Abstract
In recent years, virus-induced nephropathy caused mainly by BK polyomavirus (BKPyV), JC polyomavirus (JCPyV), and adenovirus has emerged as a problem in renal transplant patients. In the present study, we developed a multiplex real-time PCR assay to quantify the viral load of BKPyV, JCPyV, and adenovirus simultaneously. The dynamic range covered at least 6 orders of magnitude. This system was specific and reproducible, even in the presence of large amounts of DNA of other viruses. To validate this assay, urine samples from 124 renal transplant patients and serum samples from 18 hemorrhagic cystitis patients after hematopoietic stem cell transplantation were examined. In the urine samples from renal transplant patients, BKPyV was detected in 28 patients (22.6%), JCPyV was detected in 51 patients (41.1%), and adenovirus was detected in 2 patients (1.6%). The maximum amounts of each virus detected were 2.7 × 109, 8.7 × 108, and 1.2 × 102 copies/ml, respectively. Decoy cells were observed in 31 patients. The quantities of both BKPyV and JCPyV DNA were greater in samples with decoy cells. Two patients whose BKPyV viral loads exceeded 108 copies/ml had elevated serum creatinine levels and were diagnosed with BKPyV nephropathy based on graft biopsies. In serum samples from hemorrhagic cystitis patients, BKPyV, JCPyV, and adenovirus was detected in six, two, and three patients, respectively. Strong correlations were observed between the viral DNA copy numbers determined in the multiplex assays and those determined in single assays. Since this new assay is rapid, sensitive, and specific, it can be used for quantitative analyses of viruses in urine and serum samples after transplantation.
Although immunological rejection after renal transplantation has decreased with advances in immunosuppressive therapy, virus-induced nephropathy, which was rare with conventional immunosuppressants, has become a clinical problem. BK polyomavirus (BKPyV) is a prevalent pathogen causing virus-induced nephropathy, and other viruses, including JC polyomavirus (JCPyV) and adenovirus, can cause nephropathy (1, 4, 13). These viruses commonly infect a large number of people in childhood and remain latent in the urinary tract after primary infection. Reactivation with asymptomatic viruria may occur in both immunocompetent subjects and immunocompromised patients.
For the early diagnosis and treatment of BKPyV nephropathy, urine cytology is useful for screening high-risk patients (1). The virus-infected urothelial cells called “decoy cells,” identified by their typical ground glass intranuclear inclusions on cellular smears stained by the Papanicolaou method, are observed in most patients with BKPyV nephropathy. However, decoy cells are not specific for the presence of BKPyV in urine and can be found in JCPyV and adenovirus infection (1, 4, 22). Therefore, the detection of viral DNA is essential for a precise diagnosis and the identification of patients at high risk for nephropathy. In addition, hemorrhagic cystitis can be observed after hematopoietic stem cell transplantation and sometimes after renal transplantation. This involves sustained hematuria and symptoms of lower urinary tract irritability, such as dysuria with frequency and urgency. It is caused most often by adenovirus with serotypes 11, 34, and 35 in subgroup B, although BKPyV and JCPyV can also cause hemorrhagic cystitis (6, 22).
Recently, real-time PCR methods have been introduced into clinical virology for the quantitative detection of viral copy numbers, and the exact determination of virus genome copy numbers provides useful information about the magnitude of the infection, which is beneficial for evaluating whether the detected virus is pathogenic, especially with latent virus infections. Previously, we developed multiplex real-time PCR systems that can quantify three viruses simultaneously (20, 21) and put the technique into clinical practice after stem cell transplantation. The use of these systems reduces significantly the time and labor required for the examination of each virus.
The present study developed a multiplex real-time PCR assay for the simultaneous quantification of BKPyV, JCPyV, and adenovirus and validated it for the quantitative determination of viral loads. This method was then further validated on samples of urine and serum from posttransplant patients.
MATERIALS AND METHODS
Primers and probes.
We considered the primers and probes described in previous reports and chose the large T antigen for BKPyV (11), the hypothetical protein Jvgp5 for JCPyV (17), and the hexon protein for adenovirus (19). The known complete genome sequences of 20 BKPyV strains (16), 8 JCPyV strains (23), and 3 adenovirus serotypes (including adenoviruses 11, 34, and 35) distributed in Japan were obtained from the NCBI database and aligned by using Genetyx version 8 (Genetyx, Tokyo, Japan). The sequences of the primers and probes for JCPyV and adenovirus almost completely matched the known sequences. For BKPyV, we modified the sequences of reported primers (11) and used a set of mixed primers because the target nucleotide sequence of BKPyV observed in Japan differs from that described in the literature (11). Each probe was labeled with different fluorochromes (20): the BKPyV probe was labeled with 6-carboxyfluorescein (FAM) and quenched with black-hole quencher (BHQ) 1a; the JCPyV probe was labeled with carbocyanine 5 (Cy5) and quenched with BHQ3a; and the adenovirus probe was labeled with 6-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein (JOE) and quenched with BHQ1a. All primers (Fasmac, Kanagawa, Japan) and probes (Operon Biotechnologies, Huntsville, AL) were synthesized commercially. The sequences of the primers and probes used in the multiplex real-time PCR assay are listed in Table 1.
TABLE 1.
Sequences of the primers and probes used in the real-time PCR assay
| Target gene (GenBank no.) | Primer or probe | Sequence (5′-3′)a | Position |
|---|---|---|---|
| BKPyV FUK-23 (AB365131) | Forward primer 1 | AGCAGGCAAGGGTTCTATTACTAAAT | 4209-4234 |
| Reverse primer 1 | GAAGCAACAGCAGATTCTCAACA | 4319-4341 | |
| Probe | FAM-AAGACCCTAAAGACTTTCCTTCTGATCTACACCAGTTT-BHQ1a | 4249-4286 | |
| BKPyV JPN-36 (AB269840) | Forward primer 2 | AGCAGGCAAGAGTTCTATTACTAAAT | 4212-4237 |
| Reverse primer 2 | GAGGCAACAGCAGATTCCCAACA | 4322-4344 | |
| JCPyV Tokyo-1 (AF030085) | Forward primer | AGAGTGTTGGGATCCTGTGTTTT | 4296-4318 |
| Reverse primer | GAGAAGTGGGATGAAGACCTGTTT | 4350-4373 | |
| Probe | Cy5-TCATCACTGGCAAACATTTCTTCATGGC-BHQ3a | 4321-4348 | |
| Adenovirus 11 (AC000015) | Forward primer | GCCCACCCTGCTTTATCTTCTC | 20977-20998 |
| Reverse primer | CAGGTAGACTGCCTCGATGATG | 21043-21064 | |
| Probe | JOE-TGCACTCTGACCACGTCGAAAACTTC-BHQ1a | 21002-21027 |
The underlined nucleotides differ between BKPyV strains FUK-23 and JPN-36. FAM, 6-carboxyfluorescein; BHQ, back-hole quencher; Cy5, carbocyanine 5; JOE, 6-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein.
Constructing positive control plasmids.
To construct positive control plasmids, the PCR product amplified by each primer (Table 1) was cloned into pGEM-T Easy plasmid (Promega, Madison, WI), as described previously (12, 18). For BKPyV and adenovirus (type 11), clinical isolates from the urine of renal transplant patients were used as templates. For JCPyV, a plasmid containing the complete sequence of the Mad1 strain, kindly provided by Hirofumi Sawa, was used as the template. The constructed plasmids were sequenced on an ABI Prism 310 (Perkin-Elmer, Waltham, MA). The DNA concentration of the plasmids was determined by using the UV absorbance at 260 nm, and serial dilutions of plasmid DNA were used to make a standard curve.
DNA extraction.
For urine, viral DNA was extracted from 140-μl samples by using an automatic DNA extraction machine, the QIAcube (Qiagen, Hilden, Germany), and QIAamp viral RNA kits (Qiagen) and then eluted in 60 μl of water. For serum samples, viral DNA was extracted from 200-μl samples using QIAamp DNA blood kits (Qiagen) and eluted in 200 μl of water.
Quantification of viral DNA by using multiplex real-time PCR.
Multiplex and single real-time PCR were performed by using a QuantiTect multiplex PCR kit (Qiagen). The multiplex real-time PCR assay was performed in a total reaction volume of 25 μl containing 5 μl of DNA extract, 12.5 μl of 2× QuantiTect multiplex PCR master mix, each forward and reverse primer, and each probe (20). To determine the optimal concentrations of the primers and probes, various concentrations of the primer and probe sets were evaluated by using single and multiplex real-time PCR assays. The optimal concentration of each primer and probe was 100 nM for each BKPyV primer, 200 nM for JCPyV and adenovirus primers, and 100 nM for each probe. A passive reference dye, Rox, was included in the reaction mixture. Amplification and real-time fluorescence detection were performed by using the Mx3000P real-time PCR system (Stratagene, La Jolla, CA) and the following protocol: initial denaturation and polymerase activation for 15 min at 95°C, followed by 50 cycles at 94°C for 30 s and 60°C for 60 s. Real-time fluorescence measurements were recorded and a threshold cycle (CT) value for each sample was calculated by determining the point at which the fluorescence exceeded the threshold (12). Each real-time PCR assay contained a standard dilution series for DNA quantification, and all samples were analyzed in duplicate. Negative controls were included with each run. The standards were plasmid controls that contained PCR products amplified by each primer set, as described above. For multiplex real-time PCR, serial dilutions of mixed plasmid control were tested, and standard curves were constructed for each virus from the CT values. The number of viral DNA copies was calculated from these standard curves and expressed as copies per 1 ml of urine or serum. Single real-time PCR assays were performed in the same manner as the multiplex assay, except that only one set of primers/probe was included at a time.
Clinical specimens.
Urine samples from 124 renal transplant recipients and serum samples from 18 hemorrhagic cystitis patients after hematopoietic stem cell transplantation were obtained to test the accuracy of the assay. The mean patient ages were 47 (range, 8 to 75 years) and 15 (3 to 58) years, respectively. The periods after transplantation were 78 (2 to 275) and 2.4 (0.9 to 6.0) months, respectively. The need for renal transplantation was derived from chronic glomerular nephropathy (n = 70), IgA nephropathy (n = 22), diabetic nephropathy (n = 10), follicular glomerular sclerosis (n = 4), and miscellaneous causes (n = 20). Patients who received a hematopoietic stem cell transplant suffered from severe aplastic anemia (n = 9), acute lymphoblastic leukemia (n = 3), acute myelogenous leukemia (n = 2), and miscellaneous diseases (n = 4). The maintenance drugs used for immunosuppression after a renal transplant included cyclosporine (n = 53), tacrolimus (n = 62), and mycophenolate mofetil (n = 75); and cyclosporine (n = 1) and tacrolimus (n = 17) were the drugs used for subjects with a hematopoietic stem cell transplant. Informed consent was obtained from each subject, and ethical considerations were in accordance with the provisions of the Declaration of Helsinki.
Statistical analysis.
Statistical analyses were performed with SPSS for Windows 16.0 (SPSS, Chicago, IL). A regression analysis was used to compare the multiplex assay with the single assays. Probit analysis was used to determine the minimum quantitative level in multiplex and single real-time PCRs. The 95% confidence interval (CI) was calculated from the t distribution as the mean estimated copy number ± t × the standard error, where t was estimated to be 2.042 from the Student t table. A Mann-Whitney U test was used to compare the mean viral DNA copy numbers.
RESULTS
Standard curve and dynamic range of the multiplex assay.
Serial dilutions of mixed viral plasmid standards were tested by using the multiplex real-time PCR, and individual standard curves were constructed from the CT values (Fig. 1). The multiplex assay could amplify each plasmid standard between 5 × 10 and 5 × 107 copies per reaction mixture with a strong linear relationship between the CT values and the log10 of the input number of copies (BKPyV, r2 = 0.998; JCPyV, r2 = 1.000; adenovirus, r2 = 0.999). The plasmid standards at five copies/ml were not amplified in all mixtures. The slopes of the standard curves were −3.331 for BKPyV, −3.209 for JCPyV, and −3.231 for adenovirus. The standard curves generated from the multiplex assay were similar to those generated from the single assays (data not shown).
FIG. 1.
Standard curves generated by multiplex real-time PCR using serial dilutions of each viral standard ranging from 5 × 10 to 5 × 107 copies per reaction. The CT values corresponding to the PCR cycle number are plotted against the copy number of each viral standard. Symbols: ○, BKPyV standard plasmid; ▵, JCPyV standard plasmid; □, adenovirus standard plasmid.
Sensitivity test.
To determine the minimum quantitative level for the assay, we performed sensitivity studies using 10 replicates of various dilutions of the plasmid. The minimum quantitative level established with this multiplex assay was 18 copies per reaction for BKPyV (95% CI = 7.40 to 841.40), 6 copies for JCPyV (95% CI = 3.78 to 32.73), and 11 copies for adenovirus (95% CI = 6.34 to 83.56). The minimum quantification level with the single assays was 21 copies for BKPyV (95% CI = 8.26 to 1,383.57), 9 for JCPyV (95% CI = 5.47 to 61.09), and 33 for adenovirus (95% CI = 11.43 to 2,192.80). These results indicated that the multiplex assay has the same sensitivity as the single assays.
Reproducibility test.
To evaluate intra- and interassay variability, a 10-fold serial dilution of mixed standards was used in the multiplex assay. The CT values were measured in multiple replicates, and the mean of each CT value and coefficients of variation were calculated. The intra-assay variability was determined using 10 replicates per batch, and the interassay variability was examined by running the same standards with five replicates on four consecutive days (Table 2). Except for five copies of standard plasmid, the coefficients of variation were <5% in the intra- and interassays, indicating that the assay was highly reproducible. We also performed reproducibility studies with clinical isolates (Table 3). We chose five clinical specimens (four urine and one serum specimens), most of which had multiple viruses with low to high viral loads. DNA was extracted from the samples and used for multiplex PCR. Similar to the plasmid controls, high reproducibility was confirmed using the clinical specimens.
TABLE 2.
Intra-and interassay variability of plasmid standarda
| Copy no. of plasmid standard | BKPyV |
JCPyV |
Adenovirus |
|||
|---|---|---|---|---|---|---|
| Mean CT | %CV | Mean CT | %CV | Mean CT | %CV | |
| Intra-assay (n = 10) | ||||||
| 5 × 107 | 15.15 | 4.43 | 14.89 | 1.78 | 15.21 | 1.80 |
| 5 × 106 | 18.80 | 2.04 | 18.30 | 1.44 | 18.49 | 1.52 |
| 5 × 105 | 22.44 | 3.52 | 21.63 | 1.09 | 22.01 | 0.89 |
| 5 × 104 | 24.77 | 0.95 | 24.52 | 1.55 | 24.51 | 1.96 |
| 5 × 103 | 28.33 | 1.48 | 27.71 | 0.91 | 28.14 | 0.92 |
| 5 × 102 | 32.61 | 1.83 | 31.03 | 1.21 | 31.56 | 1.44 |
| 5 × 10 | 35.12 | 2.00 | 34.23 | 1.37 | 34.64 | 1.12 |
| 5 | 40.04 | 13.40 | 37.97 | 11.61 | 40.23 | 13.00 |
| Interassay (n = 20)b | ||||||
| 5 × 107 | 15.26 | 4.63 | 15.03 | 2.68 | 15.18 | 3.22 |
| 5 × 106 | 18.67 | 2.20 | 18.22 | 1.39 | 18.51 | 1.36 |
| 5 × 105 | 22.30 | 3.44 | 21.68 | 1.78 | 22.04 | 2.68 |
| 5 × 104 | 25.19 | 3.51 | 25.03 | 1.54 | 25.25 | 2.04 |
| 5 × 103 | 28.59 | 1.25 | 28.22 | 0.91 | 28.70 | 1.55 |
| 5 × 102 | 32.29 | 1.29 | 31.56 | 0.85 | 32.09 | 1.12 |
| 5 × 10 | 35.86 | 2.16 | 35.09 | 1.81 | 35.49 | 1.57 |
| 5 | 43.23 | 13.17 | 42.72 | 14.58 | 44.73 | 13.48 |
CT, threshold cycle; %CV, percent coefficient of variation.
Five replicates, four times.
TABLE 3.
Intra-assay variability of clinical specimensa
| Patient | Sample type | BKPyV |
JCPyV |
Adenovirus |
|||
|---|---|---|---|---|---|---|---|
| Mean copy no./ml | %CV | Mean copy no./ml | %CV | Mean copy no./ml | %CV | ||
| 1 | Urine | 2.8 × 109 | 1.36 | ||||
| 2 | Urine | 3.5 × 103 | 3.36 | 2.4 × 107 | 0.33 | ||
| 3 | Urine | 7.5 × 103 | 1.47 | 7.1 × 102 | 12.78 | ||
| 4 | Urine | 5.2 × 106 | 0.91 | 3.6 × 106 | 0.72 | 1.1 × 103 | 4.92 |
| 5 | Serum | 2.4 × 104 | 1.34 | 1.1 × 105 | 1.29 | 2.8 × 107 | 0.87 |
Mean copy number refers to the geometric mean viral copy numbers based on 10 replicates. %CV, percent coefficient of variation of 10 replicates.
Specificity test.
To investigate whether the DNA extraction solution from clinical specimens influences the amplification efficiency, we performed a reconstructing study using plasmid standard diluted in water or water containing DNA extraction solution from either urine or serum. The urine and serum samples were obtained from a healthy volunteer. No significant changes were observed in the presence of DNA extraction solution from urine or serum, indicating that the background DNA or extracted solution does not affect the amplification efficiency (data not shown).
None of the primer-probe sets reacted with DNA from other viruses, including BKPyV, JCPyV, and adenovirus types 11, 34, and 35, confirming a lack of cross-reactivity among the viruses used in the assay. To examine whether the presence of multiple target viruses within a single sample can affect the value of the individual test component, we evaluated the performance of the multiplex assay in the presence of 105 copies of BKPyV, JCPyV, and adenovirus type 11 DNA isolated from the clinical specimens (Fig. 2A to C) or 107 copies of plasmid control (Fig. 2D to F). The amplification efficacies for each viral plasmid in the presence of one other viral DNA were nearly equal to those generated from the standard plasmids without other viruses, indicating that the quantitative linearity is not influenced by the DNA of other viruses.
FIG. 2.
Influence of background viral DNAs on the linearity of standard curves. (A) BKPyV standard curve in the presence of 105 copies of clinically isolated JCPyV or adenovirus DNA. (B) JCPyV standard curve in the presence of 105 copies of clinically isolated BKPyV or adenovirus DNA. (C) Adenovirus standard curve in the presence of 105 copies of clinically isolated BKPyV or JCPyV DNA. (D) BKPyV standard curve in the presence of 107 copies of JCPyV or adenovirus plasmid DNA. (E) JCPyV standard curve in the presence of 107 copies of BKPyV or adenovirus plasmid DNA. (F) Adenovirus standard curve in the presence of 107 copies of BKPyV or JCPyV plasmid DNA. Symbols: ○, BKPyV DNA standard plasmid without background DNAs; ▵, JCPyV DNA standard plasmid without background DNAs; □, adenovirus standard plasmid without background DNAs; •, the addition of background BKPyV DNA; ▴, the addition of background JCPyV DNA; ▪, the addition of background adenovirus DNA.
Detection of viral DNA in clinical specimens.
First, the multiplex real-time PCR assay was applied to 124 urine specimens from renal transplant patients. BKPyV was detected in 28 (22.6%) samples, JCPyV in 51 (41.1%) samples, and adenovirus in 2 (1.6%) samples. BKPyV and JCPyV were detected together in five urine specimens, BKPyV and adenovirus were detected together in one, and all three viruses were amplified in one. The maximum amounts of each virus were 2.7 × 109, 8.7 × 108, and 1.2 × 102 copies/ml for BKPyV, JCPyV, and adenovirus, respectively. Decoy cells were observed in 31 patients. Of these patients, only BKPyV was detected in 5 patients, only JCPyV was detected in 21 patients, and both viruses were detected in 5 patients. Limited to the cases with only BKPyV, the quantity of BKPyV DNA was higher in samples with decoy cells than in those without (mean, 107.0 versus 103.5 copies/ml; P = 0.001), and all samples positive for decoy cells had a viral load of >105 copies/ml (Fig. 3). Conversely, decoy cells were observed in five of seven (71%) samples with >105 copies of BKPyV DNA/ml. Similarly, there was more JCPyV DNA in samples with decoy cells than in those without (mean, 106.6 versus 104.7copies/ml; P < 0.001), and decoy cells were observed in 18 of 29 (62%) samples with >105 copies of JCPyV DNA/ml (Fig. 3). Two patients whose BKPyV viral loads exceeded 108 copies/ml had elevated serum creatinine levels and were diagnosed with BKPyV nephropathy based on graft biopsies.
FIG. 3.
Comparison of the viral load in urine between samples with or without decoy cells. Samples in which only one virus was detected were analyzed. Bars indicate the logarithmic mean of BKPyV or JCPyV DNA copy numbers.
In addition, 18 serum specimens from patients who developed hemorrhagic cystitis after stem cell transplantation were examined. BKPyV, JCPyV, and adenovirus were amplified in six, two, and three specimens, respectively. BKPyV and adenovirus were codetected in one patient, and all three viruses were detected in another patient. The maximum amounts of each virus were 3.2 × 104, 1.2 × 105, and 1.0 × 107 copies/ml of for BKPyV, JCPyV, and adenovirus, respectively.
Next, we performed single real-time PCR assays for all clinical specimens. Compared to the results of the single assays, the sensitivities and specificities of the multiplex assays were 88.9 and 98.1% for BKPyV, 96.2 and 97.8% for JCPyV, and 83.3 and 100% for adenovirus, respectively. There were some discordant results between the multiplex and single assays; for all of these, the viral copy numbers were below the quantification limits determined above. BKPyV and JCPyV copy numbers were compared by using linear regression analyses, while no linear correlation was calculated for adenovirus because there were only five positive samples. All samples with positive results in both the single and the multiplex assays were used. Strong correlations were observed between the viral DNA copy numbers determined by the multiplex assays and those obtained by the single assays for BKPyV and JCPyV (Fig. 4). The slopes of the correlation plots were 1.046 for BKPyV and 1.010 for JCPyV, indicating that the multiplex assay is as reliable as the single assays for quantifying viral loads.
FIG. 4.
Correlation of each viral DNA load determined in the multiplex and single real-time PCR assays. (A) Correlation of BKPyV DNA copy number (n = 36); (B) correlation of JCPyV DNA copy number (n = 51).
DISCUSSION
We established a multiplex real-time PCR system that can quantify BKPyV, JCPyV, and adenovirus DNA simultaneously. This multiplex assay has a high sensitivity and accuracy without interference by the presence of large amounts of DNA from other viruses. Particularly, BKPyV and JCPyV are closely related to each other with 72 to 81% nucleotide homology in the regions of their 5.1-kb DNA genomes, yielding amino acid homologies of 59 to 83%. However, this assay was specific for each virus. These results indicate that the multiplex system described here would be reliable in clinical settings, although we did not compare the results obtained in our assay to those produced by other established assays. Therefore, cross-reaction with other pathogens cannot be ruled out.
There are several merits of the multiplex system compared to using three separate PCR tests (7). This system reduces the cost, time, and labor required for virus examination since it permits the simultaneous amplification of three viruses in a single reaction mixture. This system would be particularly useful in the management of renal and stem cell transplantation, which requires frequent and expeditious viral monitoring. As shown here, it is possible to detect more than one virus in one patient. Therefore, it is beneficial to examine the presence of viruses by using the multiplex assay. The detection of these viruses aids in clinical management, allowing early treatment or a reduction in immunosuppressive drugs in order to prevent a sudden disease. In addition, the exact determination of virus genome copy numbers provides useful information for diagnosing the severity of the infection and following the course of treatment.
The sequences of the primer-probe sets used in this assay are nearly identical to those of BKPyV and JCPyV from Japan (16, 23). The most commonly used strains outside Japan are Dunlop for BKPyV and Mad1 for JCPyV. There is only a single mismatch between the Dunlop strain and our BKPyV probe, and there is no mismatch between Mad1 and our JCPyV primer-probe combination. Therefore, the assay should be useful for detecting JCPyV in samples collected outside Japan. We designed the adenovirus primers/probe based on the sequences of adenovirus types 11, 34, and 35, which are the main causes of hemorrhagic cystitis and which belong to subgroup B, and confirmed that the primer-probe set could amplify clinical isolates of adenoviruses 11, 34, and 35. We examined the sequences of adenovirus subgroups A through F in the NCBI database and found that the primer-probe combination used in the present study corresponded to only adenovirus subgroup B. Therefore, subgroups other than B are unlikely to be detected by our assay.
Recently, BKPyV has become a major pathogen of viral nephropathy after renal transplantation. However, clinicians consider other viruses in the setting of virus nephropathy because rare cases of viral nephropathy by JCPyV and adenovirus have been reported (1, 4, 13). These virus-induced nephropathies are diagnosed by the immunohistochemical detection of virus-infected tubular epithelial cells in allograft needle core biopsy specimens. However, since biopsy bears the risk of additional complications, the use of such invasive procedures should be minimized. A BKPyV viruria exceeding 107 copies/ml followed by viremia exceeding 104 copies/ml leads to the histopathological manifestations of disease (10, 15). Hence, the quantity of BKPyV in urine may be useful for identifying patients at risk before they develop BKPyV nephropathy, and serum viral replication can be used as a surrogate marker for BKPyV nephropathy (3, 9). In our study population, two patients with BKPyV nephropathy showed a viral replication greater than 108 copies/ml. In contrast, no patient positive for JCPyV in urine exhibited renal functional deterioration.
Although BKPyV, JCPyV, and adenovirus are latent in urothelial cells and are amplified in urine in some populations (5, 24), these viruses are more prevalent in posttransplant patients. The reported detection rates differ markedly, by 7 to 47% for BKPyV, by 4 to 40% for JCPyV, and by 4% for adenovirus (2, 6, 8, 14). Our results concur with these previous studies, although the detection rates differ according to the timing after transplantation (3). The detection of viral genome sequences alone, without signs of viral replication or epithelial cell damage, may simply indicate a latent viral state of no clinical significance (24); therefore, clinicians must be careful when interpreting positive results.
In summary, we have developed a multiplex real-time PCR assay for the simultaneous detection of BKPyV, JCPyV, and adenovirus DNA. This test is as sensitive and specific as the single real-time PCR assays. The savings in cost, time, and labor associated with this multiplex real-time PCR would be useful in the management of posttransplant recipients.
Acknowledgments
We thank Hirofumi Sawa (Hokkaido University) for kindly providing the plasmid containing the JCPyV Mad1 strain. We also thank the following urologists participating in the Tokai Urological Clinical Trial Group—Tsuneo Kinukawa, Masashi Kato, Osamu Matsuura, and Osamu Kamihira—for providing clinical specimens.
This study was supported in part by a grant for research on measures for emerging and reemerging infections (Intractable Infectious Diseases in Organ Transplant Recipients, H21-Shinko-Ippan-009) from the Ministry of Health, Labor, and Welfare of Japan.
Footnotes
Published ahead of print on 6 January 2010.
REFERENCES
- 1.Baksh, F. K., S. D. Finkelstein, P. A. Swalsky, G. L. Stoner, C. F. Ryschkewitsch, and P. Randhawa. 2001. Molecular genotyping of BK and JC viruses in human polyomavirus-associated interstitial nephritis after renal transplantation. Am. J. Kidney Dis. 38:354-365. [DOI] [PubMed] [Google Scholar]
- 2.Boldorini, R., M. Brustia, C. Veggiani, D. Barco, S. Andorno, and G. Monga. 2005. Periodic assessment of urine and serum by cytology and molecular biology as a diagnostic tool for BK virus nephropathy in renal transplant patients. Acta Cytol. 49:235-243. [DOI] [PubMed] [Google Scholar]
- 3.Costa, C., M. Bergallo, S. Astegiano, M. E. Terlizzi, F. Sidoti, G. P. Segoloni, and R. Cavallo. 2008. Monitoring of BK virus replication in the first year following renal transplantation. Nephrol. Dial. Transplant. 23:3333-3336. [DOI] [PubMed] [Google Scholar]
- 4.Drachenberg, C. B., H. H. Hirsch, J. C. Papadimitriou, R. Gosert, R. K. Wali, R. Munivenkatappa, J. Nogueira, C. B. Cangro, A. Haririan, S. Mendley, and E. Ramos. 2007. Polyomavirus BK versus JC replication and nephropathy in renal transplant recipients: a prospective evaluation. Transplantation 84:323-330. [DOI] [PubMed] [Google Scholar]
- 5.Egli, A., L. Infanti, A. Dumoulin, A. Buser, J. Samaridis, C. Stebler, R. Gosert, and H. H. Hirsch. 2009. Prevalence of polyomavirus BK and JC infection and replication in 400 healthy blood donors. J. Infect. Dis. 199:837-846. [DOI] [PubMed] [Google Scholar]
- 6.Gorczynska, E., D. Turkiewicz, K. Rybka, J. Toporski, K. Kalwak, A. Dyla, Z. Szczyra, and A. Chybicka. 2005. Incidence, clinical outcome, and management of virus-induced hemorrhagic cystitis in children and adolescents after allogeneic hematopoietic cell transplantation. Biol. Blood Marrow Transplant. 11:797-804. [DOI] [PubMed] [Google Scholar]
- 7.Gunson, R. N., T. C. Collins, and W. F. Carman. 2006. Practical experience of high throughput real-time PCR in the routine diagnostic virology setting. J. Clin. Virol. 35:355-367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Helantera, I., F. Ortiz, E. Auvinen, A. Raisanen-Sokolowski, M. Lappalainen, I. Lautenschlager, and P. Koskinen. 2009. Polyomavirus BK and JC infections in well matched Finnish kidney transplant recipients. Transpl. Int. 22:688-693. [DOI] [PubMed] [Google Scholar]
- 9.Hirsch, H. H., D. C. Brennan, C. B. Drachenberg, F. Ginevri, J. Gordon, A. P. Limaye, M. J. Mihatsch, V. Nickeleit, E. Ramos, P. Randhawa, R. Shapiro, J. Steiger, M. Suthanthiran, and J. Trofe. 2005. Polyomavirus-associated nephropathy in renal transplantation: interdisciplinary analyses and recommendations. Transplantation 79:1277-1286. [DOI] [PubMed] [Google Scholar]
- 10.Hirsch, H. H., W. Knowles, M. Dickenmann, J. Passweg, T. Klimkait, M. J. Mihatsch, and J. Steiger. 2002. Prospective study of polyomavirus type BK replication and nephropathy in renal-transplant recipients. N. Engl. J. Med. 347:488-496. [DOI] [PubMed] [Google Scholar]
- 11.Hirsch, H. H., M. Mohaupt, and T. Klimkait. 2001. Prospective monitoring of BK virus load after discontinuing sirolimus treatment in a renal transplant patient with BK virus nephropathy. J. Infect. Dis. 184:1494-1496. [DOI] [PubMed] [Google Scholar]
- 12.Kimura, H., M. Morita, Y. Yabuta, K. Kuzushima, K. Kato, S. Kojima, T. Matsuyama, and T. Morishima. 1999. Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay. J. Clin. Microbiol. 37:132-136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lim, A. K., S. Parsons, and F. Ierino. 2005. Adenovirus tubulointerstitial nephritis presenting as a renal allograft space occupying lesion. Am. J. Transplant. 5:2062-2066. [DOI] [PubMed] [Google Scholar]
- 14.Lopez, V., C. Gutierrez, D. Burgos, M. Gonzalez Molina, M. Cabello, E. Sola, I. Garcia, J. Siles, and P. Florez. 2008. Prospective study of infection and nephropathy due to BK and JC polyomavirus in 76 kidney transplant recipients. Transplant. Proc. 40:2927-2929. [DOI] [PubMed] [Google Scholar]
- 15.Nickeleit, V., T. Klimkait, I. F. Binet, P. Dalquen, V. Del Zenero, G. Thiel, M. J. Mihatsch, and H. H. Hirsch. 2000. Testing for polyomavirus type BK DNA in plasma to identify renal-allograft recipients with viral nephropathy. N. Engl. J. Med. 342:1309-1315. [DOI] [PubMed] [Google Scholar]
- 16.Nishimoto, Y., T. Takasaka, M. Hasegawa, H. Y. Zheng, Q. Chen, C. Sugimoto, T. Kitamura, and Y. Yogo. 2006. Evolution of BK virus based on complete genome data. J. Mol. Evol. 63:341-352. [DOI] [PubMed] [Google Scholar]
- 17.Ryschkewitsch, C., P. Jensen, J. Hou, G. Fahle, S. Fischer, and E. O. Major. 2004. Comparison of PCR-southern hybridization and quantitative real-time PCR for the detection of JC and BK viral nucleotide sequences in urine and cerebrospinal fluid. J. Virol. Methods 121:217-221. [DOI] [PubMed] [Google Scholar]
- 18.Tanaka, N., H. Kimura, K. Iida, Y. Saito, I. Tsuge, A. Yoshimi, T. Matsuyama, and T. Morishima. 2000. Quantitative analysis of cytomegalovirus load using a real-time PCR assay. J. Med. Virol. 60:455-462. [DOI] [PubMed] [Google Scholar]
- 19.Teramura, T., M. Naya, T. Yoshihara, A. Morimoto, and S. Imashuku. 2002. Quantitative detection of serum adenovirus in a transplant recipient. Lancet 359:1945. [DOI] [PubMed] [Google Scholar]
- 20.Wada, K., N. Kubota, Y. Ito, H. Yagasaki, K. Kato, T. Yoshikawa, Y. Ono, H. Ando, Y. Fujimoto, T. Kiuchi, S. Kojima, Y. Nishiyama, and H. Kimura. 2007. Simultaneous quantification of Epstein-Barr virus, cytomegalovirus, and human herpesvirus 6 DNA in samples from transplant recipients by multiplex real-time PCR assay. J. Clin. Microbiol. 45:1426-1432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wada, K., S. Mizoguchi, Y. Ito, J. Kawada, Y. Yamauchi, T. Morishima, Y. Nishiyama, and H. Kimura. 2009. Multiplex real-time PCR for the simultaneous detection of herpes simplex virus, human herpesvirus 6, and human herpesvirus 7. Microbiol. Immunol. 53:22-29. [DOI] [PubMed] [Google Scholar]
- 22.Yuste, R. S., C. Frias, A. Lopez, C. Vallejo, P. Martin, and C. Bellas. 2008. Diagnostic value of JC/BK virus antibody immunohistochemistry staining in urine samples from posttransplant immunosuppressed patients in relation to polyomavirus reactivation. Acta Cytol. 52:191-195. [DOI] [PubMed] [Google Scholar]
- 23.Zheng, H. Y., C. Sugimoto, M. Hasegawa, N. Kobayashi, A. Kanayama, A. Rodas, M. Mejia, J. Nakamichi, J. Guo, T. Kitamura, and Y. Yogo. 2003. Phylogenetic relationships among JC virus strains in Japanese/Koreans and Native Americans speaking Amerind or Na-Dene. J. Mol. Evol. 56:18-27. [DOI] [PubMed] [Google Scholar]
- 24.Zhong, S., H. Y. Zheng, M. Suzuki, Q. Chen, H. Ikegaya, N. Aoki, S. Usuku, N. Kobayashi, S. Nukuzuma, Y. Yasuda, N. Kuniyoshi, Y. Yogo, and T. Kitamura. 2007. Age-related urinary excretion of BK polyomavirus by nonimmunocompromised individuals. J. Clin. Microbiol. 45:193-198. [DOI] [PMC free article] [PubMed] [Google Scholar]