Skip to main content
Biomarker Insights logoLink to Biomarker Insights
. 2010 Feb 12;5:21–27. doi: 10.4137/bmi.s4094

Association of CYP1B1 Polymorphisms with Breast Cancer: A Case-Control Study in the Han Population in Ningxia Hui Autonomous Region, P. R. China

Haiyan Jiao 1,2, Chunlian Liu 3, Weidong Guo 4, Liang Peng 1,2, Yintao Chen 1,2, Francis L Martin 5
PMCID: PMC2832340  PMID: 20212917

Abstract

Studies investigating possible associations between cytochrome P4501B1 (CYP1B1) polymorphisms and breast cancer risk have been inconsistent. We set out to ascertain whether there might be an association between polymorphisms in exon 2 (codon 119, G→T) and exon 3 (codon 432, G→C) of CYP1B1 and breast cancer in a Chinese Han population in the rural region of Ningxia. Using an allele-specific polymerase chain reaction method and direct DNA sequencing, the presence or absence of the two CYP1B1 polymorphisms was investigated. Genotype and allele frequencies were analyzed in breast cancer cases (n = 152) and healthy age-matched controls (n = 156). The odds ratio (OR) of 119G→T or 432G→C in breast cancer cases and controls was 3.3 (95% CI: 1.28 to 8.28) and 2.8 (95% CI: 1.04 to 7.51), respectively. In addition, the OR for people with both polymorphisms (119T and 432C) was 4.69 (95% CI: 1.97 to 11.19). Our results suggest that certain polymorphisms in the CYP1B1 gene might increase risk for breast cancer among Han Chinese, perhaps because they influence the efficiency of CYP1B1 bio-transformation of oestrogens or pro-carcinogens into DNA-reactive electrophiles that may act as cancer-initiating agents.

Keywords: breast cancer, CYP1B1, Han population, Ningxia (China), phase I metabolism, polymorphism

Background

Breast cancer remains a major cause of morbidity and mortality worldwide with incidence rates ranging from 27/100,000 in Asian countries to 97/100,000 among US Causcasian women, but its aetiology remains unclear. Only a small proportion of cases (<10%) may be due to germline mutations in highly-penetrant susceptibility genes e.g. BRCA1/2.1 The majority of cases are sporadic and their causes are obscure, although cumulative hormonal exposure and environmental influences appear to be risk factors.2,3 Cytochrome P4501B1 (CYP1B1) catalyzes the formation of genotoxic 4-hydroxy oestradiol (4-OH E2), and bio-activates environmental pro-carcinogens [e.g. polycyclic aromatic hydrocarbons (PAHs), heterocyclic aromatic amines (HAAs)].47 The expression of CYP1B1 and the formation of 4-OH E2 have been associated with oestrogen-related tumours in multiple tissues and species.810 The 4-OHE2 catechol metabolite has the highest carcinogenic as well as oestrogenic activity and is found in higher quantities in breast cancer tissue than other 17β-oestradiol (E2) metabolites.11

CYP1B1 is genetically polymorphic, and sequence variations in the gene may be related to risk of breast cancer in some populations.1214 The human CYP1B1 gene, located at the 2p21–22 region, consists of three exons, one of which is noncoding, and two introns.15 Two common polymorphisms of CYP1B1 in exon 2 (codon 119, Ala→Ser) and exon 3 (codon 432, Val→Leu) encode the heme-binding domain; variant alleles probably exhibit altered activity.6 Therefore, genetic polymorphisms at loci encoding CYP1B1 may explain why individuals vary in their susceptibility to the carcinogenic effects of environmental chemicals.

Studies reporting the association between CYP1B1 polymorphisms and breast cancer have involved different populations but, have given rise to often inconsistent and/or contradicting findings even within the same ethnic groups.1214,1619 We undertook a case-control study of a genetically-uniform population of Han Chinese in the Ningxia Hui Autonomous Region of P. R. China in which genotype and allele frequency associations between CYP1B1 polymorphisms [in exon 2 (codon 119, G→T) and exon 3 (codon 432, G→C)] with breast cancer patients and healthy controls were determined. Our results point to an association between these two polymorphisms and breast cancer in this study population.

Material and Methods

Study participants

From May 2005 to June 2006, a total of 152 sporadic breast cancer patients and 156 healthy controls were recruited at Affiliated Hospital of Ningxia Medical University. All participants provided written informed consent before participating in the study. This research programme was approved by the local ethics approvals board at Ningxia Medical University.

The 152 breast cancer cases were verified by histopathology with a single pathologist. A cohort of 156 controls confirmed to be free of any cancer based on a health examination were randomly matched to the breast cancer arm of the study, with an age difference that was no greater than 5 years (y). The status for oestrogen receptor (ER) and progesterone receptor (PR) was also collected. The controls were not related in any way with the patients and they had no family history of breast cancer. All participants were long-term residents of Ningxia who had no prior history of cancer.

DNA isolation and analysis of single nucleotide polymorphisms (SNPs)

Blood samples (3–5 ml) were collected in Vacutainer tubes containing ethylenediaminetetraacetic acid (EDTA). Genomic DNA was extracted using standard phenol/chloroform methods. The sequences of primers for polymerase chain reaction (PCR) at each locus were synthesized by SBS-Biology (Beijing) and are listed in Table 1.

Table 1.

The primer sequences in codons 119 and 432 of CYP1B1.

Codon Allele Amino acid Primers Sequences
119 GCC Ala CYP1B1-119G-F GGCCTTCGCCGACCGGCCGG
TCC Ser CYP1B1-119T-F GGCCTTCGCCGACCGGCCGT
CYP1B1-119-R GAAGTTGCGCATCATGCTGT
432 CYP1B1-1294-F ATGCGCTTCTCCAGCTTTGT
CTG Leu CYP1B1-1294G-R TCCGGGTTAGGCCACTTCAC
GTG Val CYP1B1-1294C-R TCCGGGTTAGGCCACTTCAG

Abbreviations: F, forward primer; R, reverse primer.

Polymerase chain reaction (PCR) amplification

Genotyping assays for the two SNPs for CYP1B1 were conducted using allele-specific (AS) PCR methods in a Biometra T Gradient Thermocycler (Bio-Rad Laboratories). Each PCR mixture (25 μl) contained 10 ng DNA, 1 × PCR buffer with 1.5 mmol/L MgCl2, 0.16 mmol/L of each dNTP, 0.4 μmol/L of each primer, and 1 unit of Hotstart Taq DNA polymerase (SBS-Biology). The reaction mixture was initially denatured at 95 °C for 5 min, followed by 30 cycles at 94 °C for 30 sec, 60 °C for 30 sec, and 72 °C for 45 sec. The PCR was completed by a final extension cycle at 72 °C for 5 min. The DNA fragments were then separated and visualized by electrophoresis on 2% agarose gels containing ethidium bromide.

Statistical analysis

We determined whether CYP1B1 genotype frequencies were in Hardy-Weinberg equilibrium using standard χ2-statistics. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using SPSS (Version 11.5; Chicago, IL., USA). ORs were used to measure the strength of the association between CYP1B1 genotypes and breast cancer risk. The χ2 test was used to compare the distributions of CYP1B1 alleles and genotypes in cases and controls.

Results

The breast cancer patients had an age range between 28 y and 75 y, with a mean (M) and standard deviation (SD) of 52.27 (10.28) y. The control cohort had an age range between 30 y and 70 y, with a M (SD) of 52.69 (11.25) y. There was no significant difference in the age distribution between the patient and control arms of the study.

Representative samples for genotyping codons 119 and 432 of CYP1B1 are shown in Figures 1A and B, and typical sequencing results are shown in Figures 1C and D. In tests to determine the genotypes of codon 119 in CYP1B1, the appearance of only the “a” band was identified with GG based on DNA fragment size, the appearance of both “a” and “b” bands was identified with GT, and the appearance of only a “b” band was identified with TT (Fig. 1A). For genotypes of codon 432 of CYP1B1, the appearance of only the “a” band corresponded to GG based on DNA fragment size, the appearance of both “a” and “b” bands corresponded to GC, and the appearance of only the “b” band corresponded to CC (Fig. 1B). Reverse sequence analysis of DNA revealed a heterozygous G→T transition at nucleotide 335 of CYP1B1 (GenBank accession No. rs1056827), which results in a substitution of alanine (Ala) at codon 119 by a serine (Ser) (Fig. 1C). Direct sequence analysis of DNA also revealed a heterozygous G→C transition at nucleotide 1294 of CYP1B1 (GenBank accession No. rs1056836), which causes a substitution of the valine (Val) at codon 432 by a leucine (Leu) (Fig. 1D).

Figure 1.

Figure 1.

A, B) Representative samples for the genotyping for codons 119 and 432 of CYP1B1; C) Reverse sequence analysis to reveal a heterozygous G→T transition to result in substitution of Ala at codon 119; and, D) Direct sequence analysis to reveal a heterozygous G→C transition to result in substitution of Val at codon 432.

We compared the distribution frequencies of the two SNPs for CYP1B1 in breast cancer patients and the controls (Table 2). The frequencies of the G and T alleles on codon 119T/G of CYP1B1 differed significantly between the two cohorts (P = 0.000) with an OR of 2.20 (95% CI: 1.49 to 3.26). The frequencies of G and C alleles on codon 432C/G of CYP1B1 also showed significant differences between the two cohorts (P = 0.003), with an OR of 1.97 (95% CI: 1.25 to 3.11). The genotype frequencies at codons 119 and 432 for all subjects in this study are shown in Table 3. The distributions of the two polymorphisms were consistent with Hardy-Weinberg equilibrium (P > 0.05). There were significant differences in the GG, GT, and TT genotypes between the two cohorts (P = 0.001). The risk of breast cancer in individuals with genotypes of the homozygous TT mutation and heterozygous GT mutation was increased 3.26- and 2.32-fold, respectively, compared to the risk in individuals with the wild-type GG. There were significant differences in frequencies of the genotype GG, GC, CC between the two cohorts (P = 0.038) (Table 3). The risk of breast cancer in individuals with the homozygous CC mutation and the heterozygous GC mutation was increased 2.79- and 1.69-fold, respectively, compared to the risk in individuals with the wild-type GG.

Table 2.

Association of codons 119 and 432 of CYP1B1 allele with breast cancer risk (Han population, Ningxia).

Gene Allele No. of case (%) (n = 152) No. of control (%) (n = 156) χ2P value OR (95% CI)
A119S G 217 (71.0) 263 (84.0) 15.5
T 87 (29.0) 49 (16.0) 0.000 2.20 (1.49 to 3.26)
V432L G 245 (80.6) 278 (89.1) 8.78
C 59 (19.4) 34 (10.9) 0.003 1.97 (1.25 to 3.11)

Table 3.

Association of codons 119 and 432 of CYP1B1 genotype with breast cancer risk (Han population, Ningxia).

Gene Genotype No. of case (%) (n = 152) No. of control (%) (n = 156) χ2P value OR (95% CI)
A119S G/G 80 (52.6) 114 (73.1)
G/T 57 (37.5) 35 (22.4) 14.71 2.32 (1.40 to 3.86)
T/T 15 (9.9) 7 (4.5) 0.001 3.26 (1.28 to 8.28)
V432L G/G 107 (70.4) 128 (82.1)
G/C 31 (20.4) 22 (14.1) 6.55 1.69 (0.92 to 3.08)
C/C 14 (9.2) 6 (3.8) 0.038 2.79 (1.04 to 7.51)

We analyzed the effect of the combined 119/432 genotypes on breast cancer risk in the Ningxia Han population (Table 4). In our study, we observed individuals with the genotype of 119G/G-432C/G, 119T/T-432C/G, 119G/T-432C/C, or 119G/T-432G/G. Therefore it would seem that CYP1B1 codons 119 and 432 are not in linkage disequilibrium. The OR for individuals possessing both 119T and 432C was nearly five times the OR for those possessing 119G/G-432G/G. No associations were found between these two variations and with ER or PR status.20

Table 4.

Association between combined CYP1B1 119–432 genotypes and breast cancer (Han population, Ningxia).

Combined genotype No. of case (%) (n = 152) No. of control (%) (n = 156) OR (95%) P value
G/G-G/G 57 (37.5) 93 (59.6)
G/G-C/G 19 (12.5) 16 (10.3) 1.94 (0.92 to 4.07) 0.078
G/T-G/G 41 (27.0) 27 (17.3) 2.48 (1.38 to 4.46) 0.002
G/T-C/G 11 (7.2) 5 (3.2) 3.59 (1.19 to 10.86) 0.017
Any T-G/G 52 (34.2) 32 (20.5) 2.65 (1.53 to 4.60) 0.000
Any T-C/G 15 (9.9) 6 (3.8) 4.08 (1.50 to 11.12) 0.004
G/G-any C 25 (16.5) 20 (12.8) 2.04 (1.04 to 4.00) 0.036
G/T-any C 16 (10.5) 7 (4.5) 3.73 (1.45 to 9.62) 0.004
Any T-any C 23 (15.1) 8 (5.1) 4.69 (1.97 to 11.19) 0.000

Discussion

Individual susceptibility to cancer is likely to be influenced by the genotype for enzymes involved in the activation or detoxification of carcinogens. Polymorphic alleles of key candidate genes such as CYP1B1, which are involved in oestrogen and xenobiotic metabolism, may contribute to the different risks of breast cancer observed for different populations.1214,1619 In the present study, we investigated CYP1B1 polymorphisms in a Ningxia Han Chinese population, and observed that the genotypes 119T/T and G/T are present at a significantly higher frequency (P = 0.001) in breast cancer patients than in control participants. A difference between breast cancer patients and healthy participants was also found in the allelic distributions of codon 432. The combination of the two polymorphisms of CYP1B1 investigated [in exon 2 (codon 119, G→T) and exon 3 (codon 432, G→C)] further increases the risk of breast cancer in this Ningxia Han (China) ethnic group.

Previous studies on the association between CYP1B1 codon 119(G→T) and codon 432(G→C) and breast cancer in different populations have often given rise to conflicting or contradicting results. Our results on CYP1B1 codon 119(G→T) confirm those of a study in a Japanese population.21 Nevertheless, we measured higher frequencies of the CYP1B1 codon 119(G→T) “T” allele among controls (0.16) and cases (0.29) in the Ningxia Han than were reported among controls (0.12) and cases (0.16) in the Japanese study.21 Therefore, CYP1B1 codon 119(G→T), which is thought to participate in the substrate recognition site 1 of CYP1B1 protein, is significantly associated with breast cancer in both the Ningxia Han (China) population and the Japanese. This contradicts the protective effect reported for this polymorphism in studies carried out among Chinese women in Shanghai, Caucasian and African in U.S. (Nashville, Tennessee) and Polish women.2224

The valine substitution is reported to be present at an allele frequency of 0.43 in Caucasians, 0.75 in African-Americans and 0.23 in Asians.12,25 No association between the CYP1B1 Val432Leu polymorphism and breast cancer was observed in Asians (for Val/Val and Val/Leu combined, OR = 1.0, 95% CI: 0.8, 1.2). An inverse association was observed in a population of mixed/African origin (OR = 0.8, 95% CI: 0.7, 0.9). The pooled analysis suggested a possible association in Caucasians (for Val/Val and Val/Leu combined, OR = 1.5, 95% CI: 1.1, 2.1), with effect modification across age categories.26 Our finding of an association between CYP1B1 codon 432 (G→C) and breast cancer is consistent with the results of several studies in Caucasians.24,26 In our study, the risk of breast cancer in individuals with the homozygous CC mutation or the heterozygous GC mutation was increased 2.79 (95% CI: 1.04 to 7.51)- and 1.69 (95% CI: 0.92 to 3.08)-fold, respectively, compared to that of individuals with wild-type GG. In one study of Caucasians, Listgarten et al26 found that the homozygous Leu/Leu mutation conferred a 3.30-fold higher risk of breast cancer (95% CI: 1.76 to 6.19), while the heterozygous Val/Leu genotype was associated with a 2.15-fold higher risk (95% CI: 1.31–3.52). In a study of a Shanghai population, Zheng et al18 found that women with the Leu/Leu genotype had a 2.3-fold [95% CI, 1.2–4.5] higher risk of breast cancer. Our study in the Ningxia Han population confirms these results, although we measured lower frequencies of the CYP1B1 codon 432(G→C) “C” allele among controls (0.11) and cases (0.19) compared to those reported among controls (0.46) and cases (0.53) in the Shanghai Han population, respectively. Some studies in Caucasian populations and Asian populations19,20,22,27,28 have found no significant association between the CYP1B1 Val/Leu genotype and breast cancer risk. However, others have found a significant increase in the breast cancer risk for smoking women in a Finnish population (OR = 2.6, 95% CI 1.07–6.46), especially for smokers homozygous for the Leu allele (OR = 5.1, 95% CI 1.30–19.89, P for trend = 0.005).13

Conclusion

Certain genotypes may contribute to variation in risk for breast cancer observed in different populations or ethnic groups. To evaluate this in a rural Ningxia Han population of P. R. China, we analysed the association between CYP1B1 codon 119 (Ala→Ser) and codon 432 (Val→Leu) and risk of breast cancer. Our results show that the risk of breast cancer increases significantly (OR = 4.69, 95% CI 1.97–11.9) proportional to the number of variant alleles individuals possess. Han women living in the Ningxia province are relatively homogeneous in ethnic background, therefore eliminating some confounding effects. On the other hand, our study investigates a relatively small sample size in a case-control setting, which may make our risk estimates unstable. Nevertheless, our results are consistent with recent findings from in vitro and animal experiments implicating a potentially important role of CYP1B1 in the aetiology of human breast cancer.28,29

Other factors such as the expressed profile of ER splice variants may play a hitherto under-recognised role in the modulation of breast cancer risk.30 However, we conclude that the functional polymorphism of CYP1B1 may be a risk factor for breast cancer in the Ningxia Han population of China, and in at least some other populations. Further investigations involving larger sample sizes and other ethnic populations are needed in order to establish more completely the relationship between these CYP1B1 SNPs and breast cancer risk.

Abbreviations

Ala

alanine;

AS-PCR

allele-specific polymerase chain reaction;

CI

confidence interval;

CYP1B1

cytochrome P4501B1;

E2

17β-oestradiol;

EDTA

ethylenediaminetetraacetic acid;

ER

oestrogen receptor;

HAA

heterocyclic aromatic amine;

4-OH E2

4-hydroxy oestradiol;

Leu

leucine;

M

mean;

OR

odds ratio;

PAH

polycyclic aromatic hydrocarbon;

PCR

polymerase chain reaction;

PR

progesterone receptor;

Ser

serine;

SD

standard deviation;

SNP

single nucleotide polymorphism;

Val

valine;

y

years.

Footnotes

Financial Support

This research was supported by grants from the National Natural Science Foundation of Ningxia, China (Grant no. NZ0535) and from Ningxia Medical University (Grant no. YY200750).

Competing Interests

The authors declare that they have no competing interests.

References

  • 1.Martin FL. Genotoxins and the initiation of sporadic breast cancer. Mutagenesis. 2001;16:155–61. doi: 10.1093/mutage/16.2.155. [DOI] [PubMed] [Google Scholar]
  • 2.Yared E, McMillan TJ, Martin FL. Genotoxic effects of oestrogens in breast cells detected by the micronucleus assay and the Comet assay. Mutagenesis. 2002;17:345–52. doi: 10.1093/mutage/17.4.345. [DOI] [PubMed] [Google Scholar]
  • 3.Martin FL, Carmichael PL, Crofton-Sleigh C, et al. Genotoxicity of human mammary lipid. Cancer Res. 1996;56:5342–6. [PubMed] [Google Scholar]
  • 4.Carnell DM, Smith RE, Daley FM, et al. Target validation of cytochrome P450 CYP1B1 in prostate carcinoma with protein expression in associated hyperplastic and premalignant tissue. Int J Radiat Oncol Biol Phys. 2004;58:500–9. doi: 10.1016/j.ijrobp.2003.09.064. [DOI] [PubMed] [Google Scholar]
  • 5.McFadyen MCE, Melvin WT, Murray GI. Cytochrome P450 enzymes: Novel options for cancer therapeutics. Mol Cancer Ther. 2004;3:363–71. [PubMed] [Google Scholar]
  • 6.Ragavan N, Hewitt R, Cooper LJ, et al. CYP1B1 expression in prostate is higher in the peripheral than in the transition zone. Cancer Lett. 2004;215:69–78. doi: 10.1016/j.canlet.2004.06.051. [DOI] [PubMed] [Google Scholar]
  • 7.John K, Ragavan N, Pratt MM, et al. Quantification of phase I/II metabolizing enzyme gene expression and polycyclic aromatic hydrocarbon-DNA adduct levels in human prostate. Prostate. 2009;69:505–19. doi: 10.1002/pros.20898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.McKay JA, Melvin WT, Ah-See AK, et al. Expression of cytochrome P450 CYP1B1 in breast cancer. FEBS Lett. 1995;374:270–2. doi: 10.1016/0014-5793(95)01126-y. [DOI] [PubMed] [Google Scholar]
  • 9.McFadyen MC, Breeman S, Payne S, et al. Immunohistochemical localization of cytochrome P450 CYP1B1 in breast cancer with monoclonal antibodies specific for CYP1B1. J Histochem Cytochem. 1999;47:1457–64. doi: 10.1177/002215549904701111. [DOI] [PubMed] [Google Scholar]
  • 10.Singh PB, Matanhelia SS, Martin FL. A potential paradox in prostate adenocarcinoma progression: oestrogen as the initiating driver. Eur J Cancer. 2008;44:928–36. doi: 10.1016/j.ejca.2008.02.051. [DOI] [PubMed] [Google Scholar]
  • 11.Hayes CL, Spink DC, Spink BC, et al. 17β-Estradiol hydroxylation catalyzed by human cytochrome P450 1B1. Proc Natl Acad Sci U S A. 1996;93:9776–81. doi: 10.1073/pnas.93.18.9776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Miyoshi Y, Noguchi S. Polymorphisms of estrogen synthesizing and metabolizing genes and breast cancer risk in Japanese women. Biomed Pharmacother. 2003;57:471–81. doi: 10.1016/j.biopha.2003.09.008. [DOI] [PubMed] [Google Scholar]
  • 13.Sillanpää P, Heikinheimo L, Kataja V, et al. CYP1A1 and CYP1B1 genetic polymorphisms, smoking and breast cancer risk in a Finnish Caucasian population. Breast Cancer Res Treat. 2007;104:287–97. doi: 10.1007/s10549-006-9414-6. [DOI] [PubMed] [Google Scholar]
  • 14.Nock NL, Tang D, Rundle A, et al. Associations between smoking, polymorphisms in polycyclic aromatic hydrocarbon (PAH) metabolism and conjugation genes and PAH-DNA adducts in prostate tumors differ by race. Cancer Epidemiol Biomarkers Prev. 2007;16:1236–45. doi: 10.1158/1055-9965.EPI-06-0736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bejjani BA, Lewis RA, Tomey KF, et al. Mutations in CYP1B1, the gene for cytochrome P4501B1, are the predominant cause of primary congenital glaucoma in Saudi Arabia. Am J Hum Genet. 1998;62:325–33. doi: 10.1086/301725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lee KM, Abel J, Ko Y, et al. Genetic polymorphisms of cytochrome P450 19 and 1B1, alcohol use, and breast cancer risk in Korean women. Br J Cancer. 2003;88:675–8. doi: 10.1038/sj.bjc.6600761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Saintot M, Malaveille C, Hautefeuille A, et al. Interactions between genetic polymorphism of cytochrome P450-1B1, sulfotransferase 1A1, catechol-O-methyltransferase and tobacco exposure in breast cancer risk. Int J Cancer. 2003;107:652–7. doi: 10.1002/ijc.11432. [DOI] [PubMed] [Google Scholar]
  • 18.Zheng W, Xie DW, Jin F, et al. Genetic polymorphism of cytochrome P450-1B1 and risk of breast cancer. Cancer Epidemiol Biomarkers Prev. 2000;9:147–50. [PubMed] [Google Scholar]
  • 19.Thyagarajan B, Brott M, Mink P, et al. CYP1B1 and CYP19 gene polymorphisms and breast cancer incidence: no association in the ARIC study. Cancer Lett. 2004;207:183–9. doi: 10.1016/j.canlet.2003.12.009. [DOI] [PubMed] [Google Scholar]
  • 20.Liu C, Gu J, Peng L, et al. Research on Breast Cancer Genetic Susceptibility Associated with CYP1B1 SNPrs1056836, ER and PR in Ningxia Han Population. Bull Chinese Cancer. 2009;18:31–3. [Google Scholar]
  • 21.Watanabe J, Shimada T, Gillam EM, et al. Association of CYP1B1 genetic polymorphism with incidence to breast and lung cancer. Pharmacogenetics. 2000;10:25–33. doi: 10.1097/00008571-200002000-00004. [DOI] [PubMed] [Google Scholar]
  • 22.Wen W, Cai Q, Shu XO, et al. Cytochrome P450 1B1 and catechol-O-methyltransferase genetic polymorphisms and breast cancer risk in Chinese women: results from the shanghai breast cancer study and a meta-analysis. Cancer Epidemiol Biomarkers Prev. 2005;14:329–35. doi: 10.1158/1055-9965.EPI-04-0392. [DOI] [PubMed] [Google Scholar]
  • 23.Bailey LR, Roodi N, Dupont WD, et al. Association of cytochrome P450 1B1 (CYP1B1) polymorphism with steroid receptor status in breast cancer. Cancer Res. 1998;58:5038–41. [PubMed] [Google Scholar]
  • 24.Gaudet MM, Chanock S, Lissowska J, et al. Genetic variation of cytochrome P450 1B1 (CYP1B1) and risk of breast cancer among Polish women. Pharmacogenet Genomics. 2006;16:547–53. doi: 10.1097/01.fpc.0000215067.29342.6f. [DOI] [PubMed] [Google Scholar]
  • 25.Tang YM, Green BL, Chen GF, et al. Human CYP1B1 Leu432Val gene polymorphism: ethnic distribution in African-Americans, Caucasians and Chinese; oestradiol hydroxylase activity; and distribution in prostate cancer cases and controls. Pharmacogenetics. 2000;10:761–6. doi: 10.1097/00008571-200012000-00001. [DOI] [PubMed] [Google Scholar]
  • 26.Listgarten J, Damaraju S, Poulin B, et al. Predictive models for breast cancer susceptibility from multiple single nucleotide polymorphisms. Clin Cancer Res. 2004;10:2725–37. doi: 10.1158/1078-0432.ccr-1115-03. [DOI] [PubMed] [Google Scholar]
  • 27.Paracchini V, Raimondi S, Gram IT, et al. Meta- and pooled analyses of the cytochrome P-450 1B1 Val432Leu polymorphism and breast cancer: a HuGE-GSEC review. Am J Epidemiol. 2007;165:115–25. doi: 10.1093/aje/kwj365. [DOI] [PubMed] [Google Scholar]
  • 28.De Vivo I, Hankinson SE, Li L, et al. Association of CYP1B1 polymorphisms and breast cancer risk. Cancer Epidemiol Biomarkers Prev. 2002;11:489–92. [PubMed] [Google Scholar]
  • 29.Singh PB, Ragavan N, Ashton KM, et al. Quantified gene expression levels for phase I/II metabolizing enzyme and estrogen receptor levels in benign prostate from cohorts designated as high-risk (UK) versus low-risk (India) for adenocarcinoma at this organ site: a preliminary study. Asian J Androl. 2010;12:203–14. doi: 10.1038/aja.2009.71. doi: 101038/aja.2009.71 [Online 23 November 2009]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Taylor SE, Martin-Hirsch PL, Martin FL. Oestrogen receptor splice variants in the pathogenesis of disease. Cancer Lett. 2010;288:133–48. doi: 10.1016/j.canlet.2009.06.017. doi: 10.1016/j.canlet.2009.06.017 [Online 15 July 2009]. [DOI] [PubMed] [Google Scholar]

Articles from Biomarker Insights are provided here courtesy of SAGE Publications

RESOURCES