Skip to main content
Pancreatology logoLink to Pancreatology
. 2009 Apr 29;9(3):293–301. doi: 10.1159/000186051

Epigenetic Silencing of MicroRNA miR-107 Regulates Cyclin-Dependent Kinase 6 Expression in Pancreatic Cancer

Kwang-Hyuck Lee a,g, Craig Lotterman c,d, Collins Karikari a, Noriyuki Omura a, Georg Feldmann a, Nils Habbe a, Michael G Goggins a,b,c, Joshua T Mendell e,f, Anirban Maitra a,c,f,*
PMCID: PMC2835374  PMID: 19407485

Abstract

Aberrant expression of microRNAs (miRNAs) has emerged as an important hallmark of cancer. However, the putative mechanisms regulating miRNAs per se are only partially known. It is well established that many tumor suppressor genes in human cancers are silenced by chromatin alterations, including promoter methylation and histone deacetylation. We postulated that miRNAs undergo similar epigenetic inactivation in pancreatic cancer. Two human pancreatic cancer cell lines – MiaPACA-2 and PANC-1 – were treated with the demethylating agent, 5-aza-2′-deoxycytidine (5-Aza-dC) or the histone deacetylase inhibitor, trichostatin A, as well as the combination of the two. Expression of miRNAs in control and treated cell lines was assessed using a custom microarray platform. Fourteen miRNAs were upregulated two-fold or greater in each of the cell lines following exposure to both chromatin-modifying agents, including 5 that were in common (miR-107, miR-103, miR-29a, miR-29b, and miR-320) to both MiaPACA-2 and PANC-1. The differential overexpression of miR-107 in the treated cancer cell lines was confirmed by Northern blot assays. Methylation-specific PCR assays for assessment of CpG island methylation status in the 5′ promoter region of the miR-107 primary transcript demonstrated complete loss of methylation upon exposure to 5-Aza-dC. Enforced expression of miR-107 in MiaPACA-2 and PANC-1 cells downregulated in vitro growth, and this was associated with repression of the putative miR-107 target, cyclin-dependent kinase 6, thereby providing a functional basis for the epigenetic inactivation of this miRNA in pancreatic cancer.

Key Words: microRNA, Promoter methylation, miR-107

Introduction

MicroRNAs (miRNAs) are a diverse class of 18–24 nucleotide RNA molecules that demonstrate remarkable evolutionary conservation [1]. The principal function of these noncoding RNAs is to regulate the stability and translation of miRNA transcripts. Physiologic regulation of expression by miRNAs plays a critical role in development and homeostasis. Aberrant expression of miRNA is widespread, if not ubiquitous, in human cancers, with the identification of both overexpressed and underexpressed miRNAs in neoplastic cells compared to their normal counterparts [2]. While such misexpression may be construed as an epiphenomenon of the cancer phenotype, an increasing body of evidence suggests that these miRNA alterations are causal to tumorigenesis. Analogous to cancer-associated coding genes, both oncogenic miRNAs (onco-miRs) and tumor-suppressor miRNAs (TSG-miRs) have been identified in human cancers [3, 4]. As can be expected, candidate onco-miRs are typically overexpressed (for instance, miR-21, or the miR-17–92 polycistron) [5, 6], while putative TSG-miRs such as miR-15a, miR-16, and the let-7 family are downregulated in cancer cells [7, 8]. Many of the coding gene targets altered by misexpressed miRNAs in human cancers have been identified. For example, the critical RAS oncogene is a target of the let-7 miRNA family, and decreased expression of let-7 members results in elevated RAS transcripts in adenocarcinomas of the lung [9]. Conversely, the miR-17–92 polycistron inhibits the expression of the TSG phosphatase and tensin homolog deleted on chromosome ten (PTEN), which likely contributes to the oncogenic phenotype associated with this miRNA cluster [6, 10, 11].

Even as miRNAs have emerged as master regulators of the cellular transcriptome, a critical question pertains to the mechanisms regulating these noncoding elements themselves. In some instances, misexpressed miRNAs are a reflection of genomic alterations in the neoplastic cells. Thus, reduced expression of miR-15 and miR-16 often correlates with deletions of chromosome 13q14 in B cell lymphomas, while conversely, recurrent amplifications of 13q31 result in overexpression of the miR-17–92 polycistron contained within this amplicon [12,13,14]. In other instances, bona fide transcription factors such as C-myc, p53, and Twist have been identified as direct transcriptional regulators of miRNA, as evidenced by binding to the promoter region of the corresponding miRNA primary transcript [15,16,17]. Since the activity of these transcription factors is often altered in neoplastic cells, there is, not surprisingly, an associated disruption in miRNA homeostasis as well.

Epigenetic mechanisms, including promoter methylation and histone modification, play a critical role in the regulation of mammalian gene expression [18]. Aberrations in the ‘epigenome’ are widespread in human cancers, with transcriptional silencing of tumor suppressor genes (TSGs) by promoter methylation observed in nearly all malignancies [19, 20]. In many of these instances, restitution of gene expression through chromatin modification leads to growth inhibition, underscoring the importance of epigenetic silencing in tumor suppression [21]. Not surprisingly, several recent studies have identified that subsets of miRNAs are also regulated via epigenetic mechanisms in human cancers, typically through methylation of CpG islands within the miRNA primary transcript promoter region [22,23,24,25,26,27,28,29,30,31,32,33,34]. Thus, in addition to genomic alterations and transcription factor regulation, epigenetic mechanisms have emerged as another ‘cog in the wheel’ for the control of miRNA expression [35, 36]. In this study, we have utilized an unbiased approach to identify epigenetically regulated miRNAs in pancreatic cancer. We confirm that the miR-107 promoter undergoes methylation in pancreatic cancer cells, which can be reversed with chromatin-modifying agents. Further, we show that enforced expression miR-107 in pancreatic cancer cells inhibits in vitro growth, and represses cyclin-dependent kinase 6 (CDK6) levels, which links epigenetic inactivation of this miRNA in cancers with cell cycle progression.

Materials and Methods

Treatment of Pancreatic Cancer Lines with Chromatin-Modifying Agents

MiaPACA-2 and PANC-1 pancreatic cancer cell lines were maintained as previously described [37]. The cell lines were treated with the demethylating agent, 5-aza-2-deoxycytidine (5-Aza-dC; Sigma, St. Louis, Mo., USA) and histone deacetylase inhibitor, trichostatin A (TSA; Sigma), either alone or in combination, as previously described [38, 39]. Briefly, the cells were exposed to either 5-Aza-dC (1 μM) for 4 days, or to TSA (1 μM) for 24 h. Mock-treated cells were cultured with the equivalent volume of PBS. For the combination treatment, these cells were cultured in the presence of 5-Aza-dC (1 μM) for 3 days and then treated for another 24 h with TSA (0.5 μM), as described [38, 39].

Monitoring the Efficiency of Epigenetic Derepression

In order to confirm the efficiency of drug treatment, we performed RT-PCR for two previously described epigenetically silenced genes in MiaPACA-2 and PANC-1 cells, NPTX2 and UCHL1, as described [38]. Total RNA was extracted from pancreatic cancer cell lines using TRIzol reagent (Qiagen, Valencia, Calif., USA) according to the manufacturer's instructions, and reverse transcribed using Superscript II (Invitrogen, Grand Island, N.Y., USA). Semi-quantitative RT-PCR was performed under the following conditions: (a) 95°C for 5 min; (b) 35 cycles of 95°C for 20 s, 60°C for 20 s, and 72°C for 20 s, and (c) a final extension of 4 min at 72°C. Primer sequences were 5′-CATCGAGCTGCTCATCAAC-3′ (forward) and 5′-CTGCTCTTGTCCAAG-GATC-3′ (reverse) for NPTX2, 5′-CTTCATGAAGCAGACCATTG-3′ (forward) and 5′-ATCATGGGCTGCCTGTATG-3′ (reverse) for UCHL1. GUSB was utilized as a housekeeping gene.

MiRNA Analysis Using a Custom Microarray Platform

Microarray analysis for differentially expressed miRNAs in 5-Aza-dC-, TSA-, and combination-treated, and control PBS-treated, MiaPACA-2 and PANC-1 cells was performed using a custom Combimatrix microarray platform as we have previously described [16, 40]. Briefly, these custom microarrays contain oligonucleotide probes complementary to 474 human miRNAs. Probes containing 2 mismatches were included for all miRNAs. The hybridized arrays were scanned using a GenePix 4000B microarray scanner (Axon) and signal intensities were extracted using the Combimatrix Microarray Imager software. The background value was determined by calculating the median signal from the mismatch probes and this value was subtracted from all perfect-match probes. Signals that were less than 1.5 times background were removed and datasets were median-centered prior to calculating fold-change values. Fold-change was calculated relative to signals in the PBS-treated cells.

Northern Blot Analysis for Validation of miR-107 Expression

Northern blot assays were performed in control and treated MiaPACA-2 and PANC-1 cells as follows: 20 μg of total RNA was separated on 15% denaturing polyacrylamide gels (Invitrogen), transferred to GeneScreen Plus membranes (Invitrogen), and hybridized using UltraHyb-Oligo buffer (Ambion, Foster City, Calif., USA). The mature miR-107 sequence was obtained from Sanger institute miRBase web site (http://microrna.sanger.ac.uk/sequences/index.shtml), and complementary oligonucleotide end-labeled with T4 Kinase (Invitrogen) were used as probes.

Identification of Conserved CpG Islands in the miR-107 Regulatory Domain

The pri-miR-107 sequence is located at chromosome 10q23.31, within an intron of PANK1, a coding gene. The putative promoter region of pri-miR-107 was localized using our previously described in silico strategy for identifying miRNA promoters [16, 41, 42]. Briefly, the VISTA Browser (May 2004, http://pipeline.lbl.gov/cgi-bin/gateway2) is used to localize the predicted regulatory domain upstream of the pri-miRNA transcription site that is conserved across 6 nonhuman species – dog (May 2005), mouse (August 2005), rat (June 2003), cow (September 2004), opossum (October 2004) and chicken (February 2004). Arbitrarily, at least 50% or more conservation across 3 or more species is used as criterion to determine interspecies conserved sequences, as we have previously described [16, 41, 42]. The conserved regions are then overlaid with the CpG island track on the UCSC Genome Browser (http://genome.ucsc.edu/cgi-bin/hgGateway), in order to delineate highly conserved CpG islands within the regulatory domain.

Methylation-Specific PCR for Reversible CpG Island Methylation

The methylation status of the CpG island upstream of miR-107 was determined by methylation-specific PCR (MSP). DNA samples were treated with sodium bisulfite (Sigma) for 3 h at 70°C, and purified with the Wizard DNA clean-up system (Promega, Madison, Wisc., USA). Thereafter, 1 μl of bisulfite-modified DNA was amplified using sequencing primers or primers specific for methylated or unmethylated DNA. MSP primers were designed to detect the sequence differences between methylated and unmethylated DNA as a result of bisulfite modification, and each primer pair contained at least 4 CpG sites to provide optimal specificity [38]. Primer sequences used in this study are shown in table 1. PCR conditions were as follows: (a) 94°C for 5 min; (b) 40 cycles of 95°C for 30 s, 57°C 62°C for 30 s, and 72°C for 30 s; and (c) a final extension of 5 min at 72°C. Finally, 10 μl of each PCR product were loaded onto 3% agarose gels and visualized by ethidium bromide staining.

Table 1.

Methylation specific PCR primers for assessment of CpG island methylation in the miR-107 promoter

Methylated forward TGTGTAGTAGTTCGTTTATAGC
Methylated reverse GACTCTACGACTACTAAATCG
Unmethylated forward TGTGTAGTAGTTTGTTTATAGTG
Unmethylated reverse CCAACTCTACAACTACTAAATC

Retroviral Expression of miR-107 in Pancreatic Cancer Cells

The miR-107 primary transcript was amplified with primers (forward 5′-ATACCGCTCGAGTGCCATGTGTCCACTGAAT and reverse 5′-ATACCGCTCGAGTTCCATGCCTCAACTCCTCT) and cloned into the XhoI site of the retroviral vector pMSCV-PIG, as we have previously described [16, 42]. Phoenix packaging cells (obtained from G. Nolan, Stanford University, Stanford, Calif., USA) were transfected with 6 μg of DNA using Fugene 6 (Roche) according to the manufacturer's protocol. Following transfection, retroviral supernatants were collected, filtered, and added to MiaPACA-2 and PANC-1 cells for 8 h in the presence of 6 μg/ml polybrene. Two days after infection, puromycin was added to the media at 1 μg/ml and cell populations were selected for 48 h, subsequent to which, cells were trypsinized and counted. The infected cells were then plated and growth rates measured over 6 days using the Cell Counting Kit-8 (CCK-8, Dojindo, Rockville, Md., USA). Cells were infected with an empty MSCV-PIG vector as a control for these experiments.

Western Blot Analysis for CDK6

Western blot analysis for CDK6 expression was performed in PANC-1 cells with enforced miR-107 expression compared to cells with mock pMSCV-PIG infection, using anti-CDK6 (Santa Cruz).

Results

We treated MiaPACA-2 and PANC-1 cells with the chromatin-modifying agents 5-Aza-dC, TSA or the combination, as described [38]. The efficiency of treatment was confirmed by the reexpression of two epigenetically silenced genes, NPTX and UCHL1, whose promoters are methylated in pancreatic cancer, as we have previously described [38]. Specifically, in both cell lines, reexpression was seen in the cells receiving 5-Aza-dC and combination therapy (fig. 1). We then performed microarray analysis on the Combimatrix platform, with 4 sets of microarrays (control, 5-Aza-dC, TSA, and combination) for each of the cell lines. In both cell lines, we identified independent panels of 14 miRNAs that were upregulated two-fold or greater upon combination therapy, compared to control cells (table 2). Of these, there were 5 miRNAs that were upregulated in both cell lines: miR-29a, miR-29b, miR-103, miR-107, and miR-320. For further validation studies, we selected miR-107 due to several reasons, including its known association with human cancer [43, 44], a well-characterized primary transcript, and the existence of a conserved CpG island in the upstream sequence (see below) that would facilitate MSP analysis.

Fig. 1.

Fig. 1

Assessing the efficiency of reexpression of epigenetically silenced genes in pancreatic cancer lines. RT-PCR for NPTX and UCHL1 in MiaPACA-2 and PANC-1 cells confirms reexpression in cells treated with 5-Aza-dC and combination (5-Aza-dC and TSA) while no expression is seen in the PBS-treated cells and the TSA-only treated cells. Lanes 1 and 5: PBS-treated MiaPACA-2 and PANC-1, lanes 2 and 6: 5-Aza-dC treated; lanes 3 and 7: TSAtreated; lanes 4 and 8: combination treated.

Table 2.

Differentially upregulated miRNAs in MiaPACA-2 and PANC-1 cells treated with chromatin modifying agents

MiRNA 5-Aza-dC TSA 5-Aza-dC + TSA
MiaPACA-2
 miR-193a 2.5 1.4 3.5
 miR-214 2.0 3.0 2.9
 miR-22 1.4 2.0 2.5
 miR-320 1.5 2.3 2.5
 miR-191 1.6 1.4 2.4
 miR-29b 1.5 2.0 2.2
 miR-107 1.4 1.6 2.2
 miR-182 1.1 1.5 2.2
 miR-27a 1.0 1.7 2.1
 miR-31 1.3 1.8 2.1
 miR-29a 1.3 2.6 2.0
 miR-30b 1.1 1.5 2.0
 miR-103 1.3 1.4 2.0
 miR-19a 1.1 2.6 2.0

PANC-1
 miR-29a 2.4 3.1 5.2
 miR-29b 1.5 1.8 2.9
 miR-16 1.6 1.9 2.8
 miR-23b 1.5 1.9 2.7
 miR-107 2.0 1.1 2.5
 miR-103 1.9 1.2 2.4
 miR-20b 1.6 1.5 2.3
 miR-93 1.7 1.7 2.2
 miR-320 1.2 1.7 2.2
 miR-25 1.6 1.5 2.1
 miR-181d 1.5 1.3 2.0
 miR-24 1.1 1.7 2.0
 miR-494 1.7 1.9 2.0
 miR-20a 1.5 1.2 2.0

Numbers represent fold upregulation compared to control MiaPACA cells, as measured on the Combinatrix miRNA micro-array platform. Fold changes are rounded to 1st decimal place. miRNAs with at least 2-fold upregulation in combination treatment condition were selected. miRNAs in bold are present in both differentially upregulated lists.

Northern blot analysis for miR-107 in treated MiaPACA-2 and PANC-1 cells confirmed the upregulation of the mature miRNA upon 5-Aza-dC and combination therapy (fig. 2); in MiaPACA-2 cells, miR-107 was also upregulated with TSA alone. In silico analysis of the miR-107 primary transcript showed the presence of an evolutionarily conserved CpG island upstream of the PANK1 transcription start site (fig. 3), highly suggestive of a regulatory role for this region. We designed MSP primers for discrimination of the methylation status of this CpG island in control pancreatic cancer cells compared to those with 5-Aza-dC treatment. Treatment with 5-Aza-dC was accompanied by complete loss of CpG island methylation in both MiaPACA-2 and PANC-1 cells (fig. 4), consistent with epigenetic regulation of the miR-107 promoter. In the control cells, the presence of a product using MSP primers for the detection of unmethylated sequence suggested that methylation of the CpG island was partial.

Fig. 2.

Fig. 2

Northern blot assay for validation of miR-107 reexpression in pancreatic cancer cells. Relative quantification of the miRNA signals under each condition, normalized to U6 snRNA expression, is indicated below the Northern blot. Note the low endogenous expression of miR-107 in both cell lines, and its upregulation in the 5-Aza-dC and combination therapy conditions. a Mia PACA-2 cells. b PANC-1 cells.

Fig. 3.

Fig. 3

In silico identification of conserved CpG island miR-107 promoter sequence. The primary transcript of miR-107 is coexpressed from an intronic segment within PANK1, a coding gene on chromosome 10. A freeze frame of the UCSC Genome Browser (http://genome.ucsc.edu) confirms the presence of a highly conserved CpG island in the immediate upstream sequence of the PANK1 transcription start site. A VISTA plot reiterates the highly conserved nature of the CpG island compared to 6 other 6 species: dog, mouse, rat, cow, opossum and chicken (http://pipeline.lbl.gov/cgi-bin/gateway2), with three species demonstrating at least 50% or more sequence conservation.

Fig. 4.

Fig. 4

MSP analysis of the conserved CpG island in the miR-107 promoter. MSP confirms complete loss of CpG island methylation upon 5-Aza-dC treatment in MiaPACA-2 (a) and PANC-1 (b) cells. The presence of an unmethylated band in the control cells confirms partial methylation of the CpG island in the miR-107 promoter. Note the qualitative increase in the unmethylated product upon 5-Aza-dC treatment, underscoring an alteration in the ratio of methylated:unmethylated alleles in treated cells. MC = Methylated primer, control; MA = methylated primer, 5-Aza-dC; UC = unmethylated primer, control; UA = unmethylated primer, 5-Aza-dC.

Having established that the transcription of miR-107 is epigenetically regulated in pancreatic cancer cells, we next wanted to determine the phenotypic consequences of miR-107 reexpression in cells with low endogenous levels of the mature miRNA. Retrovirally induced enforced expression of miR-107 in PANC-1 and MiaPACA-2 lines led to in vitro growth inhibition at 6 days, compared to cells infected with an empty vector (fig. 5). The effect on growth was particularly pronounced in PANC-1, which is a highly treatment-resistant metastatic pancreatic cancer cell line [45]. In order to identify a putative coding gene target of miR-107 that might underlie the observed growth phenotype, we conducted an in silico search for genes with miR-107 ‘seed’ sequences on TargetScan (http://www.targetscan.org) [46]. CDK6, a cell cycle progression antigen that functions as a retinoblastoma kinase [47], contains miR-107 binding sites in its 3′UTR. Western blot analysis for CDK6 in PANC-1 cells with or without enforced miR-107 expression confirmed repression of CDK6 in the presence of exogenous miR-107 (fig. 6), providing a potential mechanistic link between cell growth and epigenetic silencing of this candidate ‘TSG-miR’ in pancreatic cancer.

Fig. 5.

Fig. 5

Enforced expression of miR-107 in pancreatic cancer cells inhibits in vitro growth. Retrovirally expressed miR-107 in PANC-1 (a) and MiaPACA-2 (b) cells inhibits in vitro growth at 6 days of culture, compared to cells infected with the empty virus. Growth was measured daily, beginning at day 1 after puromycin selection, using the Cell Counting Kit-8 (CCK-8, Dojindo).

Fig. 6.

Fig. 6

Enforced miR-107 expression represses CDK6 in pancreatic cancer cells. Western blot analysis for CDK6 was performed in PANC-1 cells with enforced retroviral miR-107 expression or cells infected with the empty retrovirus. Actin is used as loading control.

Discussion

Recent reports have underscored the role of epigenetic regulation of noncoding miRNAs in human cancer, akin to what has been reported over the past decade in the context of coding genes [22,23,24,25,26,27,28,29,30,31,32,33,34]. One of the first examples for this phenomenon was reported by Jones et al. [22] in bladder cancer, where miR-127 was shown to be reversibly silenced by promoter methylation in the neoplastic cells. Further, these authors demonstrated that reexpression of miR-127 in bladder cancer causes translational repression of the antiapoptotic protein BCL-6, providing a functional basis to the observed phenotype of growth inhibition. More recently, epigenetic regulation of miRNAs has been documented in breast [23, 29, 33], colon [25, 27, 30], ovarian [24], brain [34], liver [32], and oral cancers [28], as well as in hematological malignancies [26], underscoring the rather ubiquitous nature of this phenomenon in human cancer. An miRNA methylation signature associated with cancer metastases has also been reported, with epigenetic silencing of miR-148a, miR-34b/c and miR-9 in primary cultures obtained from lymph nodal metastases [31]. Of note, reexpression of these silenced miRNAs in highly metastatic head and neck cancer cells blocked systemic tumor metastases in vivo [31]. The majority of these aforementioned studies for identification of epigenetically inactivated miRNAs have relied upon an unbiased microarray-based approach using cancer cell lines treated with chromatin-modifying agents, validating the rationale for our current strategy with pancreatic cancer cells.

To the best of our knowledge, this is the first report on global epigenetic regulation of miRNAs in pancreatic cancer. We have identified miR-107 as a candidate miRNA that undergoes transcriptional silencing through methylation of a conserved CpG island in the promoter sequence. Recently, this miRNA was shown to be upregulated during retinoic-acid-induced differentiation in acute promyelocytic leukemia cells [43]. An empirical study examining the effects of a large panel of miRNA inhibitors on cell growth in A549 lung carcinoma found acceleration of growth upon miR-107 inhibition although the functional basis for this effect was not further examined [44]. Of note, miR-107 is overexpressed in nonductal tumors of the pancreas (pancreatic endocrine and acinar cell tumors) [48] while miR-155, a commonly upregulated miRNA in ductal adenocarcinomas [49,50,51], is essentially absent in nonductal tumors. This raises the rather intriguing possibility that ductal adenocarcinomas (also known as ‘pancreatic cancers’) are characterized by a ‘miR-155 positive, miR-107 negative’ pattern, while nonductal tumors, which harbor distinct ontogeny and genetic profiles [52, 53], are ‘miR-107 positive, miR-155 negative’. Needless to say, this potential dichotomy would need to be validated in future studies.

In addition to demonstrating epigenetic silencing of miR-107, we also show that enforced expression of this miRNA inhibits pancreatic cancer growth, and is accompanied by repression in CDK6 levels. CDK6 is a cyclin-D1-dependent kinase, which phosphorylates the retinoblastoma protein, thereby removing the repression of E2F transcription factor activity, and facilitating cell cycle progression [47, 54]. Besides its more established role in the cell cycle, recent studies have also identified a novel function for CDK6 in blocking cellular differentiation, which is not shared by its functional homolog, CDK4 [reviewed in ref. [55]]. Given the prior observation that miR-107 is induced during retinoic-acid-mediated differentiation [43], it is worth speculating that epigenetic silencing of miR-107 and the secondary elevation of CDK6 in pancreatic cancer have effects beyond growth promotion alone. Of note, miR-107 is not the only putative ‘TSG-miR’ that appears to target CDK6; a recent study on miR-34a has demonstrated that restitution of this epigenetically silenced miRNA also represses CDK6 in cancer cells and inhibits in vitro growth [56]. Our group and others have previously identified miR-34a as a p53-regulated miRNA that is downregulated in many cancers, including pancreatic cancer [16, 57, 58]. Thus, it is likely that there are manifold mechanisms for the observed elevation of CDK6 in pancreatic cancer, both genetic (loss of function mutations of the CDK inhibitor, p16) [59, 60] and epigenetic (methylation of miR-107 and miR-34a promoters, respectively).

Finally, one needs to mention that, in addition to miR-107, our study also found microarray-based evidence for epigenetic silencing of other miRNAs in pancreatic cancer, including miR-29a, miR-29b, miR-103, and miR-320. A subset of these miRNAs has already been documented to have a putative TSG-like role in other malignancies, underscoring the rationale for their epigenetic silencing in pancreatic cancer. For example, miR-29b is highly expressed in normal cholangiocytes, but significantly downregulated in cholangiocarcinoma cells [61]. Enforced miR-29b expression in cholangiocarcinoma represses the antiapoptotic protein and putative miR-29b target, Mcl-1, and sensitizes the cancer cells to tumor-necrosis-factor-related apoptosis-inducing ligand cytotoxicity. On the same lines, loss of miR-320 expression correlates with significantly lower recurrence-free survival in stage II microsatellite stable colorectal cancers, highlighting an association between miRNA loss of function and tumor progression [62]. From a therapeutic standpoint, one is encouraged by the premonition that restituting the expression of one or more of these epigenetically silenced miRNAs will also emerge as a therapeutic strategy in pancreatic cancer, as recently documented with other disease models [63].

Acknowledgements

A.M. is supported by NIH P50CA062924 SPORE in GI Cancers, the Sol Goldman Pancreatic Cancer Research Center, and the Michael Rolfe Foundation for Pancreatic Cancer Research. J.M. is supported by the Leukemia and Lymphoma Society, Rita Allen Foundation Society, the Sol Goldman Pancreatic Cancer Research Center, and the NIH (R01CA120185).

References

  • 1.Croce CM, Calin GA. MiRNAs, cancer, and stem cell division. Cell. 2005;122:6–7. doi: 10.1016/j.cell.2005.06.036. [DOI] [PubMed] [Google Scholar]
  • 2.Slack FJ, Weidhaas JB. MicroRNAs as a potential magic bullet in cancer. Future Oncol. 2006;2:73–82. doi: 10.2217/14796694.2.1.73. [DOI] [PubMed] [Google Scholar]
  • 3.Zhang B, Pan X, Cobb GP, Anderson TA. MicroRNAs as oncogenes and tumor suppressors. Dev Biol. 2007;302:1–12. doi: 10.1016/j.ydbio.2006.08.028. [DOI] [PubMed] [Google Scholar]
  • 4.Lee YS, Dutta A. MicroRNAs: Small but potent oncogenes or tumor suppressors. Curr Opin Investig Drugs. 2006;7:560–564. [PubMed] [Google Scholar]
  • 5.Cho WC. OncomiRs: the discovery and progress of microRNAs in cancers. Mol Cancer. 2007;6:60. doi: 10.1186/1476-4598-6-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Mendell JT. Miriad roles for the miR-17–92 cluster in development and disease. Cell. 2008;133:217–222. doi: 10.1016/j.cell.2008.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Calin GA, Croce CM. Genomics of chronic lymphocytic leukemia microRNAs as new players with clinical significance. Semin Oncol. 2006;33:167–173. doi: 10.1053/j.seminoncol.2006.01.010. [DOI] [PubMed] [Google Scholar]
  • 8.Stefani G, Slack F. MicroRNAs in search of a target. Cold Spring Harb Symp Quant Biol. 2006;71:129–134. doi: 10.1101/sqb.2006.71.032. [DOI] [PubMed] [Google Scholar]
  • 9.Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, Labourier E, Reinert KL, Brown D, Slack FJ. RAS is regulated by the let-7 microRNA family. Cell. 2005;120:635–647. doi: 10.1016/j.cell.2005.01.014. [DOI] [PubMed] [Google Scholar]
  • 10.Xiao C, Srinivasan L, Calado DP, Patterson HC, Zhang B, Wang J, Henderson JM, Kutok JL, Rajewsky K. Lymphoproliferative disease and autoimmunity in mice with increased miR-17–92 expression in lymphocytes. Nat Immunol. 2008;9:405–414. doi: 10.1038/ni1575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Pezzolesi MG, Platzer P, Waite KA, Eng C. Differential expression of PTEN-targeting microRNAs miR-19a and miR-21 in Cowden syndrome. Am J Hum Genet. 2008;82:1141–1149. doi: 10.1016/j.ajhg.2008.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM. Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci USA. 2002;99:15524–15529. doi: 10.1073/pnas.242606799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T. A polycistronic microRNA cluster, miR-17–92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res. 2005;65:9628–9632. doi: 10.1158/0008-5472.CAN-05-2352. [DOI] [PubMed] [Google Scholar]
  • 14.Rinaldi A, Poretti G, Kwee I, Zucca E, Catapano CV, Tibiletti MG, Bertoni F. Concomitant MYC and microRNA cluster miR-17–92 (C13orf25) amplification in human mantle cell lymphoma. Leuk Lymphoma. 2007;48:410–412. doi: 10.1080/10428190601059738. [DOI] [PubMed] [Google Scholar]
  • 15.O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839–843. doi: 10.1038/nature03677. [DOI] [PubMed] [Google Scholar]
  • 16.Chang TC, Wentzel EA, Kent OA, Ramachandran K, Mullendore M, Lee KH, Feldmann G, Yamakuchi M, Ferlito M, Lowenstein CJ, Arking DE, Beer MA, Maitra A, Mendell JT. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell. 2007 doi: 10.1016/j.molcel.2007.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ma L, Teruya-Feldstein J, Weinberg RA. Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Nature. 2007;449:682–688. doi: 10.1038/nature06174. [DOI] [PubMed] [Google Scholar]
  • 18.Goldberg AD, Allis CD, Bernstein E. Epigenetics: A landscape takes shape. Cell. 2007;128:635–638. doi: 10.1016/j.cell.2007.02.006. [DOI] [PubMed] [Google Scholar]
  • 19.Bernstein BE, Meissner A, Lander ES. The mammalian epigenome. Cell. 2007;128:669–681. doi: 10.1016/j.cell.2007.01.033. [DOI] [PubMed] [Google Scholar]
  • 20.Jones PA, Baylin SB. The epigenomics of cancer. Cell. 2007;128:683–692. doi: 10.1016/j.cell.2007.01.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Baylin SB, Chen WY. Aberrant gene silencing in tumor progression: implications for control of cancer. Cold Spring Harb Symp Quant Biol. 2005;70:427–433. doi: 10.1101/sqb.2005.70.010. [DOI] [PubMed] [Google Scholar]
  • 22.Saito Y, Liang G, Egger G, Friedman JM, Chuang JC, Coetzee GA, Jones PA. Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell. 2006;9:435–443. doi: 10.1016/j.ccr.2006.04.020. [DOI] [PubMed] [Google Scholar]
  • 23.Han L, Witmer PD, Casey E, Valle D, Sukumar S. DNA methylation regulates microRNA expression. Cancer Biol Ther. 2007;6:1284–1288. doi: 10.4161/cbt.6.8.4486. [DOI] [PubMed] [Google Scholar]
  • 24.Lu L, Katsaros D, de la Longrais IA, Sochirca O, Yu H. Hypermethylation of let-7a-3 in epithelial ovarian cancer is associated with low insulin-like growth factor-II expression and favorable prognosis. Cancer Res. 2007;67:10117–10122. doi: 10.1158/0008-5472.CAN-07-2544. [DOI] [PubMed] [Google Scholar]
  • 25.Lujambio A, Ropero S, Ballestar E, Fraga MF, Cerrato C, Setien F, Casado S, Suarez-Gauthier A, Sanchez-Cespedes M, Git A, Spiteri I, Das PP, Caldas C, Miska E, Esteller M. Genetic unmasking of an epigenetically silenced microRNA in human cancer cells. Cancer Res. 2007;67:1424–1429. doi: 10.1158/0008-5472.CAN-06-4218. [DOI] [PubMed] [Google Scholar]
  • 26.Bueno MJ, Perez de Castro I, Gomez de Cedron M, Santos J, Calin GA, Cigudosa JC, Croce CM, Fernandez-Piqueras J, Malumbres M. Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. Cancer Cell. 2008;13:496–506. doi: 10.1016/j.ccr.2008.04.018. [DOI] [PubMed] [Google Scholar]
  • 27.Grady WM, Parkin RK, Mitchell PS, Lee JH, Kim YH, Tsuchiya KD, Washington MK, Paraskeva C, Willson JK, Kaz AM, Kroh EM, Allen A, Fritz BR, Markowitz SD, Tewari M. Epigenetic silencing of the intronic microRNA HSA-miR-342 and its host gene EVL in colorectal cancer. Oncogene. 2008;27:3880–3888. doi: 10.1038/onc.2008.10. [DOI] [PubMed] [Google Scholar]
  • 28.Kozaki K, Imoto I, Mogi S, Omura K, Inazawa J. Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer Res. 2008;68:2094–2105. doi: 10.1158/0008-5472.CAN-07-5194. [DOI] [PubMed] [Google Scholar]
  • 29.Lehmann U, Hasemeier B, Christgen M, Muller M, Romermann D, Langer F, Kreipe H. Epigenetic inactivation of microRNA gene HSA-miR-9–1 in human breast cancer. J Pathol. 2008;214:17–24. doi: 10.1002/path.2251. [DOI] [PubMed] [Google Scholar]
  • 30.Toyota M, Suzuki H, Sasaki Y, Maruyama R, Imai K, Shinomura Y, Tokino T. Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancer. Cancer Res. 2008;68:4123–4132. doi: 10.1158/0008-5472.CAN-08-0325. [DOI] [PubMed] [Google Scholar]
  • 31.Lujambio A, Calin GA, Villanueva A, Ropero S, Sanchez-Cespedes M, Blanco D, Montuenga LM, Rossi S, Nicoloso MS, Faller WJ, Gallagher WM, Eccles SA, Croce CM, Esteller M. A microRNA DNA methylation signature for human cancer metastasis. Proc Natl Acad Sci USA. 2008;105:13556–13561. doi: 10.1073/pnas.0803055105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Datta J, Kutay H, Nasser MW, Nuovo GJ, Wang B, Majumder S, Liu CG, Volinia S, Croce CM, Schmittgen TD, Ghoshal K, Jacob ST. Methylation mediated silencing of microRNA-1 gene and its role in hepatocellular carcinogenesis. Cancer Res. 2008;68:5049–5058. doi: 10.1158/0008-5472.CAN-07-6655. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 33.Kondo N, Toyama T, Sugiura H, Fujii Y, Yamashita H. Mir-206 expression is down-regulated in estrogen receptor α-positive human breast cancer. Cancer Res. 2008;68:5004–5008. doi: 10.1158/0008-5472.CAN-08-0180. [DOI] [PubMed] [Google Scholar]
  • 34.Silber J, Lim DA, Petritsch C, Persson AI, Maunakea AK, Yu M, Vandenberg SR, Ginzinger DG, James CD, Costello JF, Bergers G, Weiss WA, Alvarez-Buylla A, Hodgson JG. Mir-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. BMC Med. 2008;6:14. doi: 10.1186/1741-7015-6-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Saito Y, Jones PA. Epigenetic activation of tumor suppressor microRNAs in human cancer cells. Cell Cycle. 2006;5:2220–2222. doi: 10.4161/cc.5.19.3340. [DOI] [PubMed] [Google Scholar]
  • 36.Fabbri M. MicroRNAs and cancer epigenetics. Curr Opin Investig Drugs. 2008;9:583–590. [PubMed] [Google Scholar]
  • 37.Calhoun ES, Hucl T, Gallmeier E, West KM, Arking DE, Maitra A, Iacobuzio-Donahue CA, Chakravarti A, Hruban RH, Kern SE. Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays. Cancer Res. 2006;66:7920–7928. doi: 10.1158/0008-5472.CAN-06-0721. [DOI] [PubMed] [Google Scholar]
  • 38.Sato N, Fukushima N, Maitra A, Matsubayashi H, Yeo CJ, Cameron JL, Hruban RH, Goggins M. Discovery of novel targets for aberrant methylation in pancreatic carcinoma using high-throughput microarrays. Cancer Res. 2003;63:3735–3742. [PubMed] [Google Scholar]
  • 39.Sato N, Maitra A, Fukushima N, van Heek NT, Matsubayashi H, Iacobuzio-Donahue CA, Rosty C, Goggins M. Frequent hypomethylation of multiple genes overexpressed in pancreatic ductal adenocarcinoma. Cancer Res. 2003;63:4158–4166. [PubMed] [Google Scholar]
  • 40.Bruchova H, Yoon D, Agarwal AM, Mendell J, Prchal JT. Regulated expression of microRNAs in normal and polycythemia vera erythropoiesis. Exp Hematol. 2007;35:1657–1667. doi: 10.1016/j.exphem.2007.08.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, Dang CV, Thomas-Tikhonenko A, Mendell JT. Widespread microRNA repression by Myc contributes to tumorigenesis. Nat Genet. 2008;40:43–50. doi: 10.1038/ng.2007.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Dews M, Homayouni A, Yu D, Murphy D, Sevignani C, Wentzel E, Furth EE, Lee WM, Enders GH, Mendell JT, Thomas-Tikhonenko A. Augmentation of tumor angiogenesis by a Myc-activated microRNA cluster. Nat Genet. 2006;38:1060–1065. doi: 10.1038/ng1855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Garzon R, Pichiorri F, Palumbo T, Visentini M, Aqeilan R, Cimmino A, Wang H, Sun H, Volinia S, Alder H, Calin GA, Liu CG, Andreeff M, Croce CM. MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene. 2007;26:4148–4157. doi: 10.1038/sj.onc.1210186. [DOI] [PubMed] [Google Scholar]
  • 44.Cheng AM, Byrom MW, Shelton J, Ford LP. Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res. 2005;33:1290–1297. doi: 10.1093/nar/gki200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Lieber M, Mazzetta J, Nelson-Rees W, Kaplan M, Todaro G. Establishment of a continuous tumor-cell line (PANC-1) from a human carcinoma of the exocrine pancreas. Int J Cancer. 1975;15:741–747. doi: 10.1002/ijc.2910150505. [DOI] [PubMed] [Google Scholar]
  • 46.Arora A, Simpson DA. Individual mRNA expression profiles reveal the effects of specific microRNAs. Genome Biol. 2008;9:R82. doi: 10.1186/gb-2008-9-5-r82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Malumbres M, Barbacid M. Mammalian cyclin-dependent kinases. Trends Biochem Sci. 2005;30:630–641. doi: 10.1016/j.tibs.2005.09.005. [DOI] [PubMed] [Google Scholar]
  • 48.Roldo C, Missiaglia E, Hagan JP, Falconi M, Capelli P, Bersani S, Calin GA, Volinia S, Liu CG, Scarpa A, Croce CM. MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors are associated with distinctive pathologic features and clinical behavior. J Clin Oncol. 2006;24:4677–4684. doi: 10.1200/JCO.2005.05.5194. [DOI] [PubMed] [Google Scholar]
  • 49.Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC, Croce CM. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA. 2006;103:2257–2261. doi: 10.1073/pnas.0510565103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, Morgan DL, Postier RG, Brackett DJ, Schmittgen TD. Expression profiling identifies microRNA signature in pancreatic cancer. Int J Cancer. 2007;120:1046–1054. doi: 10.1002/ijc.22394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Gironella M, Seux M, Xie MJ, Cano C, Tomasini R, Gommeaux J, Garcia S, Nowak J, Yeung ML, Jeang KT, Chaix A, Fazli L, Motoo Y, Wang Q, Rocchi P, Russo A, Gleave M, Dagorn JC, Iovanna JL, Carrier A, Pebusque MJ, Dusetti NJ. Tumor protein 53-induced nuclear protein 1 expression is repressed by miR-155, and its restoration inhibits pancreatic tumor development. Proc Natl Acad Sci USA. 2007;104:16170–16175. doi: 10.1073/pnas.0703942104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Hruban RH, Klimstra DS, Pitman MB. Tumors of the pancreas. Washington, DC: American Registry of Pathology; 2006. [Google Scholar]
  • 53.Gumbs AA, Moore PS, Falconi M, Bassi C, Beghelli S, Modlin I, Scarpa A. Review of the clinical, histological, and molecular aspects of pancreatic endocrine neoplasms. J Surg Oncol. 2002;81:45–53. doi: 10.1002/jso.10142. discussion 54. [DOI] [PubMed] [Google Scholar]
  • 54.Tashiro E, Tsuchiya A, Imoto M. Functions of cyclin D1 as an oncogene and regulation of cyclin D1 expression. Cancer Sci. 2007;98:629–635. doi: 10.1111/j.1349-7006.2007.00449.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Grossel MJ, Hinds PW. Beyond the cell cycle: A new role for CDK6 in differentiation. J Cell Biochem. 2006;97:485–493. doi: 10.1002/jcb.20712. [DOI] [PubMed] [Google Scholar]
  • 56.Lodygin D, Tarasov V, Epanchintsev A, Berking C, Knyazeva T, Korner H, Knyazev P, Diebold J, Hermeking H. Inactivation of miR-34a by aberrant CpG methylation in multiple types of cancer. Cell Cycle. 2008:7. doi: 10.4161/cc.7.16.6533. [DOI] [PubMed] [Google Scholar]
  • 57.Raver-Shapira N, Marciano E, Meiri E, Spector Y, Rosenfeld N, Moskovits N, Bentwich Z, Oren M. Transcriptional activation of miR-34a contributes to p53-mediated apoptosis. Mol Cell. 2007;26:731–743. doi: 10.1016/j.molcel.2007.05.017. [DOI] [PubMed] [Google Scholar]
  • 58.He L, He X, Lim LP, de Stanchina E, Xuan Z, Liang Y, Xue W, Zender L, Magnus J, Ridzon D, Jackson AL, Linsley PS, Chen C, Lowe SW, Cleary MA, Hannon GJ. A microRNA component of the p53 tumour suppressor network. Nature. 2007;447:1130–1134. doi: 10.1038/nature05939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Shapiro GI, Edwards CD, Rollins BJ. The physiology of p16(INK4A)-mediated G1 proliferative arrest. Cell Biochem Biophys. 2000;33:189–197. doi: 10.1385/CBB:33:2:189. [DOI] [PubMed] [Google Scholar]
  • 60.Schutte M, Hruban RH, Geradts J, Maynard R, Hilgers W, Rabindran SK, Moskaluk CA, Hahn SA, Schwarte-Waldhoff I, Schmiegel W, Baylin SB, Kern SE, Herman JG. Abrogation of the Rb/p16 tumor-suppressive pathway in virtually all pancreatic carcinomas. Cancer Res. 1997;57:3126–3130. [PubMed] [Google Scholar]
  • 61.Mott JL, Kobayashi S, Bronk SF, Gores GJ. miR-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007;26:6133–6140. doi: 10.1038/sj.onc.1210436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Schepeler T, Reinert JT, Ostenfeld MS, Christensen LL, Silahtaroglu AN, Dyrskjot L, Wiuf C, Sorensen FJ, Kruhoffer M, Laurberg S, Kauppinen S, Orntoft TF, Andersen CL. Diagnostic and prognostic microRNAs in stage II colon cancer. Cancer Res. 2008;68:6416–6424. doi: 10.1158/0008-5472.CAN-07-6110. [DOI] [PubMed] [Google Scholar]
  • 63.Esquela-Kerscher A, Trang P, Wiggins JF, Patrawala L, Cheng A, Ford L, Weidhaas JB, Brown D, Bader AG, Slack FJ. The let-7 microRNA reduces tumor growth in mouse models of lung cancer. Cell Cycle. 2008;7:759–764. doi: 10.4161/cc.7.6.5834. [DOI] [PubMed] [Google Scholar]

Articles from Pancreatology are provided here courtesy of Karger Publishers

RESOURCES