DNA ligase IV as a new molecular target for temozolomide

Abstract

This work was designed to clarify details in repair pathways acting to remove DNA double strand breaks (DSB) induced by temozolomide (TMZ). Cultured mouse embryonic fibroblasts were used which were deficient in their DNA DSB repair ability. Cell sensitivity to drug treatments was assessed using colony forming assays. The most effective molecular target which was correlated with TMZ cell sensitivity was DNA Ligase IV (Lig4). In addition, it was found that siRNA for Lig4 efficiently enhanced cell lethality induced by TMZ in human glioblastoma A172 cells. These findings suggest that down regulation of Lig4 might provide a useful tool for cell sensitization during TMZ chemotherapy.

1. Introduction

Alkylating drugs are the oldest class of anti-cancer drugs which are still commonly in use, and they remain important in the treatment of several types of cancers [1,2]. Temozolomide (TMZ) is a methylating agent which prolongs survival when administered during and after radiotherapy used as a first-line treatment for glioblastoma [3], and TMZ also has significant activity against recurrent glioma [4,5]. However, the therapeutic efficacy of TMZ is limited because of tumor drug resistance.

TMZ causes the methylation of guanine (G) on its N⁷and O⁶ atoms, and the methylation of adenine (A) on its N³ atom [6]. O⁶-methylG is repaired through the action of O⁶-methylG-DNA methyltransferase (MGMT) [7]. Early studies showed that MGMT deficient cells were unable to repair O⁶-methylG damage and were therefore more sensitive to the effects of methylating agents than cells with normal levels of MGMT [8,9]. This observation has been utilized experimentally and in many clinical trials, because MGMT can be inhibited by the O⁶-methylG analogue O⁶-benzylG and by other agents [10–12]. Elevated levels of MGMT and/or a nonfunctional mismatch repair pathway have been blamed for much of the observed resistance to TMZ [13], but it has also been suggested that the repair of O⁶-methylG by MGMT is not the sole mechanism responsible for resistance to alkylating agents [14–17].

DNA double-strand breaks (DSBs) occur in wild-type cells and in other cell culture systems in response to treatments with methylating agents [18,19]. Since DSBs are likely to be the final trigger leading to cell death, it would thus be expected that cells defective in DSB repair would be more sensitive to methylating agents. DSBs are repaired through the homologous recombination (HR) and non-homologous end joining (NHEJ) [20] pathways. In human cells, the proteins involved in HR include members of the MRN complex (meiotic recombination 11 (MRE11)/radiation sensitive mutant 50 (Rad50)/Nijmegen breakage syndrome 1 (NBS1)), Rad51, the Rad51 paralogs (Rad51B, Rad51C, Rad51D), X-ray repair cross-complementing group 2 (XRCC2) and group 3 (XRCC3), Rad54, and Rad54B [20]. The proteins involved in the NHEJ pathway include Ku70/80, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ligase IV (Lig4) and XRCC4 [20].

The work described here was designed to lead to a better understanding of details in the DSB repair pathways which contribute to TMZ sensitivity. The activity of components of HR repair (XRCC2 and Rad54) and NHEJ repair (Lig4) leading to TMZ-induced DNA damage were assessed using clonogenic survival assays. A panel of p53 tumor suppressor gene knockout mouse embryonic fibroblast cell lines (MEFs) was used which contained cells which were defective in specific components in the repair pathways (XRCC2, Rad54 and Lig4).

Next, to test whether the resulting observations were applicable to glioma cells, targeted repair pathways were down regulated using small interference RNAs (siRNA), and the sensitivity of human glioblastoma A172 cells to TMZ was measured. In order to determine if DSBs were formed in response to TMZ, the expression of γH2AX was monitored at different times following treatment with TMZ in cells deficient in specific repair pathway components, and in the corresponding parental cells. Hopefully, the DNA repair mechanism which was identified as contributing to TMZ resistance in this study will be able to provide tools which can be utilized to improve drug efficacy.

2. Materials and methods

2.1. Cell lines

The cell lines used in these studies were the MEF cell lines XRCC2−/− p53−/− (XRCC2−/−); XRCC2+/+p53−/− (XRCC2+/+); Rad54−/−Lig4+/+p53−/− (Rad54−/−); Rad54+/+Lig4−/− p53−/− (Lig4−/−); Rad54−/−Lig4−/− p53−/− (Rad54−/−Lig4−/−); and Rad54+/+Lig4+/+p53−/− (Rad54+/+Lig4+/+). Human glioblastoma A172 cells were purchased from the American Type Culture Collection of Cell Cultures (Manassas, VA). Cells were cultured in DMEM-10 (Dulbecco’s modified Eagle’s medium) containing 10% (v/v) fetal bovine serum, 20 mM 2-[4-(2-hydroxyethyl)-1-piperazinyl] ethanesulfonic acid, penicillin (50 units/ml), streptomycin (50 μg/ml), and kanamycin (50 μg/ml). Cells were cultured at 37°C in a conventional humidified CO₂ incubator.

2.2. Drugs and drug treatments

TMZ (LKT Laboratories Inc. St. Paul, MN) was dissolved at a stock concentration of 100 mM in dimethylsulfoxide (DMSO). TMZ stock solutions were stored at −80°C until used. Cells were treated with medium containing TMZ at various concentrations for 3 h and then rinsed twice with PBS.

2.3. Colony forming assays

Cell survival was measured using a standard clonogenic survival assay. Three flasks were used for each point, and three independent experiments were repeated for each point. Colonies obtained after 5–10 days were fixed with methanol and stained with a 2% Giemsa solution. Microscopic colonies composed of more than approximately 50 cells were counted as having arisen from single surviving cells.

2.4. Flow cytometry

After treatment, cells were fixed with cold 70% methanol and kept at 4°C for up to 1 week before analysis. Cells were centrifuged and rinsed with Tris-PBS (TPBS). The cells were blocked with bovine serum for 15 min at room temperature and rinsed with TPBS. Cells were then incubated with anti-phospho-H2AX (Ser 139) monoclonal antibody (JBW301; Millipore, Billerica, MA) at a 300-fold dilution for 60 min at room temperature, rinsed with TPBS, incubated with an AlexaFluor 488-conjugated anti-mouse IgG second antibody (Invitrogen, Carlsbad, CA) at a 400-fold dilution for 60 min at room temperature, and then rinsed in TPBS. Before flow cytometric analysis, the samples were filtered through a 35 mm nylon mesh. Samples were analyzed using a flow cytometer (Becton Dickinson, San Jose, CA).

2.5. siRNA transfection

The siRNA sequences used for human Lig4 and its unspecific negative control were GCUAGAUGGUGAACGUAUG [21] and TATTCGCGCGTATAGCGGTTT [22], respectively. The siRNA duplexes were synthesized by Japan Bio Services Co., Ltd. (Saitama, Japan) and provided as a purified and annealed duplex. Transfections were carried out using Lipofectamine RNAiMAX in accordance with the manufacturer’s instructions (Invitrogen). Briefly, cells were seeded at 1–5×10⁴ cells per 6 cm plate for 16–24 h without antibiotics. The siRNA was diluted in Opti-MEM I (Invitrogen) to produce a final siRNA concentration of 50 nM in a 1 ml final transfection volume. In a separate tube, 10 μl of Lipofectamine RNAiMAX was added to 490 μl of Opti-MEM I. The Lipofectamine RNAiMAX dilution was mixed with the diluted siRNA and incubated at room temperature for 15 min. The complex was then added drop-wise onto the cells. The cells were incubated for 48 h before further processing. These cells were then trypsinized for colony forming assays.

2.6. Statistical analysis

Data were compared statistically using the two-tailed Student’s t test.

3. Results

3.1. The role of repair genes in the presence of TMZ-induced DNA damage

In this study, in order to understand the relative contributions of the HR and NHEJ repair pathways, cellular responses to TMZ were examined using clonogenic survival assays after a 3 h exposure to TMZ. In these studies, XRCC2 defective cells (Fig. 1A), Rad54 and/or Lig4 defective cells (Fig. 1B) were used. The sensitivity of each cell line was assessed from its D₅₀ value, i.e. from the TMZ dose which reduced cell survival to 50% (Table 1). Each D₅₀ value was calculated from the cell survival data shown in Figs. 1A and B. XRCC2−/− cells, Rad54−/−Lig4−/− cells and Lig4−/− cells were more sensitive to TMZ than the corresponding proficient cells (Figs. 1A and B). However, the sensitivity of Rad54−/− cells to TMZ was comparable to that of proficient cells (Fig. 1B). In addition, Rad54−/−Lig4−/− cells were less sensitive to TMZ than Lig4−/− cells (Fig. 1B).

Fig. 1.

Contributions of HR and NHEJ DSB repair to cellular survival following TMZ treatment. A,XRCC2+/+ cells (open circles) and XRCC2−/− cells (closed circles). B, Lig4+/+Rad54+/+ cells (open circles), Rad54−/− cells (closed triangles), Lig4−/−Rad54−/− cells (closed squares), Lig4−/− cells (closed circles). Each point represents the mean of at least three independent experiments; bars indicate the SD. C, relative D₅₀ value (% compared to proficient cells).

Table 1.

The sensitivity of each cell line to TMZ was assessed by its D₅₀ values: i.e. the dose that reduces cell survival to 50%.

Genes	D50 (μM)*
	Proficient cells	Deficient cells
XRCC2	406	178
Rad54	284	234
Rad54 & Lig4	284	107
Lig4	284	38

^*Each D₅₀ value was calculated from results of the cell survival data shown in Figs. 1A and B.

In order to accurately compare TMZ sensitivities in the repair defective cell lines, the relative D₅₀ values were normalized using the D₅₀ value of the corresponding proficient cell lines. The relative D₅₀ values listed sequentially in the order in which they increase (reflecting decreasing sensitivities to TMZ) are: Lig4−/− cells < Rad54−/−Lig4−/− cells < XRCC2−/− cells < Rad54−/− cells (Fig. 1C). In summary, the relative D₅₀ value of the Lig4 defective cells was the smallest after treatment with TMZ reflecting their high sensitivity to TMZ.

3.2. Lig4 activity in repair of DSBs induced by TMZ

To determine whether DSBs are formed in response to TMZ, and how many DSBs are formed, the overall levels of phosphorylated H2AX (γH2AX) were measured with flow cytometry. Phosphorylated H2AX (γH2AX) is formed in response to the presence of DSBs [23–25] in Lig4−/− cells and in the corresponding proficient cells, and the levels of γH2AX are different at different times following treatment with TMZ. In proficient cells, γH2AX levels decreased to 25% of their initial levels at 24 h after TMZ treatment. However, in Lig4−/− cells, γH2AX levels were still present at up to 80% of their initial levels at 24 h after TMZ treatment. At 24 h after treatment with TMZ, there was a significant difference in γH2AX levels between these two cell lines (Fig. 2).

Fig. 2.

Phosphorylation of H2AX following treatment with medium containing 300 μM TMZ for 3 h in Lig4+/+ cells (open columns) or Lig4−/− cells (close columns) at the indicated time points. The relative inducible γH2AX levels at different time points were normalized against the γH2AX levels measured immediately after treatment. For each cell line, the value of the γH2AX levels measured immediately after treatment was set as 100. Columns show the means of at least three independent experiments; the bars indicate the SD. *, Difference is statistically significant (P < 0.05).

3.3. Effect of silencing Lig4 on cellular sensitivity to TMZ in A172 glioblastoma cells

To test whether this result was pertinent to chemotherapy used against glioblastoma, Lig4 expression was silenced in A172 glioblastoma cells using siRNA, and clonogenic survival assays were then performed on the silenced cells. Lig4 silencing caused a 20% reduction in colony formation when compared to cells transfected with negative control siRNA. In addition, after TMZ treatment, Lig4 silencing caused a 62.5% reduction in colony formation when compared to cells transfected with negative control siRNA. In A172 glioblastoma cells Lig4 silencing increased cellular sensitivity to TMZ approximately three times (Fig. 3).

Fig. 3.

Effect of siRNA silencing of Lig4 in glioblastoma A172 cells. Closed columns, Lig4 siRNA; open columns, negative control RNA. Columns show the means of at least three independent experiments; the bars indicate the SD. **, Difference is statistically significant (P < 0.01).

4. Discussion

The data in this paper provide the first evidence that NHEJ and specifically, the NHEJ protein, Lig4, play a prominent role in the repair of TMZ-mediated DNA damage. In agreement with this, human glioblastoma cells harboring a mutated DNA-PKcs also showed hypersensitivity towards TMZ when compared to the corresponding wild-type cells. In this case, the relative D₅₀ value was 19.5 as low as that observed in Lig4 defective cells (data not shown). Observations of the relative D₅₀ values also support this idea. The parental cells of the Rad54−/− and Lig4−/− cells had the same genetic background, and the relative D₅₀ values showed a significant difference: the relative D₅₀ value for Rad54−/− was 85.7, and that for Lig4−/− was 13.5 (Fig. 1C). In addition, HR and NHEJ double knockout cells which were Rad54−/−Lig4−/− were less sensitive to TMZ than single NHEJ knockout Lig4−/− cells (Figs. 1B and C). These results clearly eliminate the importance of HR in the repair of TMZ-induced DNA damage. These results are in agreement with previous studies which have revealed a hypersensitivity in NHEJ mutants to other DSB-causing agents, such as ionizing radiation, and etoposide (VP-16) [26,27].

In contrast, Roos et al. [19] reported HR defective cells, but not NHEJ defective cells, are hypersensitive to TMZ. This discrepancy might be explained by the fact that different cell lines were used in their study. p53 knockout MEFs defective in HR and/or NHEJ were used here, while Roos et al [19] used mutant type (mt) Chinese hamster cell lines with defects in these functions. As mentioned before, the parental cell genetic background was the same for the HR (Rad54) and NHEJ (Lig4) proficient cells. In their study, the parental cells had different genetic backgrounds for the HR and NHEJ proficient cells. Thus, an accurate comparison between HR and NHEJ might be difficult. Furthermore, in their clonogenic survival assays, the maximum concentration of TMZ used was 20 μM for the NHEJ mt cell lines, while 100 μM was used for the HR mt cell lines. If higher concentrations of TMZ had also been tested in NHEJ mt cell lines, it is possible that they might have shown a higher TMZ sensitivity.

Although the HR and NHEJ repair pathways can both act to remove DSBs induced by TMZ, the number of DSBs present in a cell or the initial binding of repair factors to the break sites may affect which system is used. Several reports suggest that poly (ADP ribose) polymerase-1 (PARP-1) might have a role in regulating the balance between HR and NHEJ activity by decreasing the affinity of Ku for DSBs [28,29], and thus favoring access for HR factors. Other work suggests that DNA polymerase μ interacts with NHEJ components, and that this may favor this repair pathway [30].

DNA repair pathways of TMZ-induced DNA damage are summarized in Fig. 4. TMZ–induced O⁶-methylG residues are repaired by MGMT [7]. Takagi et al. described the sensitivity of MGMT−/− cells to TMZ [31], and the relative D₅₀ value of MGMT deficient cells was found to be 33.3 here (data not shown). In newly diagnosed glioblastomas, MGMT sometimes shows low levels of activity! partly! because p53 mutations suppress MGMT expression [32–34] or MGMT promoter hypermethylation results in gene silencing of MGMT [35]. Therefore, if MGMT is targeted with O⁶-benzylG, improvements in therapeutic efficacy are considered to be limited. !If O⁶-meG is not repaired, replication over unrepaired O⁶-meG:C will result in an O⁶-meG:T mismatch (or possibly an O⁶-meG:C ambiguous pair) (Fig. 4) [36]. In the next round of replication this would result in an A:T transition mutation, and again to an O⁶-meG:C pair, or in an O⁶-meG:T mismatch [36]. The O⁶-meG:T or C pair is recognized by the MutSα complex (hMSH2 and hMSH6) which initiates mismatch repair (MMR) and this can create a gapped duplex after incision of the newly replicated strand (Fig. 4) [36]. Since O⁶-meG remains in the template, this process may be repeated in a “futile repair loop” which eventually results in highly toxic DSBs that are intermediates in DSB repair pathways (Fig. 4) [36]. The XRCC2 protein plays a role in HR via its interaction with Rad51 [37]. Therefore, it may be argued that XRCC2 must be required for the Rad51 mediated strand invasion step to occur during HR. Without strand invasion of the homologous DNA, tolerance of the replication blocking lesion cannot occur. The Rad54 protein interacts with Rad51 directly during the HR process after the induction of DNA damage in mammalian cells [38]. In the NHEJ pathway, after DSB formation, the Ku70/80 heterodimer binds to the damaged DNA ends. This facilitates the recruitment of the DNA-PKcs to the DSB. The sequential binding of these proteins activates the phosphorylation function of the DNA-PKcs which then phosphorylates itself, the Ku heterodimer, and other proteins involved in cell cycle regulation [39]. It has been suggested that Ku70/80 might also function as an alignment factor which binds DSB ends, and can thus provide ready access for, and greatly stimulate the functioning of the Lig4-XRCC4 complex. This can increase the efficiency and accuracy of NHEJ [40]. The Lig4-XRCC4 complex then rejoins the juxtaposed DNA ends. In conclusion, NHEJ, and in particular Lig4, play an important role in the repair of TMZ-mediated DNA damage. The degree of HR and NHEJ contributions towards the repair of TMZ-induced DNA damage are indicated by the width of the arrows in Fig. 4, and it is suggested that Lig4 could provide a new molecular target for TMZ chemotherapy.

Fig. 4.

DNA repair pathways active in the repair of TMZ-induced DNA damage.

The data presented here suggests that Lig4 can generate cellular resistance to TMZ exposure by repairing lesions which trigger the activation of DNA damage response cascades. H2AX, a histone protein, is rapidly phosphorylated at Ser139 when DNA breaks are introduced in mammalian cell DNA in response to damage and replication fork collapse [23–25]. Many of the early components in the DNA damage response pathway co-localize with γH2AX at sites of DNA breaks [41–44]. Therefore, the detection and quantitation of γH2AX is a useful tool to monitor the induction of DNA damage response signaling pathways. DSBs induced by TMZ are repaired in 24 h in Lig4 proficient cells. However, in Lig4−/− cells DSBs remained because they were not repaired (Fig. 2). Considering that the relative D₅₀ value in Lig4−/− cells was low (13.5) (Fig. 1C), this model appears to be reasonable.

In addition, it was found that the down regulation of Lig4 by siRNA increased the sensitivity of glioblastoma A172 cells to TMZ (Fig. 3). It was also confirmed that A172 cells exhibit very low levels of MGMT activity [45]. This suggests that Lig4 down regulation could potentially be a useful strategy for augmenting the therapeutic effects of TMZ in glioma treatments.

In TMZ chemotherapy, we focus on DSBs which might be induced by unrepaired O⁶-meG (Fig. 4), and it was demonstrated that the depression of DSB repair can enhance the sensitivity of glioma cells to TMZ (Figs. 2 and 3). In this study, it was found that Lig4 could provide a new molecular target for TMZ. In view of the work shown here, it is proposed that Lig4 contributes significantly towards the repair of TMZ-induced DSBs and that modulating Lig4 activity could enhance sensitivity to chemotherapeutic agents such as TMZ.