Expression of βB₂-Crystallin mRNA and Protein in Retina, Brain, and Testis

Abstract

Purpose

To evaluate the expression of βB₂-crystallin mRNA and protein in rat, bovine, and human nonlens and nonocular tissues.

Methods

βB₂-crystallin mRNA levels were detected by RT-PCR. βB₂-crystallin protein was purified from rat and bovine tissues by FPLC chromatography. FPLC fractions were analyzed by immunoblotting. The identity of βB₂-crystallin protein, isolated from the retina, was confirmed by protein microsequencing.

Results

βB₂-crystallin transcript was detected in rat brain, rat testis, and human retina by RT-PCR. βB₂-crystallin transcript was not found in rat lung, heart, ovary, spleen, thymus, kidney, and liver or in human brain and testis. βB₂-crystallin protein was partially purified from and its identity confirmed in rat brain, rat testis, and bovine retina. The bovine retinal protein was further confirmed to be authentic βB₂-crystallin by protein microsequencing.

Conclusions

These results establish that βB₂-crystallin mRNA and protein are expressed in tissues outside of the lens and outside of the eye including retina, brain, and testis. Extralenticular and extraocular expression of βB₂-crystallin, coupled with its participation in phosphorylation pathways, suggests that it has nonrefractive functions in these tissues.

The crystallin proteins that make up the transparent eye lens were originally thought to be restricted to the lens and to have entirely refractive functions. It is now established that several crystallins, including members of the α-, β-, and γ-crystallin gene families, are expressed outside of the lens where they may have nonrefractive functions.^1–11 Indeed, both αA- and αB-crystallins are expressed in nonlens tissues^1,2,4,5 and are functional chaperones that protect other proteins against thermal insult.^12,13 α-Crystallins are also phosphorylated by cAMP-dependent^14,15 and cAMP-independent^16–18 pathways, suggesting that they may participate in signal transduction pathways.¹⁸

Like α-crystallin, βB₂-crystallin has also been detected outside of the lens.^3,7,9,10 βB₂-crystallin protein has been reported in chicken retina,³ and βB₂-crystallin mRNA has been reported in rat brain, testis, lung, and other tissues.^9,10 βB₂-crystallin is also involved in cAMP-dependent¹⁹ and cAMP-independent phosphorylation pathways.⁹ Extralenticular expression of βB₂-crystallin, coupled with its role in phosphorylation pathways, suggests that it may have an important nonrefractive function. To date, βB₂-crystallin protein has not been reported outside of the eye, and no information about its human nonlens expression is available. In the present report, we investigated the mRNA and protein expression patterns of βB₂-crystallin in rat, bovine, and human tissues. We show that both βB₂-crystallin mRNA and protein are present in nonlens and nonocular tissues.

The results support the possibility that βB₂-crystallin has one or more nonrefractive functions in nonocular tissues.

Methods

Reverse Transcriptase PCR of βB₂-Crystallin

Three different procedures were used to amplify βB₂-crystallin mRNA. Rat Procedure: Total RNA from 3-day-old rat brain, testis, and lens was prepared using RNAzol (Tel-Test, Friendsworth, TX) as directed by the manufacturer. Ten or 2.0 μg of rat brain or testis and 2.0 μg of rat lens RNA were reverse-transcribed using mouse Moloney tumor virus reverse transcriptase (100 U/rxn; Gibco-BRL, Bethesda, MD) according to the manufacturer. Identical samples were prepared in the absence of reverse transcriptase as controls. After first-strand synthesis, PCR was performed for 30 cycles using Taq polymerase (Perkin-Elmer Cetus, Foster City, CA) as recommended by the manufacturer. The oligonucleotide sequences used in this procedure are shown in Table 1 as primer sets 3 and 4, annealing to exons 3 and 6, and 4 and 6, respectively. The resulting RT-PCR products were separated by electrophoresis on 1.0% gels and visualized by ethidium staining. In addition to the above, total RNA was also analyzed by isolation from 60- to 90-day-old rat tissues using RNAzol. Total RNA from rat testis was also obtained from Ambion, Inc. (Austin, TX). Reverse transcription and cDNA amplification (35 and 40 cycles) were then conducted with the One-Step RT-PCR System according to the manufacturer (Gibco-BRL), and identical reactions were performed with heat-inactivated reverse transcriptase as control. The oligonucleotides used in this procedure are shown in Table 1 as primer sets 1 and 2 and anneal to βB₂-crystallin exons 2 and 6. As control, β-actin was coamplified in identical reactions. The sequence of the β-actin primers were 5′OH-TCATGAAGTGTGACGTTGACATCCGT-3′ + 5′OH-CCTAGAAGCATTTGCGGTGCACGATG-3′. Products were separated by electrophoresis on 0.8% gels and visualized by ethidium staining. To confirm the identity of the RT-PCR fragments, the lens and brain products were cloned and sequenced to ensure they represented authentic βB₂-crystallin. Human Procedure: βB₂-crystallin was reverse-transcribed and PCR-amplified for 40 cycles from human lens RNA (prepared as indicated above) or PCR-amplified for 40 cycles using purified total cDNA prepared from retina, brain, and testis. The retina, brain, and testis total cDNAs were a gift from Ignacio Rodriquez of the National Eye Institute. Total cDNA was amplified with Amplitaq polymerase according to the manufacturer (BRL). The oligonucleotide sequences used for this procedure are shown in Table 1 as primer pair 5. These primers anneal to exons 2 and 6 of the βB₂-crystallin mRNA. Control β-actin transcripts were coamplified in identical reactions.

Table 1.

Oligonucleotide Sets Used for RT-PCR Amplification

Species	Oligonucleotide Sequence	Position	Temperature (°C)	No. Cycles
Rat	(1) F: 5′GTCACCTCGACACCAGAGAG3′	1–20	52	35
	R: 5′CACTCTGGGTGTCAGGAGGA3′	710–691
	(2) F: 5′CCACCATGGCCTCAGACCACCAGACAC3′	22–48	68	40
	R: 5′GTCCTTGTAATCCCCCTTCTCCAGCAG3′	545–518
	(3) F: 5′CTCCGTCCTGGTGCAGGCTGG3′	176–196	54	30
	R: 5′GTAATCCCCCTTCTCCAGCAG3′	539–519
	(4) F: 5′CCCATCAAAGTGGACAGCCAG3′	321–341	54	30
	R: 5′GTAATCCCCCTTCTCCAGCAG3′	539–519
Human	(5) F: 5′CCACCATGGCCTCAGATCACCAGAC3′	8–32	68	40
	R: 5′GTCCTTGTAGTCTCCCTTCTCCAGCAG3′	531–505

F, forward; R, reverse.

Purification of βB₂-Crystallin Protein from Nonlens Tissues

Proteins were prepared and separated by FPLC chromatography on a Pharmacia HR-6 column (Uppsala, Sweden) as previously described.²⁰ Fractions coeluting with purified bovine βB₂-crystallin were collected, and protein concentrations were determined by standard methods.

Immunoblotting of Purified βB₂-Crystallin Fractions

One to 2 μg of each FPLC fraction (above) was denatured by boiling in 10% SDS buffer [10% (w/v) SDS, 0.5 M Tris-HCl (pH 6.8), 5% (v/v) 2-mercaptoethanol, and 5% (v/v) glycerol], loaded onto 12.5% polyacrylamide SDS gels, and electrophoresed. After electrophoresis, the proteins were transferred (30 V for 1 hour in 12 mM Tris-HCl, 96 mM glycine, 15% methanol) to nitrocellulose filters. The resulting blot was fixed in 25% isopropanol/10% acetic acid for 1 hour, washed with PBS for 30 minutes, and blocked with 3% bovine serum albumin in PBS for 1 hour. The blot was then washed three times in TBS (10 mM Tris-HCl, 50 mM NaCl, pH 7.5) over 15 minutes and incubated for 1 hour at room temperature with 1:1000 βB₂-crystallin antibody in 1% bovine serum albumin in TBS. The blot was subsequently washed five times in TBS over a period of 1 hour. Immunoreactive βB₂-crystallin was visualized by using the ABC kit (Pierce Biochemicals, Rockford, IL) as described by the manufacturer.

Microsequencing

A bovine retinal protein fraction coeluting with purified βB₂-crystallin was separated on a 12.5% SDS-PAGE gel, electrophoretically transferred to nitrocellulose, stained with ponceau S, and excised. The resulting sample was digested with trypsin; peptides were separated by HPLC, and a single peptide was microsequenced.

William Lane at the Harvard Microchemistry Facility conducted the HPLC and microsequencing procedures. The resulting protein sequence was aligned with the reported rat, bovine, and human βB₂-crystallin sequences using Lasergene (ver. 5.1) software (DNAStar, Madison, WI) and further analyzed using the BLAST algorithm, National Library of Medicine (NIH, Bethesda, MD).

Results

Detection of βB₂-Crystallin Transcript in Rat Testis and Brain by RT-PCR

Figure 1A shows the 228-bp and Figure 1B the 373-bp βB₂-crystallin products generated with primer pairs 4 and 3 (Table 1), respectively. Two and 10 μg total RNA (1× and 5×) were used in the RT-PCR procedure. With primer set 4 (Fig. 1A), βB₂-crystallin mRNA was detected in brain (lanes 1 and 2), testis (lanes 3 and 4), and as control lens (lane 5). With primer set 3 (Fig. 1B), very low amounts of βB₂-crystallin mRNA were detected in brain (lanes 6 and 7), whereas high levels of βB₂-crystallin mRNA were detected in testis (lanes 8 and 9) and lens (lane 10). To further confirm βB₂-crystallin expression in these tissues, fresh total RNA samples were prepared from 60-to 90-day-old rat lens, brain, lung, heart, testis, ovary, spleen, thymus, kidney, and liver and analyzed by RT-PCR with additional primer sets (Table 1, oligo sets 1 and 2). Significant amounts of βB₂-crystallin were detected in brain, lens, and testis total RNA (Fig. 1C, lanes 1 and 2; Fig. 1D, lane 1). The lens band appeared weaker than that found for brain. This is likely the result of minor degradation of this sample as evidenced by the presence of a lower band in the lens lane (Fig. 1C, lane 1) and reduced levels of the corresponding β-actin band (Fig. 1C, lane 2). All products were reverse transcriptase-specific, and representative control products from brain and lens were sequenced and confirmed to be authentic βB₂-crystallin (data not shown). β-Actin transcript was detected at high levels in corresponding reactions (Fig. 1C, lanes 3 and 4; Fig. 1D, lane 2). βB₂-crystallin mRNA was not detected by RT-PCR in 1.0 μg (Table 1, oligo set 1) or 1.4 μg (Table 1, oligo set 2) total RNA from lung, heart, ovary, spleen, thymus, kidney, or liver (data not shown).

Figure 1.

RT-PCR of βB₂-crystallin mRNA in rat brain (Br), testis (Te), and lens (Le). (A) Ethidium bromide–stained gel showing the levels of βB₂-crystallin mRNA (228 bp) in 10 μg (5×) or 2.0 μg (1×) of rat brain (lanes 1 and 2), testis (lanes 3 and 4), and lens (lane 5). Total RNA was reverse transcribed and amplified for 30 PCR cycles using primer set 4 from Table 1. (B) Ethidium bromide–stained gel showing the levels of βB₂-crystallin mRNA (373 bp) in 10 μg (5×) or 2.0 μg (1×) of rat brain (lanes 6 and 7), testis (lanes 8 and 9), and lens (lane 10). Total RNA was reverse transcribed and amplified for 30 PCR cycles using primer set 3 from Table 1. (C) Ethidium bromide–stained gel showing the levels of βB₂-crystallin mRNA (524 bp) detected by reverse transcription followed by 40 RT-PCR cycles using 1.4 μg of rat lens (lane 1) and brain (lane 2) total RNA with primer set 2 from Table 1. Indicated as control are the corresponding levels of β-actin transcript (285 bp) produced with 0.14 μg of the same lens (lane 3) and brain (lane 4) RNAs amplified at 40 cycles after reverse transcription. (D) Ethidium bromide–stained gel showing the levels of βB₂-crystallin mRNA (710 bp) in 1 μg of rat testis (lane 1) at 35 PCR cycles using primer set 1 from Table 1. Also shown as control is the corresponding level of β-actin transcript (285 bp) in 1 μg of the same sample (lane 2) amplified at 35 cycles after reverse transcription.

Detection of βB₂-Crystallin Transcript in Human Retina

To determine whether parallel patterns of βB₂-crystallin expression extended to human tissues, βB₂-crystallin mRNA levels were examined in human retina, brain, testis, and lens. Total RNA (1 μg) was used for monitoring βB₂-crystallin mRNA in lens, and purified total cDNA was used for monitoring βB₂-crystallin transcript in retina (6 ng), brain (3 ng), and testis (3 ng). Because about 3% of total RNA is mRNA and reverse-transcriptase is not 100% efficient, this amount of total cDNA is at least equivalent to the 1.0 to 1.4 μg total RNA used in the rat studies. The primers used for this analysis are shown in Table 1 (oligo set 5). βB₂-crystallin was only detected in the retina (Fig. 2, lane 2). Shown as control are βB₂-crystallin mRNA in lens (Fig. 2, lane 1) and positive expression of β-actin mRNA in all tissues (Fig. 2, lanes 5–8).

Figure 2.

RT-PCR of βB₂-crystallin mRNA in human tissues. Ethidium bromide–stained gel showing the relative levels of βB₂-crystallin mRNA (524 bp) after reverse transcription and amplification for 40 PCR cycles in 1 μg human lens RNA (lane 1), 6 ng purified human retina cDNA (lane 2), 3 ng purified human brain cDNA (lane 3), and 3 ng purified human testis cDNA (lane 4). Also indicated are the levels of β-actin transcripts (285 bp) in the same samples amplified under identical conditions (lanes 5 through 8). The primers for human βB₂-crystallin are shown in Table 1 as oligo set 5.

FPLC Elution Profile and Immunoblotting of Rat and Bovine Protein Extracts

To confirm that βB₂-crystallin protein was present in tissues where βB₂-crystallin mRNA was detected, protein extracts were prepared from the indicated tissues and partially purified by FPLC chromatography. Fractions coeluting as a dimer with purified bovine lens βB₂-crystallin (34 minutes, Fig. 3) were collected and 1 to 2 μg of each fraction analyzed by Western blot analysis with βB₂-crystallin–specific antibody. Figure 3 shows the elution profile, and Figure 4 shows the corresponding Western blot. A single 27-kDa immunoreactive band comigrating with purified βB₂-crystallin was detected in rat testis, rat brain, and bovine retina (Fig. 4, lanes 3–5, respectively). Shown as control are purified bovine lens βB₂-crystallin (Fig. 4, lane 1) and molecular weight standards (Fig. 4, lane 2).

Figure 3.

FPLC elution profile of brain, testis, and retinal tissue extracts. Individual tissues and species are indicated. Fractions coeluting with dimeric purified bovine βB₂-crystallin (indicated at 34 minutes) were collected and further analyzed.

Figure 4.

Immunoblotting of purified βB₂-crystallin. Lane 1, purified bovine lens control (2 μg); lane 3, testis (2 μg); lane 4, brain (2 μg); and lane 5, retina (2 μg). Indicated are the positions of the 27-kDa reactive bands and the prestained molecular weight standards (lane 2).

The minor bands migrating above or below the purified βB₂-crystallin control are most likely due to slight degradation and cross-linking of the overloaded sample.

Microsequencing of βB₂-Crystallin from Bovine Retina

To further confirm the identity of βB₂-crystallin protein in bovine retina, bovine retinal protein extract was prepared. FPLC was purified as described above and separated by SDS-PAGE, and the major band comigrating with purified lens βB₂-crystallin was excised from the gel. The resulting gel slice was digested with trypsin, and the resulting peptides were separated by HPLC. One peptide was chosen for microsequencing. Its sequence was identical with that reported for the corresponding region (amino acids 172–190) of bovine lens βB₂-crystallin. The sequence of this peptide, aligned with bovine,²¹ human,²² and rat²³ βB₂-crystallin is shown in Figure 5.

Figure 5.

The amino acid sequence of the HPLC-purified peptide obtained from trypsin digestion of βB₂-crystallin purified from bovine retina (boxed). Indicated are the corresponding sequences of cow, human, and rat βB₂-crystallin. Numbers located above the sequences indicate the relative amino acid positions.

Discussion

The present report shows that βB₂-crystallin protein and mRNA are expressed in the retina, brain, and testis of multiple species. βB₂-crystallin mRNA was detected in human retina, rat brain, and rat testis by RT-PCR. βB₂-crystallin protein was purified from and its identity confirmed by immunoblotting in bovine retina, rat brain, and rat testis protein extracts. The identity of bovine retinal βB₂-crystallin protein was further confirmed by microsequencing.

Differences in βB₂-crystallin expression were found between rat and human tissues. In rat, βB₂-crystallin transcript was detected in brain and testis, whereas in human, βB₂-crystallin transcript was detected only in the retina. We believe that these differences are species-specific; however, we cannot rule out the possibility that developmental or spatial expression differences could also be involved. The rat brain RNA preparation was made from cerebellum and brain stem, whereas the human brain RNA preparation was made from whole brain. Because specific subregions of human brain or testis are not available, further localization of βB₂-crystallin in these tissues will have to await the availability of these tissues.

The results of the present study are consistent with previous studies demonstrating expression of βB₂-crystallin protein in the retina of several species including rat.^3,10,16 However, the results do not coincide with a previous study that failed to detect βB₂-crystallin mRNA in rat brain and failed to detect βB₂-crystallin protein outside of the eye.¹⁰ We do not know the reason for this discrepancy; however, it is likely to be related to the fact that βB₂-crystallin protein was not FPLC fractionated in this other study and that a blotting procedure instead of direct PCR monitoring was used to examine the βB₂-crystallin transcript. The potential nonrefractive function of βB₂-crystallin in the retina, brain, and testis is not known. One possibility is that it is related to signal transduction pathways because βB₂-crystallin is known to be phosphorylated by a cAMP-dependent pathway.¹⁶ Evidence has also been reported for non-cAMP–dependent phosphorylation of βB₂-crystallin.⁹ Whatever its function, the present data extend our knowledge of βB₂-crystallin expression to the retina, brain, and testis, and they suggest a nonrefractive function for βB₂-crystallin in these tissues.