Resistance to Linezolid in a Porcine Clostridium perfringens Strain Carrying a Mutation in the rplD Gene Encoding the Ribosomal Protein L4

Abstract

Coresistance to human reserve antibiotics can be selected by antibiotics used in veterinary medicine. A Clostridium perfringens strain isolated from pig manure was resistant to the reserve drug linezolid and, simultaneously, resistant against florfenicol and erythromycin. We detected a new mutation in a highly conserved region of rplD, encoding protein L4 of the 50S ribosomal subunit. This is the first genetic substantiation of linezolid resistance in the genus Clostridium.

Clostridium perfringens is a ubiquitous bacterial agent (21). Although it belongs to the normal intestinal flora of animals and humans (18), it is known to cause diarrhea in pigs, calves, chickens, and other animals due to the production of enterotoxins. C. perfringens is also considered to be a human pathogen (20), causing not only diarrhea or gas gangrene/necrotizing fasciitis, but also severe complications like bacteremia (25) or brain abscess (5). Due to its rapid doubling time and heat resistance, it is defined as a major food-borne pathogen (18). The antimicrobial susceptibility of C. perfringens seems to have been high up to now (11, 14, 22), but most studies are constrained by a limited number of either tested isolates or antimicrobial agents.

Due to coresistance, resistance against human reserve antibiotics might be selected in animals in which the respective reserve drugs are not used at all. This has happened in the past, especially with structurally related substances like avoparcin and vancomycin (16). In addition to structural similarity of antimicrobials and genetic linkage of different resistance genes on common mobile genetic elements, coselection might also be caused by a common target of different antibiotics. For linezolid, fenicols, and macrolides, the common target is the 50S ribosomal subunit (3, 4, 24).

Within a representative study of antibiotic-resistant bacteria in pig manure (12), one strain, LFM1, was identified as Clostridium perfringens by the API biochemical test series (bioMérieux, Nürtingen, Germany). LFM1 was tested under anaerobic conditions for antimicrobial resistance in a DIN-standardized microdilution procedure (9) as described elsewhere (23) and turned out to be resistant against chloramphenicol, florfenicol, clindamycin, erythromycin, and linezolid according to the breakpoints of DIN for clindamycin and erythromycin (8) and DANMAP for chloramphenicol and florfenicol (7); for linezolid, the EUCAST non-species-related breakpoint (susceptible, ≤2 mg/liter; resistant, >4 mg/liter) was used (http://www.srga.org/eucastwt/mictab/MICoxazolidones.htm). The manure sample originated from a German fattening pig farm with more than 220 fattening pigs and was tested positive by liquid chromatography-mass spectrometry (13) for tetracycline (1.3 mg/kg), chlortetracycline (1.8 mg/kg), sulfamethazine (0.5 mg/kg), and sulfadiazine (0.8 mg/kg), but not florfenicol (detection limit of 0.02 mg/kg). From the same manure sample, a multiresistant Escherichia coli strain had been isolated as described elsewhere (12), which in addition to being resistant to eight other antimicrobial agents (Table 1) was also resistant to florfenicol.

TABLE 1.

Resistance characteristics of multiresistant C. perfringens LFM1 and E. coli isolated from one common pig manure sample

Organism	Mutation in rplD	flo gene	MIC (mg/liter)		Resistance phenotype
			Florfenicol	Linezolid
C. perfringens LFM1	404C→T	Negative	64	16	Chloramphenicol, florfenicol, erythromycin, clindamycin, linezolid
E. coli	None	Positive	>64	(>32)a	Chloramphenicol, florfenicol, ampicillin, amoxicillin-clavulanate, piperacillin, doxycycline, sulfamethoxazole-trimethoprim, neomycin, spectinomycin, streptomycin

^aNaturally resistant.

Mechanisms conferring resistance against linezolid (and other antibiotics like macrolides and fenicols) include single-nucleotide changes of the 23S rRNA (19), methylation of the 23S rRNA by a methyltransferase encoded by the cfr gene (17), or amino acid changes in protein L4 of the 50S ribosomal subunit. Concerning the last-mentioned mechanism, in S. pneumoniae, nonsusceptibility to linezolid (MIC, 4 mg/liter), combined with resistance against macrolides and chloramphenicol—accompanied by a metabolic cost—had been found to be based on 6-bp deletions in a highly conserved region of the rplD gene coding for L4 (27). Therefore, rplD genes of S. pneumoniae, available in the GenBank database (http://www.ncbi.nlm.nih.gov/GenBank/index.html) (NC011900; GeneID 7327472), and C. perfringens (NC_008261; GeneID 4203864) were compared, showing 69% identity and complete conservation in amino acids ⁶³K to R⁷⁹ of the encoded protein L4, the region in which diverse deletions of two amino acids (⁶⁷Q-T⁷⁰ and ⁶⁴P-Q⁶⁷) had been shown to interact with linezolid resistance previously (27). Thus, the complete rplD gene of C. perfringens LFM1 was amplified using the primers rplD-cpf_fw (TTCAGCCATAGCTGCCATAC) and rplD-cpf_rv (CCAGGTCCAAATAAAGGCAC), as proposed by the GenBank primerBLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). As the region of ⁵⁸K to R⁶⁹ is conserved in the L4 protein—encoded by rplD—of E. coli as well, rplD (NC_011415; GeneID 947818) was also amplified in E. coli using the primers rplD-eco_fw (TGCACAGCAGCTTTGATTTC) and rplD-eco_rv (TAGTACGCGTTGACGCTGAG) (GenBank primerBLAST). In addition, both the E. coli strain and C. perfringens LFM1 were examined for the presence of the flo gene using primers as described elsewhere (2). Amplicons of the rplD genes of C. perfringens and E. coli were externally sequenced (Sequiserve, Vaterstetten, Germany). The rplD amplicon of E. coli was completely identical to the GenBank reference sequence (NC_011415; GeneID 947818). The rplD amplicon of C. perfringens had one single C→T mutation at bp 404 of the rplD gene (NC_008261; GeneID 4203864), resulting in the glycine 71 replacement with aspartate. The flo gene was detected in E. coli, but not in C. perfringens.

Linezolid is a reserve drug approved for the treatment of infections with vancomycin-resistant enterococci (VRE) and methicillin-resistant Staphylococcus aureus (MRSA) (19). Linezolid resistance is as yet rare in human bacterial isolates and even rarer in bacteria from livestock, but the latter might be partly due to the fact that human reserve antibiotics are not regularly included in resistance screening of bacteria from animal-related sources. Despite this, linezolid resistance had been found e.g., in particular strains of enterococci from cattle (10), in Staphylococcus aureus from pigs (15), and in Listeria monocytogenes from raw meat (6).

Resistance against linezolid in the genus Clostridium has been described for Clostridium difficile (1, 26). For the species C. perfringens, Tyrrell et al. (26) report one strain from human clinical specimens with an intermediate linezolid MIC (4 mg/liter). The molecular base of this resistance in the genus Clostridium has not been published yet. In the C. perfringens strain LFM1, we found a new mutation resulting in an amino acid exchange (⁷¹G→⁷¹D) in a highly conserved region (⁶³KPWRQKGTGRAR⁷⁴) of the ribosomal protein L4; other mutations of this region have already been shown to interact with oxazolidinone and fenicol resistance in S. pneumoniae (27).

Florfenicol is exclusively used in veterinary medicine. For the published case, final evidence for florfenicol administration on this farm is missing, as no florfenicol was found in the manure sample (detection limit of 0.02 mg/kg). However, florfenicol showed high degradation in a storage trial (data not shown). The presence of an E. coli strain also resistant to florfenicol due to an unrelated mechanism, the presence of the flo gene, raises certain suspicion that florfenicol might have been the selective agent for the development of linezolid resistance in C. perfringens LFM1. Macrolides are regularly used in pig farming as well and cannot be excluded as the potentially selective agent. But this possibility seems less probable, as none out of four naturally susceptible bacteria from the same manure sample was resistant against macrolides (data not shown).

Up to now, resistance against linezolid in human isolates has usually developed by spontaneous mutation under treatment (19), and zoonotic infections with linezolid-resistant strains are unknown. However, attention should be paid to the fact that those spontaneous mutants might also be selected under treatment with fenicols or macrolides, as this, due to coselection, might multiply the risk of development of linezolid-resistant strains in animals during florfenicol or macrolide therapy.