Abstract
TcpC, a new Toll/interleukin-1 receptor domain-containing protein of uropathogenic Escherichia coli involved in the suppression of innate immunity, was found in 2008. The aim of the present study was to determine the prevalence of tcpC and its association with virulence factors and phylogenetic groups among strains from a collection of 212 E. coli isolates from urinary tract and skin and soft tissue infections and 90 commensal E. coli strains.
Pathogenic microbes avoid host defenses using a wide array of virulence factors. Escherichia coli strains, even though they are common bacteria of the gut microbiota, can be important pathogens due to the possession of virulence factors (5). Recently, Cirl et al. (1) reported that they found TcpC, a new Toll/interleukin-1 receptor (TIR) domain-containing protein of uropathogenic E. coli that inhibits Toll-like receptor (TLR) and MyD88-specific signaling, thus impairing the innate immune response. They further reported that tcpC homologous sequences were present in about 40% of E. coli isolates from individuals with pyelonephritis, 21% of isolates from individuals with cystitis, 16% of isolates from individuals with asymptomatic bacteriuria, and only 8% of commensal isolates. Their results suggested that TcpC increases the severity of urinary tract infections (UTIs) in humans and provided the first unambiguous evidence that bacterial pathogens interfere with TLR signaling to survive and spread in the human host.
The aim of our study was to determine the prevalence of tcpC among 212 extraintestinal E. coli isolates: 100 E. coli isolates from individuals with symptomatic UTIs, 10 E. coli isolates from individuals with asymptomatic UTIs, 102 E. coli isolates from isolates from individuals with skin and soft tissue infections (SSTIs), and 90 E. coli commensal isolates. In addition, we investigated the association of tcpC with the phylogenetic group (groups A, B1, B2, and D; E. coli strains causing extraintestinal infections are known to mainly belong to group B2 and, to a lesser extent, group D, while commensal E. coli strains belong to groups A and B1), as well as with other well-known virulence factors of extraintestinal pathogenic E. coli (ExPEC) strains (cytotoxic necrotizing factor 1 [cnf1], hemolysin [hlyA], P-fimbrial adhesins [papGIII and papGII], S fimbriae [sfaDE], Afa/Dr adhesins [afa/draBC], aerobactin [iucD], and uropathogenic strain-specific protein [usp]). To our knowledge, this is the first investigation of the prevalence of tcpC among E. coli strains causing SSTIs and of the association of tcpC with phylogenetic group as well as virulence factor genes among UTI, SSTI, and commensal E. coli isolates.
The extraintestinal E. coli isolates examined in this study were from our previous studies of UTIs (10, 12-14) and SSTIs (9), while the 90 E. coli commensal isolates were isolated for the purposes of this study. The commensal E. coli isolates were isolated as lactose-positive colonies on MacConkey agar plates from the feces of healthy individuals. Indole, methyl red, Voges-Proskauer, and citrate tests were performed to ascertain that the species detected were E. coli. The strains investigated were cultivated in Luria-Bertani medium or agar. Cell lysates of all 302 E. coli isolates were prepared (7) and used in the PCRs. Amplifications were performed in an automated thermal cycler (UNOII; Biometra, Göttingen, Germany) in a 25-μl reaction mixture containing template DNA (5 μl of boiled lysate), 10 pmol of forward and reverse primers (Table 1), 0.2 mM deoxynucleoside triphosphate mixture, 0.625 U Taq DNA polymerase, and 2.5 mM MgCl2 in 1× PCR buffer (Fermentas, Vilnius, Lithuania). The amplification schemes were based on previous amplification protocols (Table 1). For amplification of the tcpC sequence, the following amplification scheme was employed: 1 cycle of denaturation at 94°C for 4.5 min, followed by 25 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and elongation at 72°C for 1 min. The amplification was concluded with an extension program of one cycle at 72°C for 5 min. Fisher's exact test (two-tailed; http://www.langsrud.com/fisher.htm) and the Bonferroni correction were used to analyze the data. The threshold for statistical significance after the Bonferroni correction was set at a P value of <0.05. The PCR revealed that 49 (23%) of the pathogenic strains studied harbored the tcpC sequence: 23 (21%) of our UTI E. coli isolates (21 isolates [21%] from individuals with symptomatic UTIs and 2 isolates [20%] from individuals with asymptomatic UTIs) and 26 (25%) of our SSTI E. coli isolates. The prevalence of tcpC was much lower among commensal E. coli isolates, only 7 (8%), as was found in a recent study by Cirl et al. (1). Comparison of the prevalence of tcpC among the UTI isolates of the two studies was not possible, as we could not obtain data on the type of symptomatic UTI (cystitis, pyelonephritis), and furthermore, the number of asymptomatic UTI isolates was too small (n = 10) to be statistically relevant. As seen from Table 2, strong statistical correlations were found between the presence of tcpC and the B2 phylogenetic group, as well as between the presence of tcpC and the presence of cnf1, hlyA, papGIII, sfaDE, and usp among UTI isolates, as well as commensal strains. Among the SSTI isolates, statistically significant associations were found only between the presence of tcpC and the presence of cnf1, hlyA, and usp. As ExPEC strains mainly belong to the B2 phylogenetic group, these correlations and the higher virulence scores of the tcpC-encoding strains are not surprising. Interestingly, when the UTI and SSTI isolates were compared, major differences were observed. While the prevalence rates of tcpC sequences were similar in both groups, 21% among UTI isolates and 25% among SSTI isolates, suggesting an important role of TcpC in UTIs as well as in SSTIs, P values establishing significant correlations were higher among UTI isolates than among SSTI isolates. The differences between the UTI and SSTI E. coli strains observed are most likely due to differences in pathogenic mechanisms; nevertheless, the possession of TcpC seems to be an important factor in establishing UTIs and SSTIs. As the bowel flora is a reservoir of ExPEC, it is not surprising that tcpC was also found to be significantly associated with the B2 phylogenetic group among commensal strains. Our results suggest that even though E. coli strains able to induce disease outside the gastrointestinal tract are collectively designated ExPEC (11), it could be worthwhile to consider strains from different sites or syndrome-specific pathotypes separately.
TABLE 1.
Sequences of primers used in this study
| Functional category | Primer | Primer sequence (5′ to 3′) | Reference |
|---|---|---|---|
| Phylogenetic group | ChuA.1 | GACGAACCAACGGTCAGGAT | 2 |
| ChuA.2 | TGCCGCCAGTACCAAAGACA | ||
| YjaA.1 | TGAAGTGTCAGGAGACGCTG | ||
| YjaA.2 | ATGGAGAATGCGTTCCTCAAC | ||
| TspE4C2.1 | GAGTAATGTCGGGGCATTCA | ||
| Toxins | TspE4C2.2 | CGCGCCAACAAAGTATTACG | |
| Cytotoxic necrotizing factor (cnf1) | CNF1-1 | CTGACTTGCCGTGGTTTAGTCGG | 6 |
| CNF1-2 | TACACTATTGACATGCTGCCCGGA | ||
| Hemolysin A (hlyA) | hlyA.1 | AACAAGGATAAGCACTGTTCTGGCT | |
| hlyA.2 | ACCATATAAGCGGTCATTCCCGTCA | ||
| Fimbriae and/or adhesins | |||
| P-fimbrial adhesin II (papGII) | papG_II f | GGGATGAGCGGGCCTTTGAT | 4 |
| papG_II r | CGGGCCCCCAAGTAACTCG | ||
| P-fimbrial adhesin III (papGIII) | papG_III f | CCACCAAATGACCATGCCAGAC | 15 |
| papG_III r | GGCCTGCAATGGATTTACCTGG | ||
| S fimbriae (sfaDE) | SFA-1 | CTCCGGAGAACTGGGTGCATCTTAC | 7 |
| CGGAGGAGTAATTACAAACCTGGCA | |||
| Afa/Dr adhesins (afa/draBC) | afa/draBC-f | GGCAGAGGGCCGGCAACAGGC | 3 |
| afa/draBC-r | CCCGTAACGCGCCAGCATCTC | ||
| Iron uptake | |||
| Aerobactin synthesis (iucD) | Aer1 | TACCGGATTGTCATATGCAGACCGT | 15 |
| Aer2 | AATATCTTCCTCCAGTCCGGAGAAG | ||
| Other | |||
| Uropathogenic strain-specific protein (usp) | N6 | ATGCTACTGTTTCCGGGTAGTGTGT | 8 |
| N7 | CATCATGTAGTCGGGGCGTAACAAT | ||
| TIR domain-containing protein (tcpC) | tcpC for | GGCAACAATATGTATAATATCCT | |
| tcpC rev | GCCCAGTCTATTTCTGCTAAAGA | 1 |
TABLE 2.
Distribution of phylogenetic groups and virulence factors in relation to the presence of tcpC
| Phylogenetic group or virulence factor | Prevalence (no. [%] of strains)a |
|||||||
|---|---|---|---|---|---|---|---|---|
| UTI + SSTI isolates |
UTI isolates |
SSTI isolates |
Commensal isolates |
|||||
| tcpC positive (49 [23]) | tcpC negative (163 [77]) | tcpC positive (23 [21]) | tcpC negative (87 [79]) | tcpC positive (26 [25]) | tcpC negative (76 [75]) | tcpC positive (7[8]) | tcpC negative (83 [92]) | |
| Phylogenetic group | ||||||||
| A | 5 (10) | 35 (21) | 0 (0) | 28 (32)** | 5 (19) | 7 (9) | 0 (0) | 20 (24) |
| B1 | 3 (6) | 13 (8) | 0 (0) | 6 (7) | 3 (12) | 7 (9) | 0 (0) | 13 (16) |
| B2 | 40 (82) | 81 (50)*** | 23 (100) | 32 (37)*** | 17 (65) | 49 (64) | 7 (100) | 23 (28)** |
| D | 1 (2) | 34 (21)** | 0 (0) | 21 (24)* | 1 (4) | 13 (17) | 0 (0) | 27 (33) |
| Virulence factor | ||||||||
| cnf1 | 33 (67) | 25 (15)*** | 16 (70) | 9 (10)*** | 17 (65) | 16 (21)** | 4 (57) | 1 (1)** |
| hlyA | 33 (67) | 26 (16)*** | 18 (78) | 10 (11)*** | 15 (58) | 16 (21)* | 5 (71) | 2 (2)*** |
| papGIII | 19 (39) | 10 (6)*** | 11 (48) | 3 (3)*** | 8 (31) | 7 (9) | 3 (43) | 0 (0)** |
| papGII | 13 (27) | 34 (21) | 11 (48) | 26 (30) | 2 (8) | 8 (11) | 0 (0) | 7 (8) |
| sfaDE | 33 (67) | 30 (18)*** | 19 (83) | 7 (8)*** | 14 (54) | 23 (30) | 7 (100) | 8 (10)*** |
| afa/draBC | 0 (0) | 3 (2) | 0 (0) | 2 (2) | 0 (0) | 1 (1) | 0 (0) | 4 (5) |
| iucD | 24 (49) | 70 (43) | 13 (57) | 33 (38) | 11 (42) | 37 (49) | 2 (29) | 33 (40) |
| usp | 44 (90) | 49 (30)*** | 22 (96) | 26 (30)*** | 22 22 (85) | 23 (30)* | 6 (86) | 1 (1)*** |
| Average virulence score | 4.06 | 1.52 | 4.78, 1.33 | 3.19, 1.72 | 3.86, 0.67 | |||
The P values obtained following Bonferroni correction are indicated by asterisks when P is <0.05, as follows: *, P < 0.05; **, P < 0.005; ***, P < 0.0005.
Acknowledgments
This research was financed by grant P1-0198 from the Slovenian Research Agency (ARRS). Živa Petkovšek is a recipient of a Ph.D. grant from ARRS.
Footnotes
Published ahead of print on 30 December 2009.
REFERENCES
- 1.Cirl, C., A. Wieser, M. Yadav, S. Duerr, S. Schubert, H. Fischer, D. Stappert, N. Wantia, N. Rodriguez, H. Wagner, C. Svanborg, and T. Miethke. 2008. Subversion of Toll-like receptor signaling by a unique family of bacterial Toll/interleukin-1 receptor domain-containing proteins. Nat. Med. 14:399-406. [DOI] [PubMed] [Google Scholar]
- 2.Clermont, O., S. Bonacorsi, and E. Bingen. 2000. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 66:4555-4558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Johnson, J., and A. Stell. 2000. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J. Infect. Dis. 181:261-272. [DOI] [PubMed] [Google Scholar]
- 4.Johnson, J., and J. Brown. 1996. A novel multiply primed polymerase chain reaction assay for identification of variant papG genes encoding the Gal(alpha 1-4)Gal-binding PapG adhesins of Escherichia coli. J. Infect. Dis. 173:920-926. [DOI] [PubMed] [Google Scholar]
- 5.Kaper, J. B., J. P. Nataro, and H. L. T. Mobley. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123-140. [DOI] [PubMed] [Google Scholar]
- 6.Kuhar, I., M. Grabnar, and D. Zgur-Bertok. 1998. Virulence determinants of uropathogenic Escherichia coli in fecal strains from intestinal infections and healthy individuals. FEMS Microbiol. Lett. 164:243-248. [DOI] [PubMed] [Google Scholar]
- 7.Le Bouguenec, C., M. Archambaud, and A. Labigne. 1992. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J. Clin. Microbiol. 30:1189-1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Nakano, M., S. Yamamoto, A. Terai, O. Ogawa, S. Makino, H. Hayashi, G. Nair, and H. Kurazono. 2001. Structural and sequence diversity of the pathogenicity island of uropathogenic Escherichia coli which encodes the USP protein. FEMS Microbiol. Lett. 205:71-76. [DOI] [PubMed] [Google Scholar]
- 9.Petkovšek, Ž., K. Eleršič, M. Gubina, D. Žgur-Bertok, and M. Starčič Erjavec. 2009. Virulence potential of Escherichia coli isolates from skin and soft tissue infections (SSTI). J. Clin. Microbiol. 47:1811-1817. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Rijavec, M., M. Starčič Erjavec, J. Ambrožič, R. Reissbrodt, A. Fruth, V. Križan-Hergouth, and D. Žgur-Bertok. 2006. High prevalence of multidrug resistance and random distribution of mobile genetic elements among uropathogenic Escherichia coli (UPEC) of the four major phylogenetic groups. Curr. Microbiol. 53:158-162. [DOI] [PubMed] [Google Scholar]
- 11.Russo, T. A., and J. R. Johnson. 2000. Proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli: ExPEC. J. Infect. Dis. 181:1753-1754. [DOI] [PubMed] [Google Scholar]
- 12.Starčič Erjavec, M., M. Rijavec, V. Križan-Hergouth, A. Fruth, and D. Žgur-Bertok. 2007. Chloramphenicol and tetracycline resistant uropathogenic Escherichia coli (UPEC) exhibit reduced virulence potential. Int. J. Antimicrob. Agents 30:436-442. [DOI] [PubMed] [Google Scholar]
- 13.Starčič Erjavec, M., V. Križan-Hergouth, B. Gubina, and D. Žgur-Bertok. 2008. Prevalence of toxin encoding genes in Escherichia coli isolates from urinary tract infections in Slovenia. Zdrav. Vestn. 77:427-432. [Google Scholar]
- 14.Starčič Erjavec, M., and D. Žgur-Bertok. 2008. Prevalence, distribution and genetic association of adhesin gene sequences of Escherichia coli isolates from urinary tract infections in Slovenia. Acta Biol. Slov. 51:21-31. [Google Scholar]
- 15.Yamamoto, S., A. Terai, K. Yuri, H. Kurazono, Y. Takeda, and O. Yoshida. 1995. Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immunol. Med. Microbiol. 12:85-90. [DOI] [PubMed] [Google Scholar]