two putative endo-1,4-beta-glucanases and one putative β-glucosidase but does not encode any cellobiohydrolase.

Within the plant cell wall, the cellulose microfibrils are linked via hemicellulosic tethers to form the cellulose-hemicellulose network, which is embedded in the pectin matrix. To gain access to cellulose in plant material, pectin and hemicellulose hydrolysis is necessary. Interestingly, L. longbeachae encodes three pectin lyases (Llo1693, Llo1410, Llo1162). The last two proteins possess a signal peptide and may therefore be secreted. Pectin lyases are virulence factors usually found in phytopathogenic microorganisms that degrade the pectic component of the plant cell wall. In addition to these specific enzymes and similar to L. pneumophila, L. longbeachae encodes a protein homologous to endo-1,4-beta-xylanase. Endo-1,4-beta-xylanase hydrolyses xylan the most common hemicellulose polymer in the plant kingdom and the second most abundant polysaccharide on earth. So, unlike L. pneumophila, which does not possess cellobiohydrolase and pectin lyase, L. longbeachae seems to be fully equipped to utilize cellulose as a carbon source (Table 5). Soil bacteria also often hydrolyse chitin by the means of chitinases to use it as a carbon source. Chitin originates mainly from the cell wall of fungi and cuticles of crustaceans or insects. In line with the fact that L. longbeachae is isolated from soil, we found two chitinases (Llo0050, Llo1558) that are predicted to be secreted proteins. However, the homologue of ChiA from L. pneumophila that was shown to be involved in infection of lungs of A/J mice [31] is absent from L. longbeachae.

Table 5. Predicted L. longbeachae enzymes that may be involved in cellulose degradation.

Gene Annotation SignalP Predicted localization (PSORTb+) ATCC39462 98072 c-4E7 Homology with L. pneumophila
llo2355 Putative endo-1,4-beta-glucanase + Unknown 100% 99% 99%
llo3308 Putative endo-1,4-beta-glucanase + Unknown 100% 99% 99% lpp1893/lpg1918/lpl1882/LPC_1372
llo3305 Putative endo-1,4-beta-glucanase + Unknown 100% 99% 99% lpp0546/lpg0482/lpl0522/LPC_2862
llo1381 Putative endo-1,3(4)-beta-glucanase + Unknown 100% 99% 99%
llo0032 Putative cellobiohydrolase + Unknown 100% 99% 99%
llo0965 Putative cellobiohydrolase + Extracellular 100% 98% 98%
llo1892 Putative cellobiohydrolase + Extracellular 100% 99% 99%
llo2999 Putative cellobiohydrolase + Unknown 100% 99% 99%
llo1023 Putative beta-glucosidase + Unknown 100% 99% 99% lpp1193/lpg1191/lpl1199/LPC_0658
llo0330 Putative beta-glucosidase Cytoplasmic 100% 99% 99%
llo2462 Putative beta-glucosidase Cytoplasmic 100% 99% 99% lpp0946/lpg0885/lpl0916/LPC_2408
llo0816 Putative endo-1,4-beta-xylanase + Unknown 100% 99% 99% lpp0767/lpg0712/lpl0749/LPC_2581
llo1693 Putative pectin lyase Unknown 100% 96%* 96%*
llo1410 Putative pectin lyase + Extracellular 100% 99% 99%
llo1162 Putative pectin lyase + Extracellular 100% 99% 99%

*: frameshift at the N-terminus

+ PSORTb bacterial protein localization prediction tool (http://www.psort.org/psortb/)

Interestingly, L. longbeachae encodes a putative cyanophycin synthase (Llo2537) and therefore may be able to synthesize cyanophycin. Cyanophycin is an amino acid polymer composed of an aspartic acid backbone and arginine side groups. It serves as a storage compound for nitrogen, carbon and energy in many cyanobacteria. Acinetobacter baylyi strain ADP1 was the first non-cyanobacterial strain shown to synthesize cyanophycin, a metabolic capacity that is still restricted to only few prokaryotes [55][58]. L. longbeachae also harbors a putative cyanophycinase (Llo2536) enabling the degradation of cyanophycin to dipeptides and a dipeptidase (Llo2535) necessary to hydrolyze beta-Asp-Arg dipeptides. L. longbeachae may thus be able to completely utilize cyanophycin, providing a mechanism for energy supply under substrate-limited conditions.

Genome and electron microscopy analysis indicates that L. longbeachae encodes a capsule

In the genome of L. longbeachae NSW150 we identified two gene clusters encoding proteins that are predicted to be involved in production of lipopolysaccharide (LPS) and/or capsule (Figure 3). Neither shared homology with the L. pneumophila LPS biosynthesis gene cluster. One region of 48 kb spans from llo3148 to llo3180 (Figure 3A) and the second of 24 kb from llo0217 to llo0236 (Figure 3B). In total they contain 26 genes for synthesis of the nucleotide sugar precursor, 12 genes encoding putative glycosyltransferases, 5 polysaccharide translocation genes including homologs of the ctrABCD capsule transport operon of N. meningitidis, and 10 genes of unknown function (Table S4). The finding that L. longbeachae might be encapsulated was further substantiated by electron microscopy analysis. Figure 4 shows that a capsule-like structure surrounds the bacteria.

Figure 3. Putative capsule and LPS encoding loci in the genome of L. longbeachae.

Figure 3

(A) 48 kb chromosomal region highly conserved in the four L. longbeachae genomes sequenced putatively encoding the capsular biosynthesis genes. (B) 24 kb chromosomal region differing between Sg1 and Sg2 isolates putatively encoding the lippolysaccaride biosynthesis genes of L. longebachae. Colors indicate different classes of genes: magenta, synthesis pathway of nucleoside sugar precursors; blue, glycosyltranferase; yellow transportation; grey, genes of unknown.

Figure 4. Electron microscopy showing the presence of capsule like structures.

Figure 4

Transmission electron micrographs of L. longbeache cells cultured in BYE broth to post exponential growth phase (OD600 3.8). Black arrows, puative capsule structures, red Arrow, putative pili.

Gene clusters encoding the core lipopolysaccharide of L. pneumophila and L. longbeachae are not conserved; however we identified in the genome of L. longbeachae homologs of L. pneumophila lipidA biosynthesis genes. Llo2684, Llo1461, Llo2686 and Llo0524 are homologous to LpxA, LpxB, LpxD and WaaM lipidA biosynthesis proteins with respectively 84%, 68%, 60% and 78% of identity. Predictions deduced from the sequence analysis of strain NSW150 did not clarify which region was coding for the LPS and which for the capsule. Further insight into the LPS and capsule encoding regions came from the comparison of this region among the four L. longbeachae genomes sequenced. The 24 kb region B is identical between the two Sg1 strains sequenced and identical between the two Sg2 strains analyzed, but the Sg1 and Sg2 strains differed from each other in an approximately 10 kb region carrying glycosyltransferases, methyltransferases, and LPS biosynthesis proteins (Figure S6). In contrast the putative capsule encoding region A was highly conserved among all four strains sequenced except for a region carrying three genes, that differed among all four strains independent of the Sg. However, as it is not known whether the Sg specificity of L. longbeachae is defined by its capsule or by LPS, further studies are necessary to clearly define the function of the proteins encoded in these two genomic regions.

L. longbeachae does not encode flagella explaining differences in mouse susceptibility as compared to L. pneumophila

Cytosolic flagellin of L. pneumophila triggers Naip5-dependent caspase-1 activation and subsequent proinflammatory cell death by pyroptosis in C57BL/6 mice rendering these mice resistant to infection with L. pneumophila [22][24], [59][62]. In contrast, caspase-1 activation does not occur upon infection of C57BL/6 and A/J mice macrophages with L. longbeachae, which is then able to replicate. One possible explanation has been that due to a lack of pore-forming activity, L. longbeachae flagellin may not have access to the cytoplasm of the macrophage where it is thought to be involved in caspase-1 activation. Alternatively, L. longbeachae flagellin may not be recognized by the Naip5 pathway [11]. Genome analysis clarified this issue, as we found that L. longbeachae does not carry any flagellar biosynthesis genes except the sigma factor FliA, the regulator FleN, the two-component system FleR/FleS and the flagellar basal body rod modification protein FlgD. Interestingly, as shown in Figure 5, all genes bordering flagellar gene clusters were conserved between L. longbeachae and L. pneumophila, suggesting deletion of these regions from the L. longbeachae genome. Furthermore, not a single homologue of flagellar biosynthesis genes could be identified in other parts of the genome. Analysis of the three additional genome sequences of strains L. longbeachae ATCC39642, 98072 and C-4E7 confirmed the results. To further investigate this unexpected result, we designed primers in the conserved flanking genes to analyze these genomic regions in 15 L. longbeachae strains. All strains tested, eleven of Sg1 and four of Sg2, displayed the same organization as the sequenced strain (Table S5). According to these results, we propose that L. longbeachae fails to activate caspase-1 due to the lack of flagellin, which may also partly explain the differences in mouse susceptibility to L. pneumophila and L. longbeachae infection. The putative L. longbeachae capsule may also contribute to this difference.

Figure 5. Alignment of the chromosomal regions of L. pneumophila and L. longbeachae coding the flagella biosynthesis genes.

Figure 5

The comparison shows that all except the regulatory genes are missing in L. longbeachae. Red, conserved regulator encoding genes, grey arrows orthologous genes among the genomes, white arrows, non orthologues genes.

Although L. longbeachae does not encode flagella, it encodes a putative chemotaxis system. Chemotaxis enables bacteria to find favorable conditions by migrating towards higher concentrations of attractants. The chemotactic response is mediated by a two-component signal transduction pathway, with the histidine kinase CheA and the response regulator CheY, putatively encoded by the genes llo3302 and llo3303 respectively, in the L. longbeachae genome. Furthermore, two homologues of the ‘adaptor’ protein CheW (encoded by llo3298, llo3300) that associate with CheA or cytoplasmic chemosensory receptors are present. Ligand-binding to receptors regulates the autophosphorylation activity of CheA in these complexes. The CheA phosphoryl group is subsequently transferred to CheY, which then diffuses away to the flagellum where it modulates motor rotation. Adaptation to continuous stimulation is mediated by a methyltransferase CheR encoded by llo3299 in L. longbeachae. Together, these proteins represent an evolutionarily conserved core of the chemotaxis pathway, common to many bacteria and archea [55],[63]. A similar chemotaxis system is also present in L. drancourtii LLAP12 [64] but it is absent from L. pneumophila. The flanking genomic regions are highly conserved among L. longbeachae and all L. pneumophila strains sequenced, suggesting that L. pneumophila, although it encodes flagella has lost the chemotaxis system encoding genes.

We also observed using electron microscopy (Figure 4) that L. longbeachae possesses a long pilus-like structure. Indeed, all genes necessary to code for type IV pili are present in the genome of L. longbeachae and are, with 63–88% amino acid similarity, highly conserved between L. longbeachae and L. pneumophila. Taken together genome analysis revealed interesting features of the Legionella genomes: both encode pilus-like structures, in contrast L. longbeachae encodes a chemotaxis system but no flagella, and L. pneumophila encodes flagella but no chemotaxis system. It will be an interesting aspect of future research to understand these particular features of the two Legionella species.

The regulatory repertoire of L. longbeachae suggests different adaptation mechanisms as compared to L. pneumophila

Similar to the L. pneumophila genomes and consistent with its intracellular lifestyle, the regulatory repertoire of L. longbeachae is rather small. Genome analysis identified 121 transcriptional regulators (113–116 in the four sequenced L. pneumophila genomes), which represent only 3.0% of the predicted genes (Table S6). Similar to L. pneumophila, L. longbeachae encodes six putative sigma factors, RpoD, RpoH, RpoS, RpoN, FliA and the ECF-type sigma factor RpoE.

The most abundant class of regulators of L. pneumophila is the GGDEF/EAL family (24 or 23 in all L. pneumophila genomes sequenced). This is significantly different in L. longbeachae, as we identified only 14 GGDEF/EAL domain-containing regulators, despite the larger size of the L. longbeachae genome. Furthermore, this group of regulators may fulfill specific functions in L. longbeachae, since most of the regulators possess no orthologs in the L. pneumophila genomes (Table S6). The function of these regulators in L. pneumophila and L. longbeachae is unknown, but in other bacteria these regulators play a role in aggregation, biofilm formation, twitching motility or flagella regulation. In L. pneumophila it was suggested, as deduced from gene expression analysis, that some of the GGDEF/EAL regulators may play a role in modulating flagella expression [65],[66], thus the lower number of GGDEF/EAL domain-containing proteins of L. longbeachae may in part be related to the missing flagellum.

Another difference in the regulatory repertoire of the two Legionella species was observed for two component systems. There are 14 response regulators and 13 histidine kinases in L. pneumophila, and 17 response regulators and 16 histidine kinases in the L. longbeachae genome, but only half of the L. longbeachae response regulators possess an ortholog in L. pneumophila. For example the recently described two-component system LqsS/LqsR that is part of a quorum sensing system in L. pneumophila is missing in L. longbeachae [67][69]. Two-component systems are involved in signal transduction pathways that enable bacteria to sense, respond, and adapt to a wide range of environments, stressors, and growth conditions [70]. Different two-component systems may be linked to the different environments to which L. longbeachae has to adapt compared to L. pneumophila.

In L. longbeachae, cyclic AMP may also transduce cellular signals as the genome encodes eight class III adenylate cyclases (Llo0181, Llo1751, Llo2196, Llo1669, Llo0753, Llo1197, Llo1216, Llo3304) of which only one (Llo0181) is also conserved in L. pneumophila. LadC, an adenylate cyclase of L. pneumophila that was shown to have a significant role in the initiation of infection in vitro and in vivo [71], is absent from L. longbeachae. As shown for Pseudomonas aeruginosa, these class III adenylate cyclases may sense environmental signals ranging from nutritional content of the surrounding media to the presence of host cells and control virulence gene expression accordingly [72]. Furthermore, 13 proteins containing cAMP binding motifs were identified, only one of which is shared with L. pneumophila, again indicating specific regulatory circuits for L. longbeachae. This high number of proteins that may sense cAMP indicates the potential importance of this signaling molecule in L. longbeachae.

In contrast, the regulators shown to be important for growth phase and life cycle dependent gene expression, such as the two component system LetA/LetS (Lllo2653/llo1235), the RNA-binding protein CsrA (Llo2071), the two small RNAs RsmY and RsmZ regulating CsrA [66],[73], SpoT (Llo0908) and RelA (Llo1756) are conserved in L. longbeachae. Likewise, the two-component systems PmrAB (Llo1159/Llo1158) and CpxRA (Llo1781/Llo1782) that regulate the Dot/Icm T4SS system and some of its substrates are both conserved in L. longbeachae [74][76].

Global gene expression analysis reveals differences in the L. longbeachae and L. pneumophila life cycles

It has been shown in several studies that L. pneumophila exhibits at least two developmental stages, a replicative/avirulent and a transmissive/virulent phase that are each characterized by the expression of specific traits [9]. These stages are also reflected in a major shift in the gene expression program of L. pneumophila between the two phases of its life cycle [65]. In order to investigate, whether L. longbeachae had a similar biphasic life cycle we studied its gene expression program in exponential and post exponential growth phase in vitro. A multiple-genome microarray was constructed containing 10 692 gene-specific oligonucleotides representing 3567 genes predicted in the genome and on the plasmid and 3010 oligonucleotides specific for intergenic regions. RNA of in vitro grown bacteria was sampled at OD 2.5 (exponential growth) and at OD 3.7 (post exponential growth) and the global gene expression program was compared.

Overall, 187 genes in L. longbeachae were upregulated in the exponential (E) phase (likewise, downregulated in the postexponential phase, Table S7), and 313 genes were upregulated in the postexponential (PE) phase (downregulated in the E phase, Table S8). Real-time PCR analysis of selected genes validated the microarray results (data not shown). If we compare these results to those obtained for L. pneumophila grown in vitro [65], we observed several differences. In L. pneumophila strain Paris 543 genes are upregulated in E phase. Of the genes present in both genomes 270 are only upregulated in L. pneumophila but not in L. longbeachae. The 117 genes that are upregulated in both species in exponential phase include many ribosomal proteins, the genes belonging to the ATP synthase machinery (atp genes), the NADH deshydrogenase (nuo genes), most of the genes involved in translocation systems (sec genes) and several enzymatic activities (Table S7). However, several metabolic pathways clearly induced in E phase in L. pneumophila are not induced in L. longbeachae. These include the formyl THF biosynthesis, the purine and pyrimidine and the tetrahydrofolate biosynthesis pathways. Furthermore, genes coding for several chaperones (DnaJ, DnaK or GroES), the regulatory protein RecX and several proteins related to starvation and stress are not upregulated in E phase L. longbeachae. There are only 11 genes specific for L. longbeachae and induced in E phase, all of which code proteins for which no function could be predicted.

In PE phase 313 genes are upregulated in L. longbeachae, of which only 53 are also among the 441 PE phase genes of L. pneumophila. Interestingly, 208 of the genes upregulated in PE in L. longbeachae have no orthologs in L. pneumophila, and for 70% of these no function could be predicted. Thus the response of L. longbeachae to PE phase growth is distinct from that of L. pneumophila. In particular we observed differences in the expression profiles of many factors known to be involved in L. pneumophila virulence. For example, of the genes coding putative substrates of the Dot/Icm secretion system only few, sidC (llo3098), sdhB (llo2439), sidE homologue (llo2210), sdeC/laiC (llo3092) and sdeB/laiB (llo3095) are upregulated in post-exponential phase. However, several of the newly identified putative substrates are induced in L. longbeachae in PE phase. These comprise seven proteins homologous to Sid proteins of L. pneumophila (Llo0424, Llo0426, Llo2210, Llo2439, Llo3092, Llo3095 and Llo3098), three genes coding homologues of EnhA (llo0852, llo1475 and llo2343), three ankyrin proteins (Llo0115, Llo1646 and Llo1715) and a putative serine threonine kinase (Llo1139). However, clear differences in gene expression between L. pneumophila and L. longbeachae exist and the switch from replicative to transmissive phase seems to be less pronounced in L. longbeachae than in L. pneumophila. Interestingly, the genes coding the stationary phase sigma factor RpoS and the sigma factor 28 (FliA) and CsrA, all involved in the regulation of the biphasic life cycle of L. pneumophila are not differentially regulated in L. longbeachae. In contrast, seven GGDEF/EAL domain-containing regulators (llo0090, llo1253, llo1377, llo2005, llo3125, llo3392 and llo3414) and four cAMP binding proteins (llo3395, llo2387, llo2141 and llo1336) are induced in PE phase. Thus cyclic di-GMP and cAMP may be important signaling molecules for regulating PE phase traits of L. longbeachae. According to our transcriptome analysis, the switch in the lifecycle of L. longbeachae appears less pronounced as compared to L. pneumophila, and regulation may be achieved mainly by secondary messenger molecules.

Concluding remarks

L. longbeachae is the second leading cause of Legionnaires' disease in the world and a major cause of pneumonia in Australia and New Zealand. Yet, still very little is known about its virulence strategies and the genetic basis of virulence and niche adaptation. Analysis of the genome sequences of four L. longbeachae strains and its comparison with the published L. pneumophila genomes has uncovered important differences in the genetic repertoire of the two species and suggests different strategies for intracellular replication and niche adaptation.

Similar to L. pneumophila, L. longbeachae encodes a type IVB secretion system homologous to the Dot/Icm system. Inactivation of the type IV secretion system, through deletion of the dotA gene, showed that it is essential for virulence, as the dotA mutant had a severe growth defect in A. castellanii infection and could not establish an infection in the lungs of A/J mice. Despite this resemblance to L. pneumophila, the secreted effectors are very different as only 44% of the known L. pneumophila substrates were conserved in L. longbeachae. However, like L. pneumophila, many of them have eukaryotic domains or resemble eukaryotic proteins. Thus a large cohort of eukaryotic-like proteins was also a specific feature of the L. longbeachae genomes. An emerging theme in bacterial virulence is the evolution of virulence factors that can mimic the activities of Ras small GTPases (for a review see [77]). Small GTPases regulate unique biological functions of the cell as diverse as cell division/differentiation, actin cytoskeleton rearrangements, intracellular membrane trafficking. L. pneumophila produces the effector proteins RalF [78] and SidM/DrrA [40],[41] that activate small G-protein signaling cascades and interfere with host membrane trafficking. Here we identified L. longbeachae specific proteins belonging to the Rab subfamily of Ras small GTPases. These are the first prokaryotic Rab GTPases described and they may account for some of the differences in phagosome maturation between L. longbeachae and L. pneumophila. Overall, more than 3% of the L. pneumophila genome is thought to encode T4SS substrates that fulfill various functions, such as interfering with small GTPases of the early secretory pathway, disrupting phosphoinositide signaling or targeting microtubule-dependent vesicular transport. They may represent new strategies to interfere with host cell processes and may partly explain variations in the replication cycle of the two species.

An intriguing and unresolved question has been the susceptibility of C57BL/6 mice to L. longbeachae infection but their resistance to L. pneumophila infection. Only A/J mice that carry a particular Naip-5 allele are susceptible to L. pneumophila infection. Genome analysis has provided some insight into this question through the observation that L. longbeachae does not encode flagella, and thus does not trigger Naip5-dependent caspase-1 activation and subsequent proinflammatory cell death by pyroptosis [22][24], [59][62]. In contrast, L. longbeachae encodes a capsule that might be implicated in the recognition by the host immune system and which may provide some protection against killing by phagocytes. In L. pneumophila, expression of flagella is a hallmark of transmissive, virulent bacteria and a marker of its biphasic life cycle. In line with the absence of flagella, L. longbeachae also seems to have a less pronounced life cycle switch, as transcriptome analysis revealed a less dramatic change in gene expression compared to L. pneumophila. This result might explain the fact that intracellular proliferation of L. longbeachae is independent of the growth phase [11].

Previously we and others hypothesized, that L. pneumophila had acquired DNA by horizontal transfer or by convergent evolution during its co-evolution with free-living amoebae [25],[79] and that L. pneumophila uses molecular mimicry to subvert host functions [8],[80]. Presumably, L. longbeachae is not only able to interact with protozoa but also with plants, as several proteins present in plants and several enzymes which might confer the ability to degrade plant material were identified in the L. longbeachae genome.

Interestingly, the comparison of the genome sequence of four strains of L. longbeachae identified high gene content conservation unlike L. pneumophila. Furthermore, between strains of the same serogroup very few SNPs are present, most of them located in few plasticity zones, indicating recent expansion of this species. Based on these genome sequences, future comparative and functional studies will allow definition of the common and distinct survival tactics of pathogenic Legionella spp. and may open new ways to combat L. pneumophila and L. longbeachae infections.

Materials and Methods

Ethics statement

All animal experiments were conducted with approval from the University of Melbourne Animal Ethics committee application ID 0704867.3.

DNA preparation and sequencing techniques

L. longbeachae strain NSW150 was grown on BCYE agar at 37°C for 3 days and chromosomal DNA was isolated by standard protocols. Cloning, sequencing and assembly were done as described [81]. One library (inserts of 1−3 kb) was generated by random mechanical shearing of genomic DNA, followed by cloning of the fragments into pcDNA-2.1 (Invitrogen). A scaffold was obtained by end-sequencing clones from a BAC library constructed as described [82] using pIndigoBac (Epicentre) as a vector. Plasmid DNA purification was done with a TempliPhi DNA sequencing template amplification kit (Amersham Biosciences). Sequencing reactions were done with an ABI PRISM BigDye Terminator cycle sequencing ready reactions kit and a 3730 Xl Genetic Analyzer (Applied Biosystems). We obtained and assembled 40299 sequences and performed finishing by adding 1125 additional sequences, as described earlier [81]. For draft genome sequencing of strains ATCC39642, 98072 and C-4E7 Illumina, shotgun libraries were generated from 5 µg of genomic DNA each using the standard Illumina protocols. Sequencing was carried out on an Illumina Genome Analyzer II as paired-end 36bp reads, following the manufacturer's protocols and with the Illumina PhiX sample used as control. Image analysis and base calling was performed by the Genome Analyser pipeline version 1.3 with default parameters.

Annotation and sequence analysis

Definition of coding sequences and annotation were done as described [81] by using CAAT-box software [83] and MAGE (Magnifying Genomes) [84]. All predicted coding sequences were examined visually. Function predictions were based on BLASTp similarity searches and on the analysis of motifs using the PFAM, Prosite and SMART databases. We identified orthologous genes by reciprocal best-match BLAST and FASTA comparisons. Pseudogenes had one or more mutations that would prevent complete translation. Analysis of the three drafts genome sequences obtained by the Illumina technique was done as follows. First, to precisely determine the average insert size of mate-paired reads, we mapped the reads of each strain to the NSW150 sequence. Then, this value was used to give good mate-pair information to the de novo assembler. Short-reads were assembled de novo into contigs (without reference to any other sequence) using Velvet (version 0.7.55) [85]. To increase specificity and length of the generated contigs, we used the hash length (k-mer) of 27. Subsequently Mauve (version 2.3.0) [86] was used to build super contigs by aligning the de novo obtained contigs on the finished NSW150 sequence. Finally, for SNP discovery the program Maq (version 0.7.1) [87] was used for mapping the Solexa reads to the NSW150 reference. To detect high confidence SNPs, we only kept those SNPs that had a coverage of 10x to 300x. SNPs with a frequency lower than 80% were removed.

Construction of a dotA mutant in strain L. longbeachae NSW150

To construct the dotA mutant strain, the chromosomal region containing the dotA gene was PCR-amplified with the primers dotA-for CTCGCGCATTGGAACTTTAT and dotA-rev TTCGCTCATAAACCGCTCTT. The product was cloned into the pGEM-T Easy vector (Promega) yielding pGEM-dotA. We performed inverse PCR on pGEM-dotA with primers dotAinv-for CGCGGATCCCCGCATTTAATACGCCAAAC and dotAinv-rev CGCGGATCCAAGGTTTTGCGTTGGATAGG containing BamHI overhangs allowing internal deletion of 2582 bp in dotA. PCR product was digested with BamHI and ligated to the kanamycin resistance cassette, which was amplified via PCR from the plasmid pGEM-KanR, using primers containing BamHI restriction sites at the ends (Kan-BamHI-for TGCAGGTCGACTCAGAGGAT Kan-BamHI-rev CGCGGATCCGAGCTCGGTACC). Linearized vector was electroporated in L. longbeachae to obtain dotA::Km mutant.

Acanthamoeba castellanii infection assay

For in vivo growth of L. longbeachae and its dotA deletion mutant in A. castellanii we followed a protocol previously described [65]. In brief, three days old cultures of A. castellanii were washed in infection buffer (PYG 712 medium without proteose peptone, glucose, and yeast extract) and adjusted to 105–106 cells per ml. Stationary phase Legionella grown on BCYE agar, diluted in water were mixed with A. castellanii at a MOI of 0.1. After allowing invasion for 1 hour at 37°C the A. castellanii layer was washed twice with infection buffer (start point of time-course experiment). Intracellular multiplication was monitored using a 300 µl sample, which was centrifuged (14 000 rpm) and vortexed to break up amoeba. The number of colony forming units (CFU) of Legionellae was determined by plating on BCYE agar. Each infection was carried out in duplicates.

Pulmonary infection of A/J mice with L. longbeachae

The comparative virulence of L. longbeachae NSW150 and the dotA::Km derivative within A/J mice was examined via competition assays and in single infections, as described previously [21],[34]. Briefly, 6- to 8-week-old female A/J mice (Jackson Laboratory, ME) were anesthetized and inoculated intratracheally with approximately 105 CFU of each L. longbeachae strain under investigation. At 24 and 72 h following inoculation, mice were sacrificed and their lung tissue isolated. Tissue was homogenized, and complete host cell lysis was achieved by incubation in 0.1% saponin for 15 min at 37°C. Serial dilutions of the homogenate were plated onto both plain and antibiotic-selective BCYE agar to determine the number of viable bacteria and the ratio of wild-type to mutant bacteria colonizing the lung in mixed infections.

Electron microscopy

Bacteria were transferred to Formvar-carbon-coated copper grids after glow discharged for 3′, stained with 1% uranyl acetate for 35sec, air dried and observed under a Jeol 1200EXII transmission electron microscope (Jeol, Tokyo, Japan) operated at 80kV. Digital acquisition was performed with a Mega View camera and the Analysis pro software version 3,1 (ELOISE, Roissy, France).

PCR analysis

PCR for the regions containing the flagella biosynthesis coding genes in strain L. pneumophila Paris and L. longbeachae NSW150 were amplified with genomic DNA of strain Paris and NSW150 respectively. Primers were designed using the Primer 3 software to amplify a specific fragment of about 1 -3kb respectively for each region (melting temperatures 58°C). Amplification reactions were performed in a 50-µl reaction volume containing 6 ng of chromosomal DNA. The size of each PCR product was verified on agarose gels. Primers used are listed in Table S9.

Transcriptome analysis

L. longbeachae strain NSW150 was cultured in N-(2-acetamido)-2-aminoethanesulphonic acid (ACES)-buffered yeast extract broth or on ACES-buffered charcoal –yeast (BCYE) extract agar at 37C. Total RNA was extracted as previously described [88]. L. longbeachae was harvested for RNA isolation at the exponential (OD 2.5) and post-exponential phase (OD 3.7). RNA was prepared from three independent cultures and each RNA sample was hybridized twice to the microarrays (dye swap). RNA was reverse-transcribed with Superscript indirect cDNA kit (Invitrogen) and labeled with Cy5 or Cy3 (Amersham Biosciences) according to the supplier's instructions. The microarray containing 13 710 60mer oligonucleotides specific for 3567 predicted genes of the genome, the plasmid and all intergenic regions longer than 200nts has been designed using the program OligoArray (http://berry.engin.umich.edu/oligoarray/). Based on these sequences a custom oligonucleotide array was manufactured (Agilent Technologies) with a final density of 15K. For hybridization, Cy3 and Cy5 target quantities were normalized at 150 pmol. Arrays were scanned using an Axon 4000B scanner with fixed PMT (PMT  =  550 for Cy3 and 650 for Cy5). Data were acquired and analyzed by Genepix Pro 5.0 (Axon Instrument). Spots were excluded from analysis in case of high local background fluorescence slide abnormalities or weak intensity. Data normalization and differential analysis were conducted using the R software (http://www.r-project.org). For each gene 3 probes were present on the microarray. Data for which at least 2 of the 3 probes gave a significant and non-contradictory result were taken into account. A loess normalization [89] was performed on a slide-by-slide basis (BioConductor package marray; http://www.bioconductor.org/packages/bioc/html/marray.html). Differential analysis was carried out separately for each comparison between two time points, using the VM method (VarMixt package [90], together with the Benjamini and Yekutieli [91] p-value adjustment method. The cut off for the expression ratio was set to either superior/equal to 2 or inferior/equal to 0.5 and the general ratio of expression of each gene was calculated as the average expression ratio from the different significant probes.

URLs

The sequence and the annotation of the L. longbeachae NSW150 genome is accessible at the LegioList Web Server (http://genolist.pasteur.fr/LegioList and http://genolist.pasteur.fr/) and under the EMBL/Genbank Accession number: FN650140 the L. longbeachae NSW150 plasmid under the EMBL/Genbank Accession number: FN650141. Due to new regulations for genome sequence submissions to EMBL/Genbank the gene names (locus_tag), which are e.g. llo0001 in the article and in the Institut Pasteur databases had to be changed to LLO_0001 in the sequence submission. According to the standards for genome sequences published by Chain and colleagues [92] the L. pneumophila NSW150 genome sequence can be defined as “Finished” and the three Solexa genome sequence drafts can be defined as “High-Quality Draft”. The complete dataset for the transcriptome analysis is available at http://genoscript.pasteur.fr in a MIAME compliance public database maintained at the Institut Pasteur and was submitted to the ArrayExpress database maintained at http://www.ebi.ac.uk/microarray-as/ae/ under the Accession number: A-MEXP-1779.

Supporting Information

Figure S1

Classification of the L. longbeachae CDS in the different COG groups. 2,506 CDS are classified in at least one COG group. Since several genes are assigned to multiple categories, the total number of assignments is greater than the number of ORFs in the genome.

(11.39 MB TIF)

Figure S2

Synteny plot of the chromosomes of L. pneumophila strain Paris and L. longbeachae NSW150. The plot was created using the mummer software package (http://mummer.sourceforge.net/).

(6.88 MB TIF)

Figure S3

Comparison of the plasmids identified in L. longbeachae and L. pneumophila. (A) Synteny LinePlot between the L. longbeachae plasmid and the plasmids of L. pneumophila strain Lens and Paris, respectively. Orthologous genes are defined by bi-directional blastP best hits (BDBH) or a blastP alignment threshold of 35% sequence identity over 80% of the length of the smaller protein. The gap parameter, representing the maximum number of consecutive genes that are not involved in a synteny group was 3. (B) Percentage of aminoacid identity among Tra proteins of the L. longbeachae and the L. pneumophila strain Lens as compared to the Tra region of strain Paris. (C) Venn diagram showing the common and specific gene content of the plasmids of L. pneumophila strains Paris, Lens and L. longbeachae NSW150.

(17.22 MB TIF)

Figure S4

Distribution of SNPs along the chromosome of L. longbeachae ATCC39462 (Sg1) and C-4E7 (Sg2) with respect to the completely sequence genome of L. longbeachae NSW 150 (Sg1). Outer circle, Mapping of SNPs between L. longbeachae Sg1 (NSW150) and Sg2 (C-4E7), central circle in green, sequence couverage of mapped reads of strain ATCC39462 on the NSW150 genome, inner circle; SNP distributon among the two Sg1 strains sequenced. 1426 SNPs are located in 7 genomic regions; region 1: llo0557-llo0587 containing 112 SNPs; region 2: llo0643-llo0653, carries an integrase gene and contains 152 SNPs; region 3: llo0814-llo0841 containing 38 SNPs; region 4: llo0943-llo0952, carries an integrase gene and contains 152 SNPs; region 5: llo1813-llo1886, carries many tra- like genes and contains 651 SNPs; region 6: llo2119-llo2142, contains 89 SNPs, region 7: llo3148-llo3180, carries genes encoding the putative capsule and contains 166 SNPs.

(10.54 MB TIF)

Figure S5

Aminoacid alignment of the RAS-domains of different L. longbeachae proteins identified in the genome of strain NSW150. PFAM was used to align the different sequences (http://pfam.sanger.ac.uk/).

(14.63 MB TIF)

Figure S6

Alignment of the putative LPS-encoding region of L. longbeachae Sg1 and Sg2 using the ARTEMIS comparison tool. Note the nearly perfect alignment of the four segments with only two regions differing between Sg1 and Sg2. Furthermore, the putative LPS-coding region of the two strains of the same Sg line perfectly up with a over 90% nucleotide identity. Specific regions and the predicted proteins encoded are depicted below.

(8.74 MB TIF)

Table S1

L. longbeachae NSW150 protein coding genes and their distribution within functional categories.

(0.03 MB DOC)

Table S2

Specific genes of L. longbeachae without orthologues in any of the four sequenced L. pneumophila genomes.

(0.50 MB DOC)

Table S3

Distribution of known and predicted Dot/Icm substrates of L. pneumophila in L. longbeachae.

(0.31 MB DOC)

Table S4

Putative capsule and LPS encoding genes in L. longbeachae and its comparison to L. pneumophila Paris.

(0.14 MB DOC)

Table S5

Analysis of the FlgD, FleR/S, and FliA/FleN encoding regions in L. longbeachae.

(0.05 MB DOC)

Table S6

Transcriptional regulators identified in L. longbeachae and their orthologs in L. pneumophila.

(0.30 MB DOC)

Table S7

Genes upregulated in L. longbeachae in exponential growth phase.

(0.23 MB DOC)

Table S8

Genes upregulated in L. longbeachae in post-exponetial growth phase.

(0.35 MB DOC)

Table S9

Sequence of primers used to amplify putative flagella gene encoding regions.

(0.04 MB DOC)

Acknowledgments

We would like to thank P. Glaser for critical reading of the manuscript, A. Hagman for help in the initial steps of the project, M. C. Prevost (Electron microscopy platform, Institut Pasteur) for electron microscopy photos of L. longbeachae, and S. Rousseau and I. Moszer (Pasteur Genopole Ile-de-France–PF4 Genome analysis and Integration) for curating the transcriptome database at the Institut Pasteur.

Footnotes

The authors have declared that no competing interests exist.

This work received financial support from the Institut Pasteur, the Centre National de la Recherche (CNRS), the Network of Excellence “Europathogenomics” LSHB-CT-2005-512061, and the Australian National Health and Medical Research Council (NHMRC). ML is holder of a Marie Curie fellowship financed by the European Commission (INTRAPATH project MEST-CT-2005-020715) coordinated by Institut Pasteur and LG-V is holder of a Roux postdoctoral research Fellowship financed by the Institut Pasteur. ELH holds an Australian Research Council Future Fellowship. HJN and FMS hold NHMRC Biomedical Training fellowships. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Yu VL, Plouffe JF, Pastoris MC, Stout JE, Schousboe M, et al. Distribution of Legionella species and serogroups isolated by culture in patients with sporadic community-acquired legionellosis: an international collaborative survey. J Infect Dis. 2002;186:127–128. doi: 10.1086/341087. [DOI] [PubMed] [Google Scholar]
  • 2.Phares CR, Wangroongsarb P, Chantra S, Paveenkitiporn W, Tondella ML, et al. Epidemiology of severe pneumonia caused by Legionella longbeachae, Mycoplasma pneumoniae, and Chlamydia pneumoniae: 1-year, population-based surveillance for severe pneumonia in Thailand. Clin Infect Dis. 2007;45:e147–155. doi: 10.1086/523003. [DOI] [PubMed] [Google Scholar]
  • 3.Bibb WF, Sorg RJ, Thomason BM, Hicklin MD, Steigerwalt AG, et al. Recognition of a second serogroup of Legionella longbeachae. J Clin Microbiol. 1981;14:674–677. doi: 10.1128/jcm.14.6.674-677.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cameron S, Roder D, Walker C, Feldheim J. Epidemiological characteristics of Legionella infection in South Australia: implications for disease control. Aust N Z J Med. 1991;21:65–70. doi: 10.1111/j.1445-5994.1991.tb03007.x. [DOI] [PubMed] [Google Scholar]
  • 5.Steele TW, Moore CV, Sangster N. Distribution of Legionella longbeachae serogroup 1 and other legionellae in potting soils in Australia. Appl Environ Microbiol. 1990;56:2984–2988. doi: 10.1128/aem.56.10.2984-2988.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Isberg RR, O'Connor TJ, Heidtman M. The Legionella pneumophila replication vacuole: making a cosy niche inside host cells. Nat Rev Microbiol. 2009;7:13–24. doi: 10.1038/nrmicro1967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shin S, Roy CR. Host cell processes that influence the intracellular survival of Legionella pneumophila. Cell Microbiol. 2008;10:1209–1220. doi: 10.1111/j.1462-5822.2008.01145.x. [DOI] [PubMed] [Google Scholar]
  • 8.Nora T, Lomma M, Gomez-Valero L, Buchrieser C. Molecular mimicry: an important virulence strategy employed by Legionella pneumophila to subvert host functions. Future Microbiol. 2009;4 doi: 10.2217/fmb.09.47. [DOI] [PubMed] [Google Scholar]
  • 9.Molofsky AB, Swanson MS. Differentiate to thrive: lessons from the Legionella pneumophila life cycle. Mol Microbiol. 2004;53:29–40. doi: 10.1111/j.1365-2958.2004.04129.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Byrne B, Swanson MS. Expression of Legionella pneumophila virulence traits in response to growth conditions. Infect Immun. 1998;66:3029–3034. doi: 10.1128/iai.66.7.3029-3034.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Asare R, Abu Kwaik Y. Early trafficking and intracellular replication of Legionella longbeachaea within an ER-derived late endosome-like phagosome. Cell Microbiol. 2007;9:1571–1587. doi: 10.1111/j.1462-5822.2007.00894.x. [DOI] [PubMed] [Google Scholar]
  • 12.Asare R, Santic M, Gobin I, Doric M, Suttles J, et al. Genetic susceptibility and caspase activation in mouse and human macrophages are distinct for Legionella longbeachae and L. pneumophila. Infect Immun. 2007;75:1933–1945. doi: 10.1128/IAI.00025-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Berger KH, Isberg RR. Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila. . Mol Microbiol. 1993;7:7–19. doi: 10.1111/j.1365-2958.1993.tb01092.x. [DOI] [PubMed] [Google Scholar]
  • 14.Roy CR, Berger KH, Isberg RR. Legionella pneumophila DotA protein is required for early phagosome trafficking decisions that occur within minutes of bacterial uptake. Mol Microbiol. 1998;28:663–674. doi: 10.1046/j.1365-2958.1998.00841.x. [DOI] [PubMed] [Google Scholar]
  • 15.Segal G, Purcell M, Shuman HA. Host cell killing and bacterial conjugation require overlapping sets of genes within a 22-kb region of the Legionella pneumophila genome. Proc Natl Acad Sci U S A. 1998;95:1669–1674. doi: 10.1073/pnas.95.4.1669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Vogel JP, Andrews HL, Wong SK, Isberg RR. Conjugative transfer by the virulence system of Legionella pneumophila. Science. 1998;279:873–876. doi: 10.1126/science.279.5352.873. [DOI] [PubMed] [Google Scholar]
  • 17.Burstein D, Zusman T, Degtyar E, Viner R, Segal G, et al. Genome-scale identification of Legionella pneumophila effectors using a machine learning approach. PLoS Pathog. 2009;5:e1000508. doi: 10.1371/journal.ppat.1000508. doi: 10.1371/journal.ppat.1000508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ensminger AW, Isberg RR. Legionella pneumophila Dot/Icm translocated substrates: a sum of parts. Curr Opin Microbiol. 2009;12:67–73. doi: 10.1016/j.mib.2008.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ninio S, Roy CR. Effector proteins translocated by Legionella pneumophila: strength in numbers. Trends Microbiol. 2007;15:372–380. doi: 10.1016/j.tim.2007.06.006. [DOI] [PubMed] [Google Scholar]
  • 20.Morozova I, Qu X, Shi S, Asamani G, Greenberg JE, et al. Comparative sequence analysis of the icm/dot genes in Legionella. Plasmid. 2004;51:127–147. doi: 10.1016/j.plasmid.2003.12.004. [DOI] [PubMed] [Google Scholar]
  • 21.Gobin I, Susa M, Begic G, Hartland EL, Doric M. Experimental Legionella longbeachae infection in intratracheally inoculated mice. J Med Microbiol. 2009;58:723–730. doi: 10.1099/jmm.0.007476-0. [DOI] [PubMed] [Google Scholar]
  • 22.Molofsky AB, Byrne BG, Whitfield NN, Madigan CA, Fuse ET, et al. Cytosolic recognition of flagellin by mouse macrophages restricts Legionella pneumophila infection. J Exp Med. 2006;17:1093–1104. doi: 10.1084/jem.20051659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ren T, Zamboni DS, Roy CR, Dietrich WF, Vance RE. Flagellin-deficient Legionella mutants evade caspase-1- and Naip5-mediated macrophage immunity. PLoS Pathog. 2006;2:e18. doi: 10.1371/journal.ppat.0020018. doi: 10.1371/journal.ppat.0020018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wright EK, Goodart SA, Growney JD, Hadinoto V, Endrizzi MG, et al. Naip5 affects host susceptibility to the intracellular pathogen Legionella pneumophila. Curr Biol. 2003;13:27–36. doi: 10.1016/s0960-9822(02)01359-3. [DOI] [PubMed] [Google Scholar]
  • 25.Cazalet C, Rusniok C, Bruggemann H, Zidane N, Magnier A, et al. Evidence in the Legionella pneumophila genome for exploitation of host cell functions and high genome plasticity. Nat Genet. 2004;36:1165–1173. doi: 10.1038/ng1447. [DOI] [PubMed] [Google Scholar]
  • 26.Chien M, Morozova I, Shi S, Sheng H, Chen J, et al. The genomic sequence of the accidental pathogen Legionella pneumophila. Science. 2004;305:1966–1968. doi: 10.1126/science.1099776. [DOI] [PubMed] [Google Scholar]
  • 27.Steinert M, Heuner K, Buchrieser C, Albert-Weissenberger C, Glöckner G. Legionella pathogenicity: genome structure, regulatory networks and the host cell response. Int J Med Microbiol. 2007;297:577–587. doi: 10.1016/j.ijmm.2007.03.009. [DOI] [PubMed] [Google Scholar]
  • 28.Doyle RM, Heuzenroeder MW. A mutation in an ompR-like gene on a Legionella longbeachae serogroup 1 plasmid attenuates virulence. Int J Med Microbiol. 2002;292:227–239. doi: 10.1078/1438-4221-00210. [DOI] [PubMed] [Google Scholar]
  • 29.Cazalet C, Jarraud S, Ghavi-Helm Y, Kunst F, Glaser P, et al. Multigenome analysis identifies a worldwide distributed epidemic Legionella pneumophila clone that emerged within a highly diverse species. Genome Res. 2008;18:431–441. doi: 10.1101/gr.7229808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cianciotto NP. Many substrates and functions of type II secretion: lessons learned from Legionella pneumophila. Future Microbiol. 2009;4:797–805. doi: 10.2217/FMB.09.53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.DebRoy S, Dao J, Soderberg M, Rossier O, Cianciotto NP. Legionella pneumophila type II secretome reveals unique exoproteins and a chitinase that promotes bacterial persistence in the lung. Proc Natl Acad Sci U S A. 2006;103:19146–19151. doi: 10.1073/pnas.0608279103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Feldman M, Segal G. A specific genomic location within the icm/dot pathogenesis region of different Legionella species encodes functionally similar but nonhomologous virulence proteins. Infect Immun. 2004;72:4503–4511. doi: 10.1128/IAI.72.8.4503-4511.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Feldman M, Zusman T, Hagag S, Segal G. Coevolution between nonhomologous but functionally similar proteins and their conserved partners in the Legionella pathogenesis system. Proc Natl Acad Sci U S A. 2005;102:12206–12211. doi: 10.1073/pnas.0501850102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Newton HJ, Sansom FM, Dao J, McAlister AD, Sloan J, et al. Sel1 repeat protein LpnE is a Legionella pneumophila virulence determinant that influences vacuolar trafficking. Infect Immun. 2007;75:5575–5585. doi: 10.1128/IAI.00443-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Nagai H, Cambronne ED, Kagan JC, Amor JC, Kahn RA, et al. A C-terminal translocation signal required for Dot/Icm-dependent delivery of the Legionella RalF protein to host cells. Proc Natl Acad Sci U S A. 2005;102:826–831. doi: 10.1073/pnas.0406239101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kubori T, Hyakutake A, Nagai H. Legionella translocates an E3 ubiquitin ligase that has multiple U-boxes with distinct functions. Mol Microbiol. 2008;67:1307–1319. doi: 10.1111/j.1365-2958.2008.06124.x. [DOI] [PubMed] [Google Scholar]
  • 37.Shevchuk O, Batzilla C, Hagele S, Kusch H, Engelmann S, et al. Proteomic analysis of Legionella-containing phagosomes isolated from Dictyostelium. Int J Med Microbiol. 2009;299:489–508. doi: 10.1016/j.ijmm.2009.03.006. [DOI] [PubMed] [Google Scholar]
  • 38.Urwyler S, Brombacher E, Hilbi H. Endosomal and secretory markers of the Legionella-containing vacuole. Commun Integr Biol. 2009;2:107–109. doi: 10.4161/cib.7713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Urwyler S, Nyfeler Y, Ragaz C, Lee H, Mueller LN, et al. Proteome analysis of Legionella vacuoles purified by magnetic immunoseparation reveals secretory and endosomal GTPases. Traffic. 2009;10:76–87. doi: 10.1111/j.1600-0854.2008.00851.x. [DOI] [PubMed] [Google Scholar]
  • 40.Machner MP, Isberg RR. Targeting of host Rab GTPase function by the intravacuolar pathogen Legionella pneumophila. Dev Cell. 2006;11:47–56. doi: 10.1016/j.devcel.2006.05.013. [DOI] [PubMed] [Google Scholar]
  • 41.Murata T, Delprato A, Ingmundson A, Toomre DK, Lambright DG, et al. The Legionella pneumophila effector protein DrrA is a Rab1 guanine nucleotide-exchange factor. Nat Cell Biol. 2006;8:971–977. doi: 10.1038/ncb1463. [DOI] [PubMed] [Google Scholar]
  • 42.Weber SS, Ragaz C, Hilbi H. The inositol polyphosphate 5-phosphatase OCRL1 restricts intracellular growth of Legionella, localizes to the replicative vacuole and binds to the bacterial effector LpnE. Cell Microbiol. 2009;11:442–460. doi: 10.1111/j.1462-5822.2008.01266.x. [DOI] [PubMed] [Google Scholar]
  • 43.Weber SS, Ragaz C, Reus K, Nyfeler Y, Hilbi H. Legionella pneumophila exploits PI(4)P to anchor secreted effector proteins to the replicative vacuole. PLoS Pathog. 2006;2:e46. doi: 10.1371/journal.ppat.0020046. doi: 10.1371/journal.ppat.0020046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Brombacher E, Urwyler S, Ragaz C, Weber SS, Kami K, et al. The Rab1 guanine nucleotide exchange factor SidM is a major PtdIns(4)P-binding effector protein of Legionella pneumophila. J Biol Chem. 2008;284:4846–4856. doi: 10.1074/jbc.M807505200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pan X, Lührmann A, Satoh A, Laskowski-Arce MA, Roy CR. Ankyrin repeat proteins comprise a diverse family of bacterial type IV effectors. Science. 2008;320:1651–1654. doi: 10.1126/science.1158160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Eiserich JP, Estévez AG, Bamberg TV, Ye YZ, Chumley PH, et al. Microtubule dysfunction by posttranslational nitrotyrosination of alpha-tubulin: a nitric oxide-dependent mechanism of cellular injury. Proc Natl Acad Sci U S A. 1999;96:6365–6370. doi: 10.1073/pnas.96.11.6365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lurin C, Andrés C, Aubourg S, Bellaoui M, Bitton F, et al. Genome-wide analysis of Arabidopsis pentatricopeptide repeat proteins reveals their essential role in organelle biogenesis. Plant Cell. 2004;16:2089–2103. doi: 10.1105/tpc.104.022236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Nakamura T, Schuster G, Sugiura M, Sugita M. Chloroplast RNA-binding and pentatricopeptide repeat proteins. Biochem Soc Trans. 2004;32:571–574. doi: 10.1042/BST0320571. [DOI] [PubMed] [Google Scholar]
  • 49.Schmitz-Linneweber C, Small I. Pentatricopeptide repeat proteins: a socket set for organelle gene expression. Trends Plant Sci. 2008;13:663–670. doi: 10.1016/j.tplants.2008.10.001. [DOI] [PubMed] [Google Scholar]
  • 50.Belyi Y, Stahl M, Sovkova I, Kaden P, Luy B, et al. Region of elongation factor 1A1 involved in substrate recognition by Legionella pneumophila glucosyltransferase Lgt1: identification of Lgt1 as a retaining glucosyltransferase. J Biol Chem. 2009;284:20167–20174. doi: 10.1074/jbc.M109.008441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Belyi Y, Tabakova I, Stahl M, Aktories K. Lgt: a family of cytotoxic glucosyltransferases produced by Legionella pneumophila. J Bacteriol. 2008;190:3026–3035. doi: 10.1128/JB.01798-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Belyi Y, Niggeweg R, Opitz B, Vogelsgesang M, Hippenstiel S, et al. Legionella pneumophila glucosyltransferase inhibits host elongation factor 1A. Proc Natl Acad Sci U S A. 2006;103:16953–16958. doi: 10.1073/pnas.0601562103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Heidtman M, Chen EJ, Moy MY, Isberg RR. Large-scale identification of Legionella pneumophila Dot/Icm substrates that modulate host cell vesicle trafficking pathways. Cell Microbiol. 2009;11:230–248. doi: 10.1111/j.1462-5822.2008.01249.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Duchaud E, Rusniok C, Frangeul L, Buchrieser C, Givaudan A, et al. The genome sequence of the entomopathogenic bacterium Photorhabdus luminescens. Nat Biotechnol. 2003;21:1307–1313. doi: 10.1038/nbt886. [DOI] [PubMed] [Google Scholar]
  • 55.Hazelbauer GL, Falke JJ, Parkinson JS. Bacterial chemoreceptors: high-performance signaling in networked arrays. Trends Biochem Sci. 2008;33:9–19. doi: 10.1016/j.tibs.2007.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Krehenbrink M, Oppermann-Sanio FB, Steinbuchel A. Evaluation of non-cyanobacterial genome sequences for occurrence of genes encoding proteins homologous to cyanophycin synthetase and cloning of an active cyanophycin synthetase from Acinetobacter sp. strain DSM 587. Arch Microbiol. 2002;177:371–380. doi: 10.1007/s00203-001-0396-9. [DOI] [PubMed] [Google Scholar]
  • 57.Fuser G, Steinbuchel A. Analysis of genome sequences for genes of cyanophycin metabolism: identifying putative cyanophycin metabolizing prokaryotes. Macromol Biosci. 2007;7:278–296. doi: 10.1002/mabi.200600207. [DOI] [PubMed] [Google Scholar]
  • 58.de Berardinis V, Durot M, Weissenbach J, Salanoubat M. Acinetobacter baylyi ADP1 as a model for metabolic system biology. Curr Opin Microbiol. 2009;12:568–576. doi: 10.1016/j.mib.2009.07.005. [DOI] [PubMed] [Google Scholar]
  • 59.Diez E, Lee SH, Gauthier S, Yaraghi Z, Tremblay M, et al. Birc1e is the gene within the Lgn1 locus associated with resistance to Legionella pneumophila. Nat Genet. 2003;33:55–60. doi: 10.1038/ng1065. [DOI] [PubMed] [Google Scholar]
  • 60.Lamkanfi M, Amer A, Kanneganti TD, Munoz-Planillo R, Chen G, et al. The Nod-like receptor family member Naip5/Birc1e restricts Legionella pneumophila growth independently of caspase-1 activation. J Immunol. 2007;178:8022–8027. doi: 10.4049/jimmunol.178.12.8022. [DOI] [PubMed] [Google Scholar]
  • 61.Lightfield KL, Persson J, Brubaker SW, Witte CE, von Moltke J, et al. Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin. Nat Immunol. 2008;9:1171–1178. doi: 10.1038/ni.1646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Zamboni DS, Kobayashi KS, Kohlsdorf T, Ogura Y, Long EM, et al. The Birc1e cytosolic pattern-recognition receptor contributes to the detection and control of Legionella pneumophila infection. Nat Immunol. 2006;7:318–325. doi: 10.1038/ni1305. [DOI] [PubMed] [Google Scholar]
  • 63.Kentner D, Sourjik V. Spatial organization of the bacterial chemotaxis system. Curr Opin Microbiol. 2006;9:619–624. doi: 10.1016/j.mib.2006.10.012. [DOI] [PubMed] [Google Scholar]
  • 64.La Scola B, Birtles RJ, Greub G, Harrison TJ, Ratcliff RM, et al. Legionella drancourtii sp. nov., a strictly intracellular amoebal pathogen. Int J Syst Evol Microbiol. 2004;54:699–703. doi: 10.1099/ijs.0.02455-0. [DOI] [PubMed] [Google Scholar]
  • 65.Brüggemann H, Hagman A, Jules M, Sismeiro O, Dillies M, et al. Virulence strategies for infecting phagocytes deduced from the in vivo transcriptional program of Legionella pneumophila. Cell Microbiol. 2006;8:1228–1240. doi: 10.1111/j.1462-5822.2006.00703.x. [DOI] [PubMed] [Google Scholar]
  • 66.Sahr T, Bruggemann H, Jules M, Lomma M, Albert-Weissenberger C, et al. Two small ncRNAs jointly govern virulence and transmission in Legionella pneumophila. Mol Microbiol. 2009;72:741–762. doi: 10.1111/j.1365-2958.2009.06677.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Tiaden A, Spirig T, Carranza P, Bruggemann H, Riedel K, et al. Synergistic contribution of the Legionella pneumophila lqs genes to pathogen-host interactions. J Bacteriol. 2008;190:7532–7547. doi: 10.1128/JB.01002-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Spirig T, Tiaden A, Kiefer P, Buchrieser C, Vorholt JA, et al. The Legionella autoinducer synthase LqsA produces an alpha-hydroxyketone signaling molecule. J Biol Chem. 2008;283:18113–18123. doi: 10.1074/jbc.M801929200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Tiaden A, Spirig T, Weber SS, Brüggemann H, Bosshard R, et al. The Legionella pneumophila response regulator LqsR promotes virulence as an element of the regulatory network controlled by RpoS and LetA. Cell Microbiol. 2007;9:2903–2920. doi: 10.1111/j.1462-5822.2007.01005.x. [DOI] [PubMed] [Google Scholar]
  • 70.Skerker JM, Prasol MS, Perchuk BS, Biondi EG, Laub MT. Two-component signal transduction pathways regulating growth and cell cycle progression in a bacterium: a system-level analysis. PLoS Biol. 2005;3:e334. doi: 10.1371/journal.pbio.0030334. doi: 10.1371/journal.pbio.0030334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Newton HJ, Sansom FM, Dao J, Cazalet C, Bruggemann H, et al. Significant Role for ladC in Initiation of Legionella pneumophila Infection. Infect Immun. 2008;76:3075–3085. doi: 10.1128/IAI.00209-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Lory S, Wolfgang M, Lee V, Smith R. The multi-talented bacterial adenylate cyclases. Int J Med Microbiol. 2004;293:479–482. doi: 10.1078/1438-4221-00297. [DOI] [PubMed] [Google Scholar]
  • 73.Rasis M, Segal G. The LetA-RsmYZ-CsrA regulatory cascade, together with RpoS and PmrA, post-transcriptionally regulates stationary phase activation of Legionella pneumophila Icm/Dot effectors. Mol Microbiol. 2009;72:995–1010. doi: 10.1111/j.1365-2958.2009.06705.x. [DOI] [PubMed] [Google Scholar]
  • 74.Gal-Mor O, Segal G. Identification of CpxR as a positive regulator of icm and dot virulence genes of Legionella pneumophila. J Bacteriol. 2003;185:4908–4919. doi: 10.1128/JB.185.16.4908-4919.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Zusman T, Aloni G, Halperin E, Kotzer H, Degtyar E, et al. The response regulator PmrA is a major regulator of the icm/dot type IV secretion system in Legionella pneumophila and Coxiella burnetii. Mol Microbiol. 2007;63:1508–1523. doi: 10.1111/j.1365-2958.2007.05604.x. [DOI] [PubMed] [Google Scholar]
  • 76.Altman E, Segal G. The response regulator CpxR directly regulates expression of several Legionella pneumophila icm/dot components as well as new translocated substrates. J Bacteriol. 2008;90:1985–1996. doi: 10.1128/JB.01493-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Alto NM. Mimicking small G-proteins: an emerging theme from the bacterial virulence arsenal. Cell Microbiol. 2008;10:566–575. doi: 10.1111/j.1462-5822.2007.01110.x. [DOI] [PubMed] [Google Scholar]
  • 78.Nagai H, Kagan JC, Zhu X, Kahn RA, Roy CR. A bacterial guanine nucleotide exchange factor activates ARF on Legionella phagosomes. Science. 2002;295:679–682. doi: 10.1126/science.1067025. [DOI] [PubMed] [Google Scholar]
  • 79.de Felipe KS, Pampou S, Jovanovic OS, Pericone CD, Ye SF, et al. Evidence for acquisition of Legionella type IV secretion substrates via interdomain horizontal gene transfer. J Bacteriol. 2005;187:7716–7726. doi: 10.1128/JB.187.22.7716-7726.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Brüggemann H, Cazalet C, Buchrieser C. Adaptation of Legionella pneumophila to the host environment: role of protein secretion, effectors and eukaryotic-like proteins. Curr Opin Microbiol. 2006;9:86–94. Epub 2006 Jan 2006. doi: 10.1016/j.mib.2005.12.009. [DOI] [PubMed] [Google Scholar]
  • 81.Glaser P, Frangeul L, Buchrieser C, Rusniok C, Amend A, et al. Comparative genomics of Listeria species. Science. 2001;294:849–852. doi: 10.1126/science.1063447. [DOI] [PubMed] [Google Scholar]
  • 82.Buchrieser C, Rusniok C, Frangeul L, Couve E, Billault A, et al. The 102-kilobase pgm locus of Yersinia pestis: sequence analysis and comparison of selected regions among different Yersinia pestis and Yersinia pseudotuberculosis strains. Infect Immun. 1999;67:4851–4861. doi: 10.1128/iai.67.9.4851-4861.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Frangeul L, Glaser P, Rusniok C, Buchrieser C, Duchaud E, et al. CAAT-Box, Contigs-Assembly and Annotation tool-box for genome sequencing projects. Bioinformatics. 2004;20:790–797. doi: 10.1093/bioinformatics/btg490. [DOI] [PubMed] [Google Scholar]
  • 84.Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, et al. MaGe: a microbial genome annotation system supported by synteny results. Nucleic Acids Res. 2006;34:53–65. doi: 10.1093/nar/gkj406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Zerbino DR, Birney E. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 2008;18:821–829. doi: 10.1101/gr.074492.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Darling AC, Mau B, Blattner FR, Perna NT. Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004;14:1394–1403. doi: 10.1101/gr.2289704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Li H, Ruan J, Durbin R. Mapping short DNA sequencing reads and calling variants using mapping quality scores. Genome Res. 2008;18:1851–1858. doi: 10.1101/gr.078212.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Milohanic E, Glaser P, Coppee JY, Frangeul L, Vega Y, et al. Transcriptome analysis of Listeria monocytogenes identifies three groups of genes differently regulated by PrfA. Mol Microbiol. 2003;47:1613–1625. doi: 10.1046/j.1365-2958.2003.03413.x. [DOI] [PubMed] [Google Scholar]
  • 89.Yang YH, Dudoit S, Luu P, Lin DM, Peng V, et al. Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res. 2002;30:e15. doi: 10.1093/nar/30.4.e15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Delmar P, Robin S, Daudin JJ. VarMixt: efficient variance modelling for the differential analysis of replicated gene expression data. Bioinformatics. 2005;21:502–508. doi: 10.1093/bioinformatics/bti023. [DOI] [PubMed] [Google Scholar]
  • 91.Reiner A, Yekutieli D, Benjamini Y. Identifying differentially expressed genes using false discovery rate controlling procedures. Bioinformatics. 2003;19:368–375. doi: 10.1093/bioinformatics/btf877. [DOI] [PubMed] [Google Scholar]
  • 92.Chain PS, Grafham DV, Fulton RS, Fitzgerald MG, Hostetler J, et al. Genomics. Genome project standards in a new era of sequencing. Science. 2009;326:236–237. doi: 10.1126/science.1180614. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Classification of the L. longbeachae CDS in the different COG groups. 2,506 CDS are classified in at least one COG group. Since several genes are assigned to multiple categories, the total number of assignments is greater than the number of ORFs in the genome.

(11.39 MB TIF)

Figure S2

Synteny plot of the chromosomes of L. pneumophila strain Paris and L. longbeachae NSW150. The plot was created using the mummer software package (http://mummer.sourceforge.net/).

(6.88 MB TIF)

Figure S3

Comparison of the plasmids identified in L. longbeachae and L. pneumophila. (A) Synteny LinePlot between the L. longbeachae plasmid and the plasmids of L. pneumophila strain Lens and Paris, respectively. Orthologous genes are defined by bi-directional blastP best hits (BDBH) or a blastP alignment threshold of 35% sequence identity over 80% of the length of the smaller protein. The gap parameter, representing the maximum number of consecutive genes that are not involved in a synteny group was 3. (B) Percentage of aminoacid identity among Tra proteins of the L. longbeachae and the L. pneumophila strain Lens as compared to the Tra region of strain Paris. (C) Venn diagram showing the common and specific gene content of the plasmids of L. pneumophila strains Paris, Lens and L. longbeachae NSW150.

(17.22 MB TIF)

Figure S4

Distribution of SNPs along the chromosome of L. longbeachae ATCC39462 (Sg1) and C-4E7 (Sg2) with respect to the completely sequence genome of L. longbeachae NSW 150 (Sg1). Outer circle, Mapping of SNPs between L. longbeachae Sg1 (NSW150) and Sg2 (C-4E7), central circle in green, sequence couverage of mapped reads of strain ATCC39462 on the NSW150 genome, inner circle; SNP distributon among the two Sg1 strains sequenced. 1426 SNPs are located in 7 genomic regions; region 1: llo0557-llo0587 containing 112 SNPs; region 2: llo0643-llo0653, carries an integrase gene and contains 152 SNPs; region 3: llo0814-llo0841 containing 38 SNPs; region 4: llo0943-llo0952, carries an integrase gene and contains 152 SNPs; region 5: llo1813-llo1886, carries many tra- like genes and contains 651 SNPs; region 6: llo2119-llo2142, contains 89 SNPs, region 7: llo3148-llo3180, carries genes encoding the putative capsule and contains 166 SNPs.

(10.54 MB TIF)

Figure S5

Aminoacid alignment of the RAS-domains of different L. longbeachae proteins identified in the genome of strain NSW150. PFAM was used to align the different sequences (http://pfam.sanger.ac.uk/).

(14.63 MB TIF)

Figure S6

Alignment of the putative LPS-encoding region of L. longbeachae Sg1 and Sg2 using the ARTEMIS comparison tool. Note the nearly perfect alignment of the four segments with only two regions differing between Sg1 and Sg2. Furthermore, the putative LPS-coding region of the two strains of the same Sg line perfectly up with a over 90% nucleotide identity. Specific regions and the predicted proteins encoded are depicted below.

(8.74 MB TIF)

Table S1

L. longbeachae NSW150 protein coding genes and their distribution within functional categories.

(0.03 MB DOC)

Table S2

Specific genes of L. longbeachae without orthologues in any of the four sequenced L. pneumophila genomes.

(0.50 MB DOC)

Table S3

Distribution of known and predicted Dot/Icm substrates of L. pneumophila in L. longbeachae.

(0.31 MB DOC)

Table S4

Putative capsule and LPS encoding genes in L. longbeachae and its comparison to L. pneumophila Paris.

(0.14 MB DOC)

Table S5

Analysis of the FlgD, FleR/S, and FliA/FleN encoding regions in L. longbeachae.

(0.05 MB DOC)

Table S6

Transcriptional regulators identified in L. longbeachae and their orthologs in L. pneumophila.

(0.30 MB DOC)

Table S7

Genes upregulated in L. longbeachae in exponential growth phase.

(0.23 MB DOC)

Table S8

Genes upregulated in L. longbeachae in post-exponetial growth phase.

(0.35 MB DOC)

Table S9

Sequence of primers used to amplify putative flagella gene encoding regions.

(0.04 MB DOC)


Articles from PLoS Genetics are provided here courtesy of PLOS

RESOURCES