Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Aug 25.
Published in final edited form as: Oncogene. 2009 Nov 23;29(8):1114–1122. doi: 10.1038/onc.2009.409

Adenosine A1 receptor, a target and regulator of ERα action, mediates the proliferative effects of estradiol in breast cancer

Zhihong Lin *, Ping Yin *, Scott Reierstad *, Meghan O’Halloran *, John S Coon V *, Elizabeth K Pearson *, Gökhan M Mutlu †, Serdar E Bulun *,‡
PMCID: PMC2829108  NIHMSID: NIHMS151865  PMID: 19935720

Abstract

Estrogen receptor-α (ERα) and its ligand estradiol (E2) play critical roles in breast cancer growth and are key therapeutic targets. Here, we report a novel dual role of the adenosine A1 receptor (Adora1) as an E2/ERα target and a regulator of ERα transcriptional activity. In ERα-positive breast cancer cells, E2 up-regulated Adora1 mRNA and protein levels, an effect that was reversed by the E2 antagonist ICI 182,780. siRNA ablation of Adora1 in ERα-positive cells reduced basal and E2-dependent proliferation, whereas Adora1 over-expression in an ERα-negative cell line induced proliferation. The selective Adora1 antagonist, DPCPX, reduced proliferation, establishing Adora1 as a mediator of E2/ERα-dependent breast cancer growth. Intriguingly, Adora1 ablation decreased both mRNA and protein levels of ERα and, consequently, estrogen responsive element-dependent ERα transcriptional activity. Moreover, Adora1 ablation decreased binding activity of ERα to the promoter of its target gene TFF1 and led to reduced TFF1 promoter activity and mRNA levels, suggesting that Adora1 is required for full transcriptional activity of ERα upon E2 stimulation. Taken together, we demonstrated a short feed-forward loop involving E2, ERα, and Adora1 that favors breast cancer growth. These data suggest that Adora1 may represent an important target for therapeutic intervention in hormone-dependent breast cancer.

Keywords: Adora1, ERα, estradiol, breast cancer, G protein-coupled receptors, cell proliferation

Introduction

Breast cancer is one of the most common malignancies in women, and is the second leading cause of death for women in the United States (Landis et al., 1999). The mechanisms of breast cancer pathogenesis have been intensively studied, and new treatments targeting this disease have emerged. Drugs such as tamoxifen (Shen et al., 2008; Snoj et al., 2008), which inhibit the ability of estrogen to activate the estrogen receptor, or aromatase inhibitors (Hayashi and Yamaguchi, 2005; Howell and Buzdar, 2005), which block aromatase enzyme activity necessary for estrogen production, are used to prevent and treat hormone-responsive breast cancer. Even with aggressive mammographic screening, adjuvant chemotherapy, and intensive therapy for existing cancer however, many of the women who develop breast cancer will die from it. Identification of additional factors that contribute to breast cancer cell proliferation may enhance our understanding of this disease and potentially facilitate the development of novel therapeutic agents.

Estrogen receptor-α (ERα) and its ligand estradiol (E2) play critical roles in breast cancer growth and are important therapeutic targets for this disease (DeNardo et al., 2005; Kun et al., 2003; Pettersson and Gustafsson, 2001). There is a significant interest in understanding the mechanisms by which ERα signaling is regulated in breast cancer and using this knowledge to develop interventions to that inhibit ERα signaling (Boulay et al., 2005; Fan et al., 1999; Namba et al., 2005; Nonclercq et al., 2007). We previously reported that the adenosine A1 receptor (Adora1) is a novel target of ERα (Lin et al., 2007), the in vivo expression of which significantly correlates with the presence of ERα in breast cancer.

Adora1 is a member of the G protein-coupled receptor (GPCR) superfamily. Adora1 has been actively studied as a potential drug target for the treatment of fetal hypoxia, Pick’s disease, and for the protection of brain from traumatic brain injury and heart from ischemia-reperfusion injury (Albasanz et al., 2007; Kochanek et al., 2006; Merighi et al., 2003; Morrison et al., 2006; Wendler et al., 2007). Based on these varied roles of Adora1, it has also been suggested that the receptor may act as a potent regulator of normal and tumor cell growth by exerting antiapoptotic and prosurvival effects.

Recently, evidence has emerged that Adora1 is over-expressed in various breast cancer cell lines (Mirza et al., 2005). We demonstrated previously that Adora1 is one of many target genes of ERα, and we hypothesized that Adora1 may serve as a mediator of estrogen action in breast cancer growth. Here, we determined whether Adora1 in turn regulates the transcriptional activity of ERα in breast cancer cells. Our findings suggest that Adora1 may play a dual role as a target and a regulator of ERα in breast cancer cells, and a positive feedback loop between ERα and Adora1 signaling may modulate cancer cell proliferation.

Results

Estrogen up-regulates Adora1 mRNA and protein in breast cancer MCF-7 cells

Adora1 was identified as a novel target of ERα in our previous study (Lin et al., 2007). To investigate effect of estrogen on expression of Adora1 in MCF-7 cells, after overnight starvation, various concentrations (10−5, 10−6, 10−7, 10−8, 10−9, 10−10 and 10−11 M) of 17β-estradiol (E2) were added to the medium for a period of 3 hours. Real-time PCR was performed to measure the expression of Adora1. E2 treatment significantly up-regulated Adora1 mRNA, with the largest inductions seen at 10−5, 10−8, 10−9 M E2, and relatively lower inductions seen at 10−6, 10−7, 10−10 and 10−11 M E2 (Figure 1A). To explore the temporal response of Adora1 expression to E2 stimulation, MCF-7 cells were treated with 10−8 M concentration E2 for 5 days and the level of Adora1 expression was quantified over time by real-time PCR (Figure 1B). E2 stimulated Adora1 mRNA levels as early as 60 minutes. Adora1 expression reached 8-fold baseline levels at 4 hours, after which the magnitude of stimulation decreased gradually and disappeared by 48 hours. E2 also induced Adora1 protein levels in a time-dependent manner in MCF-7 cells (Figure 1C). A mild E2 induction of Adora1 protein was noted at 3h. A robust E2 induction of Adora1 protein was observed at 24 h, which reached a maximum level at 48 h. The E2 antagonist ICI 182,780 reversed E2-stimulated Adora1 expression (Figure 1D). These results indicated that E2 up-regulates Adora1 mRNA and protein levels in a time-and concentration-dependent manner in MCF-7 breast cancer cells.

Figure 1.

Figure 1

Effect of E2 treatment on the expression of Adora1 in MCF-7 cells. Serum-starved MCF-7 cells were stimulated with (A) variable concentrations of E2 (ranging from 10−11 to 10−5 M) or vehicle (EtOH) for 3 hours; (B) E2 (10−8 M) or vehicle (EtOH) for 15 minutes or 1, 2, 3, 4, 6, 8, 10, 24, 48, 72, 96 or 120 hours; (C) E2 (10−8 M) or vehicle (EtOH) for 0, 1, 3, 4, 8, 24, 48 hours; or (D) E2 (10−8 M), ICI 182,780 (10−6 M) or vehicle for 3 hours. Cells were harvested, total RNA was isolated, and mRNA levels of Adora1 at each dose and time points were measured by real-time PCR and normalized by GAPDH. Data are the average of 3 replicates ± SD. *, p<0.01 determined by t-test. Adora1 protein levels were measured by immunoblot. β-actin was used as a loading control.

Adora1 silencing results in significantly decreased endogenous ERα in MCF-7 cells

Up-regulation of Adora1 expression in MCF-7 cells upon E2 stimulation suggests that Adora1 may play a role in breast cancer progression. Since ERα activation is known to promote cell cycle progression (Aitken and Lippman, 1982; Altucci et al., 1996; Osborne and Schiff, 2005), we examined whether Adora1 modulates ERα function in MCF-7. Specific targeted knockdown of Adora1 mRNA and protein levels was achieved with siRNA in MCF-7 cells (Figure 2A and 2B).

Figure 2.

Figure 2

Inhibition of Adora1 results in significantly decreased endogenous ERα in MCF-7 cells. MCF-7 cells were transiently transfected with an Adora1-targeted siRNA or a control siRNA construct; (A) mRNA levels of Adora1 and ERα were measured by real-time PCR; (B) protein levels of Adora1 and ERα were measured in immunoblot analyses using the indicated antibodies; and (C) MCF-7 cells were treated with vehicle or DPCPX at the concentration of 103 µM and 104 µM for 12 h, protein levels of ERα were measured in immunoblot analyses using ERα antibody. Data are the average of 3 replicates ± SD. *, p<0.01 determined by t-test. β-actin was used as a loading control.

We monitored Adora1 knockdown efficiency by real-time PCR prior to downstream experiments. We repeated Adora1 knockdown 3 times using optimized experimental conditions. Compared with control siRNA-transfected MCF-7 cells, the real-time PCR CT values for Adora1 mRNA in cells transfected with Adora1 siRNA were 4.5- to 5-fold higher; real-time PCR delta/delta CT calculation indicated that Adora1 mRNA levels were significantly lower by 95.6% to 96.9% in cells transfected with Adora1-siRNA. The average knockdown efficiency was 96.2%±0.58 (p<0.01, t test).

In the presence of Adora1 siRNA, we found that ERα mRNA was down-regulated to approximately 60% compared with that in non-silenced cells (Figure 2A). Silencing of Adora1 also caused a significant decrease of ERα protein level (Figure 2B). These present results showed that depletion of Adora1 resulted in a marked reduction of both ERα mRNA and protein levels.

To further demonstrate that Adora1-dependent signaling regulates ERα levels, we incubated MCF-7 cells in the presence or absence of the Adora1-selective adenosine antagonist DPCPX (103 µM and 104 µM) for 12 h and measured ERα protein levels using western analysis. DPCPX is a xanthine derivative compound and highly selective Adora1 ligand (Factor et al., 2007; Haleen et al., 1987). DPCPX inhibits the effect of adenosine on Adora1 by specifically binding to this receptor. DPCPX treatment significantly abolished ERα protein (Figure 2C). This verifies the conclusion that Adora1 knockdown or inhibition of its signaling pathway ablates ERα.

Silencing of Adora1 is associated with a decrease in breast cancer cell proliferation

It has been shown that the Adora1 gene is located proximally to an ERα binding site and that its expression is induced by E2 (Lin et al., 2007). Here, we showed that depletion of Adora1 resulted in significantly decreased mRNA and protein level of ERα (Figure 2). Because ERα activation and its signaling are critical for cell proliferation (Chalbos et al., 1982; Fu et al., 2006; Laganiere et al., 2005), we tested the possibility that Adora1 modulates ERα-mediated cell proliferation in breast cancer pathobiology. MCF-7 cells were cultured in steroid-deprived medium for 3 days, and siRNA against Adora1 or control siRNA was transiently transfected into the cells for 48 hours followed by 20 to 24-hour treatment with E2 or vehicle. We confirmed Adora1 knockdown by immunoblot (Figure 3A). As shown in Figure 3B, knockdown of Adora1 in MCF-7 cells treated with or without E2 resulted in significantly decreased cell proliferation (24.9% and 14.8%, respectively) compared with cells transfected with control siRNA (14.0% and 9.5%, respectively). We confirmed this result by quantification of proliferating cell nuclear antigen (PCNA), a marker of cell proliferation and prognosis (23, 24), by immunoblot. Knockdown of Adora1 decreased cell proliferation as shown specifically by a decrease in PCNA immunostaining (Figure 3C). The lowest level of PCNA was observed in Adora1-depleted cells incubated with vehicle. In E2-treated cells, silencing of Adora1 resulted in remarkable decrease in PCNA level compared to that in the non-silenced MCF-7 cells. Data obtained from quantification of PCNA corroborated those from the MTT assay in Figure 3B. To further demonstrate a role of Adora1 in cell proliferation, we inhibited the effect of adenosine on this receptor using the Adora1-selective antagonist, DPCPX, which also attenuated in MCF-7 breast cancer cell proliferation (Figure 3D) and E2-induced cell proliferation by 2.46-fold (Figure 3E). These results indicate that depletion of Adora1 or inhibition of the downstream signaling pathway significantly decreased mRNA and protein levels of ERα, and inhibited E2-induced cell proliferation in MCF-7 cells.

Figure 3.

Figure 3

Inhibition of Adora1 by siRNA in MCF-7 cells leads to reduced cell proliferation. (A) Adora1 protein expression in MCF-7 cells transfected with control (siC) or Adora1 (siA) siRNA. β-actin levels served as a control for specificity and gel loading. Cell proliferation was analyzed by MTT assay and PCNA immunoblot analysis. (B) MCF-7 cells were incubated in the presence of control or Adora1 siRNA in the medium supplemented with 5% charcoal-stripped FBS for 48 hours and stimulated with 10 nM E2 for an additional 24 hours. MCF-7 cells were harvested for determination of cell proliferation by MTT assay. Results represent the mean of at least 3 independent experiments ± SE. (C) Immunoblot of PCNA was performed with mouse anti-human monoclonal PCNA antibody. Control siRNA- or Adora1 siRNA-transfected MCF-7 cells were treated with or without E2 (10 nM) overnight. (D) Serum-starved MCF-7 cells were treated with variable concentrations of the Adora1 antagonist DPCPX or vehicle for 24 hours. The cells were harvested for determination of cell proliferation by MTT assay. (E) Serum-starved MCF-7 cells were treated with E2 (10nM) or E2 (10nM) plus 100µM DPCPX overnight. The cells were harvested for determination of cell proliferation by MTT assay. Data are the average of 3 replicates ± SD. *, p<0.01 determined by t-test. (F) Over-expression of Adora1 expression plasmid in serum-deprived MDA-MB-231 cells. Expression of the empty vector (Empty) was used as a reference standard. Expression plasmids and empty vector (24 µg) were separately transfected into ERα− MDA-MB-231 cells in 10cm culture dishes. Cells were then harvested 48 h after transfection and over-expression efficiency was checked by Adora1 western. Cell proliferations were measured by MTT assay and by immunoblot of proliferating cell nuclear antigen (PCNA). Blots were reprobed with β-actin antibody to control for loading Columns, mean of three independent experiments; bars, SE. *, p< 0.01, t test, statistically significant differences.

Over-expression of Adora1 is associated with an increase in proliferation of ERα negative MDA-MB-231 breast cancer cells

The inhibitory effect of Adora1 depletion on cell proliferation in ER-positive MCF-7 cell prompted us to investigate whether over-expression of a full-length Adora1 cDNA in ER-negative MDA-MB-231 cells could stimulate cell proliferation. Over-expression of Adora1 increased cell proliferation as shown in Figure 3F specifically by an increase in viable cells measured by MTT assay and by PCNA immunostaining, compared with cells transfected with an empty pcDNA 3.1 vector (control). Transfection with the Adora1 expression vector significantly increased the viable cell numbers. These results further support our conclusion that Adora1 is a mediator of breast cancer cell growth.

Targeted knockdown of Adora1 inhibits ERα transcriptional activity

To determine whether Adora1 mediates ERα transcription, we examined the transcriptional activity of endogenous ERα on an ERE-dependent reporter construct in MCF-7 and T47D cells after siRNA silencing of Adora1. Specific targeted knockdown of Adora1 protein was achieved (Figure 4A in MCF-7 cell and Figure 4C in T47D). Breast cancer cells were cultured in charcoal-stripped serum for 3 days, followed by transfection of control siRNA or siRNA to Adora1 for 24 hours, then co-transfection with an (ERE)2-Luc reporter construct for 24 hours. Cells were stimulated overnight with E2 or vehicle. As shown in Figure 4, in both MCF-7 (Figure 4B) and T47D (Figure 4D) cell lines and regardless of the absence or presence of E2, ERE-mediated transcription was significantly decreased by the addition of siRNAs directed against Adora1 compared to that in non-silenced cells. In agreement with previous data, these results indicate that silencing of Adora1 significantly reduced ERα level leading to reduced transcriptional activity of ERα.

Figure 4.

Figure 4

Adora1 silencing decreases ERα transcriptional activity in breast cancer cells. MCF-7 cells were cultured with charcoal-stripped serum for 3 days. (A) Immunoblot analysis of Adora1 expression in MCF-7 cells and (C) T47D cells transfected with control (siC) or Adora1 (siA) siRNA. β-actin levels were detected to control for specificity and gel loading. (B) MCF-7 cells and (D) T47D cells were co-transfected with control siRNA or Adora1 siRNAs (100 nM), (ERE)2-Luc reporter or pGL4 vector (200 ng) and pCMVβGal (80 ng), in the presence or absence of E2 (10−8 M) overnight. Cells were then lysed and assayed for luciferase and β-gal activities. Reported normalized luciferase activities are the means ± SD from 3 independent experiments (*, p<0.01 determined by t-test).

Adora1 silencing decreases binding of ERα to TFF1 promoter and E2-induced expression of the endogenous ERα target gene- TFF1

We examined whether Adora1 plays a functional role in transcriptional activation of a known ERα target gene, TFF1, by transfecting siRNAs directed against Adora1 in MCF-7 cells. As shown in Figure 5A, knockdown of Adora1 expression resulted in a marked reduction of E2-induced recruitment of ERα to the TFF1 promoter. This result suggested that Adora1 might be required for ERα transactivation of E2-responsive gene. As shown in Figure 5B, a TFF1-luciferase promoter construct was poorly induced by E2 in Adora1 silenced MCF-7 cells compared with Adora1 non-silenced MCF-7 cells. Thus, introduction of siRNAs directed against Adora1 considerably decreased the ability of ERα to stimulate transcription from the TFF1 promoter. Next we investigated whether the presence of Adora1 is required for binding of ERα to the TFF1 promoter. To determine more directly whether Adora1 is involved in regulating expression of ERα target, we examined the effect of inhibiting Adora1 expression on E2-induced expression of ERα target gene, TFF1. The presence of the siRNAs significantly reduced the ability of E2 to stimulate the expression of a selected ERα target, TFF1 (Figure 5C), but not the non-target siRNA. These results suggest that Adora1 is required for the full ERα transcription activity. It also, in agreement with the luciferase assay with ERE-dependent construct performed in MCF-7 cells, confirms the involvement of Adora1 in the regulation of ERα target gene expression. These results demonstrate that Adora1 plays an important role in ERα binding and transcriptional activity and the necessity of Adora1 for full ligand-dependent activity of ERα.

Figure 5.

Figure 5

Silencing of Adora1 in MCF-7 cells leads to reduced binding of ERα to TFF1 promoter, TFF1 promoter driven luferase activity, and mRNA expression of TFF1. (A) Knock-down of Adora1 results in decreased binding of ERa to the TFF1 promoter. B) siRNA knock-down of Adora1 expression decreases ERα-stimulated transcriptional activation of the TFF1 promoter. MCF-7 cells were co-transfected with a TFF1-Luc reporter or pGL4 vector (200ng), pCMVβGal (80ng), and either control or Adora1 siRNA (100 nM) in the presence or absence of E2 (10−8M) overnight. C) Adora1 silencing results in significantly decreased TFF1 expression. MCF-7 cells were transfected either with control or Adora1 siRNA (100 nM) and treated with vehicle or E2 (10−8 M) overnight. Cells were then lysed, total RNA was extracted, and mRNA levels of Adora1 were measured by real-time PCR and normalized to GAPDH. Data represent the average of 3 replicates ± SD (*, p<0.05 determined by t-test).

Discussion

In this study, we provide evidence for a novel dual role of the Adora1 as a target and a regulator of E2/ERα action in breast cancer. We show that E2 up-regulates Adora1 mRNA and protein level, and that the inhibition of Adora1 either by RNAi or its selective antagonist attenuated MCF-7 breast cancer cell proliferation by abolishing ERα and its E2-dependent transcriptional activity. These findings suggest the existence of a short feed-forward loop involving E2, ERα, and Adora1 that modulate breast cancer cell proliferation.

Studies have revealed that the ERα gene is regulated at the levels of activity of its transcription factor, such as AP2 (McPherson et al., 1997), transcribed ERα mRNA stability (Kenealy et al., 2000), and its protein degradation (Alao et al., 2004). In present study, we found that ablation of Adora1 resulted in markedly decreased ERα mRNA and protein levels; this may represent a novel mechanism, by which Adora1 decrease the binding of transcription factor, such as AP2 to ERα promoter regions, which result in decreased ERα mRNA transcribed and protein translated, and therefore the reduced the binding of ERα to its target genes. While our findings do not exclude the possibility that loss of Adora1 may shorten the half-life of ERα message or enhance ubiquitin degradation of ERα, others have suggested that suppression of ERα expression, rather than decreased stability of ERα mRNA and protein, is a more likely mechanism by which ERα activity is regulated (Huang et al., 2006; Lu et al., 2003). The ERα gene contains multiple promoters, some of which are as far as 150 kb upstream of the primary transcriptional start site (Reid et al., 2002). Only a few transcription factors are known to regulate ERα expression (McPherson et al., 2007), including AP2. Additional experiments are needed to elucidate the mechanism of ERα down-regulation by ablation of Adora1.

How Adora1 exerts of its effects on ERα function in the proliferation of human breast cancer MCF-7 cells is also unclear. It is possible that Adora1 cooperates with ERα in regulating E2-dependent cell proliferation. E2 treatment significantly increased expression of Adora1, indicating that Adora1 up-regulation, mediated by ligand-activated ERα, may be involved in breast cancer initiation and progression. It is possible that ERα-mediated E2 signaling might cross-talk with Adora1-mediated signaling through an unknown mechanism that regulates transcription and proliferation.

In this study, we identified Adora1 as being essential for ERα-stimulated TFF1 promoter activity and expression. TFF1 is a prototypic gene representing a subset of ERα target promoters, and has been shown to have a important role in breast cancer cell proliferation (Prest et al., 2002). The results of the present study not only presents a new paradigm in the control of estrogen action but a mechanism by which Adora1 modulates ERα action to regulate specific genes and biological responses. Cooperation of the downstream effector is essential to both initiate and propagate the hormonal signal (Carroll et al., 2005). The ablation of Adora1 resulted in decrease of ERα and E2-induced ERα transcriptional activity. As a consequence, ERα-mediated breast cancer cell proliferation was therefore reduced.

In the study, we demonstrated the inhibitory effect of DPCPX, an Adora1 selective adenosine antagonist, on ERα signaling. DPCPX inhibits the effect of adenosine on Adora1 by specifically binding to this receptor. DPCPX was used under in vitro and in vivo conditions to evaluate the role of Adora1 in the lungs (Factor et al., 2007), brain (Ilie et al., 2009), gut (Brunsden and Grundy, 1999), heart and kidney (Moosavi et al., 2009). Preliminary experiments revealed that antagonism of Adora1 activity result in a reduction in ERK1/2 phosphorylation (data not shown), which is critical for E2-mediated cell growth (Keshamouni et al., 2002). It has been shown that ERK phosphorylation is associated with increased ERE-mediated transcription in ovarian cancer (Bourguignon et al., 2005) and breast cancer (Kuske et al., 2006). In present study, we found that depletion of Adora1 caused a decrease in both ERα mRNA and protein levels in MCF-7 breast cancer cell line. In vivo, we previously demonstrated a significant positive correlation between ERα and Adora1 mRNA levels in ERα+ breast cancer tissues (Lin et al., 2007). Our data may have clinical implications in that the ablation or antagonism of Adora1 appears to inhibit ERα-mediated tumor cell growth. Our data suggest that the blockade of signaling pathways downstream of Adora1 may have a protective effect against tumor development and that the Adora1 pathway may represent an important target for therapeutic intervention in hormone-dependent breast cancer.

Materials and methods

Cell lines

MCF-7, T47D and MDA-MB-231 cells (American Type Culture Collection, ATCC, Manassas, VA) were maintained in Minimum Essential Medium (MEM, Invitrogen, Carlsbad, CA) containing penicillin (25 U/ml), streptomycin (25 U/ml), insulin (0.01 mg/ml), and 10% fetal bovine serum (FBS). When indicated, the cells were cultured with charcoal-stripped serum for 3 days. After overnight starvation, cells were treated with E2 (10−8 M), ICI 182780, or vehicle for the indicated times. Cells were then collected and subjected to real-time PCR analysis, immunoblot, luciferase activity assay, and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Invitrogen, Carlsbad, CA).

Reagents

E2 and ICI 182780 (ICI) were obtained from the Sigma (St. Louis, MO). MTT assay kit was from Invitrogen. Final concentrations of 10−8 M and 10−6 of E2 and ICI were diluted into culture medium at the indicated times.

Real-time PCR

Total RNA was extracted from cells, treated with DNase I, and reverse transcribed using random hexamers and SuperScript III reverse transcriptase enzyme (Invitrogen). Real-Time PCR was done with SYBR Green or Taqman Real-Time Core Reagents (Applied Biosystems, ABI, Foster City, CA) on the ABI 7000 or 7900 HT Sequence Detection Systems. Primers and probes for quantification of Adora1 and ERα were purchased from ABI. Levels of expression were normalized to the GAPDH gene.

Knock-down of Adora1 by small interference RNA (siRNA)

RNA interference was carried out by using SMARTpool small interfering RNA (siRNA) designed against Adora1 and control (nontargeting) siRNA as a negative control (Dharmacon, Lafayette, CO). The target sequences of siRNA oligonucleotides against Adora1 were: 1) GGAGGAGCCUGGAGUGUAA; 2) GGUAGGUGCUGGCCUCAAA; 3) GGAGUCUGCUUGUCUUAGA; 4) CAAGAUCCCUCUCCGGUAC. To verify that these oligonucleotide sequences in the Adora1 siRNA pool specifically targeted Adora1 but not ERα mRNA, we aligned the four Adora1 siRNA oligonucleotide sequences with ERα mRNA (Locus number: NM_000125 from NCBI DNA database) by Blast alignment from National Center for Biotechnology Information (NCBI). Alignment of these sequences to ERα mRNA did not show any homology, indicating that these siRNA oligonucleotides do not target ERα mRNA. After 3 days of culture in MEM containing 10% charcoal-stripped calf serum, siRNA against Adora1 or control siRNA at a final concentration of 100 nmol/L was transfected into the MCF-7 cells for 48 hours. The cells were then stimulated with E2 (10 nM) or vehicle for 20–24 hours and harvested for analysis.

Plasmid constructs

To generate the estrogen-responsive luciferase reporter construct (ERE)2-Luc for transient transfection assays in breast cancer cell lines, a synthesized oligo contained consensus ERE sites (GTACCAGGTCACAGTGACCTGATCAGCTAGTCAAGGTCACAGTCCTTCGTAC) was ligated into the blunted HindIII site of the pGL4.10 [luc 2] vector (Promega, Madison, WI). The promoter region of the TFF1 gene from nucleotides −428 to −332 (Nunez et al., 1989) was amplified and then ligated into PGL4.10 [luc 2]. The plasmid constructs above were confirmed by sequencing.

To investigate inducible effect of Adora1 expression on cell proliferation, a full-length Adora1 cDNA was cloned into the pcDNA3.1 vector (Invitrogen, Carlsbad, CA). The cDNA has been amplified after reverse transcription of Adora1 mRNA from MCF-7 cells. We used the following primers for PCR amplification: forward primer, 5’ CAC CAT GCC GCC CTC CAT CT 3’ and reverse primer, 5’ GTC ATC AGG CCT CTC TTC TGG 3’. The PCR profile was 3 min at 94°C, followed by 40 cycles of 30 s at 94°C, 30 s at 60°C, and 1min at 72°C, and a final extension of 7 min at 72°C. The amplified fragments were analyzed on a 1% agarose gel. The PCR fragments were directly cloned into the pcDNA3.1 expression vector (Invitrogen) as described in the manufacturer's protocol and sequenced to check its fidelity.

Luciferase assay

Hormone-depleted breast cancer cells were transfected with Adora1 or control siRNA (final concentration 100 nM, Dharmacon) using Fugene HD transfection reagent (Roche, Indianapolis, IN) for 24 hours. The cells were then co-transfected with (ERE)2-Luc plasmid or empty vector for 24 hours followed by treatment with or without E2 (10−8 M) overnight. Cells were then harvested and assayed for luciferase and pCMVβ-gal (a constitutive β-galactosidase expression vector used to normalize transfection efficiency) activities (Promega).

Over-expression of Adora1 gene in MDA-MB-231 cells

Hormone-depleted MDA-MB-231 cells were transfected with Adora1 expression plasmid or pcDNA3.1 empty vector using Fugene HD transfection reagent for 48 hours. Adora1 expression vector or pcDNA3.1 empty plasmid (24 µg) was transfected to cells cultured in 10cm-dishes, as described in the manufacturer's protocol. Cells were then harvested at 48 hours after transfection and over-expression efficiency was checked by western. Cell proliferations were measured by MTT assay and by immunoblot of proliferating cell nuclear antigen (PCNA) as described below.

Chromatin immunoprecipitation (ChIP)

After knock-down of Adora1 with siRNA, cells were subjected to ChIP with ERα based on a protocol described previously (Lin et al., 2007). The immunoprecipitated and input DNA samples were assayed for binding to the TFF1 promoter region. The primers were: Forward primer, 5’ GGCCATCTCTCACTATGAATCACTTCTGC 3’; Reverse primer, 5’ GGCAGGCTCTGTTTGCTTAAAGAGCG 3’. For PCR, 1 µl of purified DNA was used in the following PCR profile: 3 minutes at 94 °C, followed by 35 cycles of 30 seconds at 94 °C, 30 seconds at 60 °C, and 30 seconds at 72 °C; and a final extension of 7 minutes at 72°C. The amplified PCR products were analyzed on a 1% agarose gel.

Cell proliferation assay

Cell proliferation was measured by immunoblot of proliferating cell nuclear antigen (PCNA) or by utilizing the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay (Invitrogen). After transfection and treatment, the MTT reagent was applied for 4 hours and the resulting formazan crystals were dissolved overnight. The result was measured on the plate reader set to record absorbance at 570 nm.

Protein extraction and immunoblotting

Protein was extracted from treated cells and immunoblot was performed by using ERα (Millipore, Billerica, MA), PCNA, or β-actin (loading control) antibodies based on a standard protocol as follows. Aliquots of 20 µg of total protein were separated on a 10% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane (Millipore). The membrane was blocked for 1 hour at room temperature with 5% milk in TBS followed by hybridization with primary antibodies at a dilution of 1:1000 directed against the following: A1 adenosine receptor (Adora1, rabbit polyclonal, EMD), ERα (rabbit monoclonal, Millipore); PCNA (mouse monoclonal, Millipore); β-actin (mouse monoclonal, 1:10,000 dilution, Sigma). After washing, the membrane was then incubated for 1 hour at room temperature with appropriate horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology, Danvers, MA) at a dilution of 1:4,000. Immunoreactive bands were detected by a chemiluminescence (Pierce, Rockford, IL) and visualized by autoradiography.

Acknowledgements

This study was supported by grants from the NIH (R01CA067167), AVON Foundation, Lynn Sage Foundation, and Northwestern Memorial Foundation. We thank Megha Reddi for expert technical assistance.

Footnotes

All authors declare no conflict of interest

References

  1. Aitken SC, Lippman ME. Hormonal regulation of net DNA synthesis in MCF-7 human breast cancer cells in tissue culture. Cancer Res. 1982;42:1727–1735. [PubMed] [Google Scholar]
  2. Alao JP, Lam EW, Ali S, Buluwela L, Bordogna W, Lockey P, et al. Histone deacetylase inhibitor trichostatin A represses estrogen receptor alpha-dependent transcription and promotes proteasomal degradation of cyclin D1 in human breast carcinoma cell lines. Clin Cancer Res. 2004;10:8094–8104. doi: 10.1158/1078-0432.CCR-04-1023. [DOI] [PubMed] [Google Scholar]
  3. Albasanz JL, Rodriguez A, Ferrer I, Martin M. Up-regulation of adenosine A1 receptors in frontal cortex from Pick's disease cases. Eur J Neurosci. 2007;26:3501–3508. doi: 10.1111/j.1460-9568.2007.05965.x. [DOI] [PubMed] [Google Scholar]
  4. Altucci L, Addeo R, Cicatiello L, Dauvois S, Parker MG, Truss M, et al. 17beta-Estradiol induces cyclin D1 gene transcription, p36D1-p34cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G(1)-arrested human breast cancer cells. Oncogene. 1996;12:2315–2324. [PubMed] [Google Scholar]
  5. Boulay A, Rudloff J, Ye J, Zumstein-Mecker S, O'Reilly T, Evans DB, et al. Dual inhibition of mTOR and estrogen receptor signaling in vitro induces cell death in models of breast cancer. Clin Cancer Res. 2005;11:5319–5328. doi: 10.1158/1078-0432.CCR-04-2402. [DOI] [PubMed] [Google Scholar]
  6. Bourguignon LY, Gilad E, Rothman K, Peyrollier K. Hyaluronan-CD44 interaction with IQGAP1 promotes Cdc42 and ERK signaling, leading to actin binding, Elk-1/estrogen receptor transcriptional activation, and ovarian cancer progression. J Biol Chem. 2005;280:11961–11972. doi: 10.1074/jbc.M411985200. [DOI] [PubMed] [Google Scholar]
  7. Brunsden AM, Grundy D. Sensitization of visceral afferents to bradykinin in rat jejunum in vitro. J Physiol. 1999;521(Pt 2):517–527. doi: 10.1111/j.1469-7793.1999.00517.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Carroll JS, Liu XS, Brodsky AS, Li W, Meyer CA, Szary AJ, et al. Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1. Cell. 2005;122:33–43. doi: 10.1016/j.cell.2005.05.008. [DOI] [PubMed] [Google Scholar]
  9. Chalbos D, Vignon F, Keydar I, Rochefort H. Estrogens stimulate cell proliferation and induce secretory proteins in a human breast cancer cell line (T47D) J Clin Endocrinol Metab. 1982;55:276–283. doi: 10.1210/jcem-55-2-276. [DOI] [PubMed] [Google Scholar]
  10. DeNardo DG, Kim HT, Hilsenbeck S, Cuba V, Tsimelzon A, Brown PH. Global gene expression analysis of estrogen receptor transcription factor cross talk in breast cancer: identification of estrogen-induced/activator protein-1-dependent genes. Mol Endocrinol. 2005;19:362–378. doi: 10.1210/me.2004-0267. [DOI] [PubMed] [Google Scholar]
  11. Factor P, Mutlu GM, Chen L, Mohameed J, Akhmedov AT, Meng FJ, et al. Adenosine regulation of alveolar fluid clearance. Proc Natl Acad Sci U S A. 2007;104:4083–4088. doi: 10.1073/pnas.0601117104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fan S, Wang J, Yuan R, Ma Y, Meng Q, Erdos MR, et al. BRCA1 inhibition of estrogen receptor signaling in transfected cells. Science. 1999;284:1354–1356. doi: 10.1126/science.284.5418.1354. [DOI] [PubMed] [Google Scholar]
  13. Fu HJ, Jia LT, Bao W, Zhao J, Meng YL, Wang CJ, et al. Stable knockdown of estrogen receptor alpha by vector-based RNA interference suppresses proliferation and enhances apoptosis in breast cancer cells. Cancer Biol Ther. 2006;5:842–847. doi: 10.4161/cbt.5.7.2840. [DOI] [PubMed] [Google Scholar]
  14. Haleen SJ, Steffen RP, Hamilton HW. PD 116,948, a highly selective A1 adenosine receptor antagonist. Life Sci. 1987;40:555–561. doi: 10.1016/0024-3205(87)90369-9. [DOI] [PubMed] [Google Scholar]
  15. Hayashi S, Yamaguchi Y. Estrogen signaling and prediction of endocrine therapy. Cancer Chemother Pharmacol. 2005;56(Suppl 1):27–31. doi: 10.1007/s00280-005-0096-2. [DOI] [PubMed] [Google Scholar]
  16. Howell A, Buzdar A. Are aromatase inhibitors superior to antiestrogens? J Steroid Biochem Mol Biol. 2005;93:237–247. doi: 10.1016/j.jsbmb.2005.02.004. [DOI] [PubMed] [Google Scholar]
  17. Huang Y, Keen JC, Pledgie A, Marton LJ, Zhu T, Sukumar S, et al. Polyamine analogues down-regulate estrogen receptor alpha expression in human breast cancer cells. J Biol Chem. 2006;281:19055–19063. doi: 10.1074/jbc.M600910200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ilie A, Ciocan D, Constantinescu AO, Zagrean AM, Nita DA, Zagrean L, et al. Endogenous activation of adenosine A1 receptors promotes post-ischemic electrocortical burst suppression. Neuroscience. 2009;159:1070–1078. doi: 10.1016/j.neuroscience.2009.01.025. [DOI] [PubMed] [Google Scholar]
  19. Kenealy MR, Flouriot G, Sonntag-Buck V, Dandekar T, Brand H, Gannon F. The 3'-untranslated region of the human estrogen receptor alpha gene mediates rapid messenger ribonucleic acid turnover. Endocrinology. 2000;141:2805–2813. doi: 10.1210/endo.141.8.7613. [DOI] [PubMed] [Google Scholar]
  20. Keshamouni VG, Mattingly RR, Reddy KB. Mechanism of 17-beta-estradiol-induced Erk1/2 activation in breast cancer cells. A role for HER2 AND PKC-delta. J Biol Chem. 2002;277:22558–22565. doi: 10.1074/jbc.M202351200. [DOI] [PubMed] [Google Scholar]
  21. Kochanek PM, Vagni VA, Janesko KL, Washington CB, Crumrine PK, Garman RH, et al. Adenosine A1 receptor knockout mice develop lethal status epilepticus after experimental traumatic brain injury. J Cereb Blood Flow Metab. 2006;26:565–575. doi: 10.1038/sj.jcbfm.9600218. [DOI] [PubMed] [Google Scholar]
  22. Kun Y, How LC, Hoon TP, Bajic VB, Lam TS, Aggarwal A, et al. Classifying the estrogen receptor status of breast cancers by expression profiles reveals a poor prognosis subpopulation exhibiting high expression of the ERBB2 receptor. Hum Mol Genet. 2003;12:3245–3258. doi: 10.1093/hmg/ddg347. [DOI] [PubMed] [Google Scholar]
  23. Kuske B, Naughton C, Moore K, Macleod KG, Miller WR, Clarke R, et al. Endocrine therapy resistance can be associated with high estrogen receptor alpha (ERalpha) expression and reduced ERalpha phosphorylation in breast cancer models. Endocr Relat Cancer. 2006;13:1121–1133. doi: 10.1677/erc.1.01257. [DOI] [PubMed] [Google Scholar]
  24. Laganiere J, Deblois G, Lefebvre C, Bataille AR, Robert F, Giguere V. From the Cover: Location analysis of estrogen receptor alpha target promoters reveals that FOXA1 defines a domain of the estrogen response. Proc Natl Acad Sci U S A. 2005;102:11651–11656. doi: 10.1073/pnas.0505575102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Landis SH, Murray T, Bolden S, Wingo PA. Cancer statistics, 1999. CA Cancer J Clin. 1999;49:8–31. doi: 10.3322/canjclin.49.1.8. 1. [DOI] [PubMed] [Google Scholar]
  26. Lin Z, Reierstad S, Huang CC, Bulun SE. Novel estrogen receptor-alpha binding sites and estradiol target genes identified by chromatin immunoprecipitation cloning in breast cancer. Cancer Res. 2007;67:5017–5024. doi: 10.1158/0008-5472.CAN-06-3696. [DOI] [PubMed] [Google Scholar]
  27. Lu J, Pierron A, Ravid K. An adenosine analogue, IB-MECA, down-regulates estrogen receptor alpha and suppresses human breast cancer cell proliferation. Cancer Res. 2003;63:6413–6423. [PubMed] [Google Scholar]
  28. McPherson LA, Baichwal VR, Weigel RJ. Identification of ERF-1 as a member of the AP2 transcription factor family. Proc Natl Acad Sci U S A. 1997;94:4342–4347. doi: 10.1073/pnas.94.9.4342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. McPherson LA, Woodfield GW, Weigel RJ. AP2 transcription factors regulate expression of CRABPII in hormone responsive breast carcinoma. J Surg Res. 2007;138:71–78. doi: 10.1016/j.jss.2006.07.002. [DOI] [PubMed] [Google Scholar]
  30. Merighi S, Mirandola P, Varani K, Gessi S, Leung E, Baraldi PG, et al. A glance at adenosine receptors: novel target for antitumor therapy. Pharmacol Ther. 2003;100:31–48. doi: 10.1016/s0163-7258(03)00084-6. [DOI] [PubMed] [Google Scholar]
  31. Mirza A, Basso A, Black S, Malkowski M, Kwee L, Pachter JA, et al. RNA interference targeting of A1 receptor-overexpressing breast carcinoma cells leads to diminished rates of cell proliferation and induction of apoptosis. Cancer Biol Ther. 2005;4:1355–1360. doi: 10.4161/cbt.4.12.2196. [DOI] [PubMed] [Google Scholar]
  32. Moosavi SM, Bayat G, Owji SM, Panjehshahin MR. Early renal post-ischaemic tissue damage and dysfunction with contribution of A1-adenosine receptor activation in rat. Nephrology (Carlton) 2009;14:179–188. doi: 10.1111/j.1440-1797.2008.01024.x. [DOI] [PubMed] [Google Scholar]
  33. Morrison RR, Teng B, Oldenburg PJ, Katwa LC, Schnermann JB, Mustafa SJ. Effects of targeted deletion of A1 adenosine receptors on postischemic cardiac function and expression of adenosine receptor subtypes. Am J Physiol Heart Circ Physiol. 2006;291:H1875–H1882. doi: 10.1152/ajpheart.00158.2005. [DOI] [PubMed] [Google Scholar]
  34. Namba R, Young LJ, Maglione JE, McGoldrick ET, Liu S, Wurz GT, et al. Selective estrogen receptor modulators inhibit growth and progression of premalignant lesions in a mouse model of ductal carcinoma in situ. Breast Cancer Res. 2005;7:R881–R889. doi: 10.1186/bcr1317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nonclercq D, Journe F, Laios I, Chaboteaux C, Toillon RA, Leclercq G, et al. Effect of nuclear export inhibition on estrogen receptor regulation in breast cancer cells. J Mol Endocrinol. 2007;39:105–118. doi: 10.1677/JME-07-0040. [DOI] [PubMed] [Google Scholar]
  36. Nunez AM, Berry M, Imler JL, Chambon P. The 5' flanking region of the pS2 gene contains a complex enhancer region responsive to oestrogens, epidermal growth factor, a tumour promoter (TPA), the c-Ha-ras oncoprotein and the c-jun protein. Embo J. 1989;8:823–829. doi: 10.1002/j.1460-2075.1989.tb03443.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Osborne CK, Schiff R. Estrogen-receptor biology: continuing progress and therapeutic implications. J Clin Oncol. 2005;23:1616–1622. doi: 10.1200/JCO.2005.10.036. [DOI] [PubMed] [Google Scholar]
  38. Pettersson K, Gustafsson JA. Role of estrogen receptor beta in estrogen action. Annu Rev Physiol. 2001;63:165–192. doi: 10.1146/annurev.physiol.63.1.165. [DOI] [PubMed] [Google Scholar]
  39. Prest SJ, May FE, Westley BR. The estrogen-regulated protein, TFF1, stimulates migration of human breast cancer cells. FASEB J. 2002;16:592–594. doi: 10.1096/fj.01-0498fje. [DOI] [PubMed] [Google Scholar]
  40. Reid G, Denger S, Kos M, Gannon F. Human estrogen receptor-alpha: regulation by synthesis, modification and degradation. Cell Mol Life Sci. 2002;59:821–831. doi: 10.1007/s00018-002-8470-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Shen Y, Costantino JP, Qin J. Tamoxifen chemoprevention treatment and time to first diagnosis of estrogen receptor-negative breast cancer. J Natl Cancer Inst. 2008;100:1448–1453. doi: 10.1093/jnci/djn320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Snoj N, Paridaens R, Cufer T. Current controversies in extended adjuvant endocrine therapy for early breast cancer. Curr Opin Oncol. 2008;20:627–633. doi: 10.1097/CCO.0b013e3283136770. [DOI] [PubMed] [Google Scholar]
  43. Wendler CC, Amatya S, McClaskey C, Ghatpande S, Fredholm BB, Rivkees SA. A1 adenosine receptors play an essential role in protecting the embryo against hypoxia. Proc Natl Acad Sci U S A. 2007;104:9697–9702. doi: 10.1073/pnas.0703557104. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES