Skip to main content
Human Molecular Genetics logoLink to Human Molecular Genetics
. 2010 Jan 11;19(7):1324–1334. doi: 10.1093/hmg/ddq008

Mutations in Cullin 4B result in a human syndrome associated with increased camptothecin-induced topoisomerase I-dependent DNA breaks

Claudia Kerzendorfer 1, Annabel Whibley 5, Gillian Carpenter 1, Emily Outwin 1, Shih-Chieh Chiang 2, Gillian Turner 3, Charles Schwartz 4, Sherif El-Khamisy 2, F Lucy Raymond 5, Mark O'Driscoll 1,*
PMCID: PMC2838540  PMID: 20064923

Abstract

CUL4A and B encode subunits of E3-ubiquitin ligases implicated in diverse processes including nucleotide excision repair, regulating gene expression and controlling DNA replication fork licensing. But, the functional distinction between CUL4A and CUL4B, if any, is unclear. Recently, mutations in CUL4B were identified in humans associated with mental retardation, relative macrocephaly, tremor and a peripheral neuropathy. Cells from these patients offer a unique system to help define at the molecular level the consequences of defective CUL4B specifically. We show that these patient-derived cells exhibit sensitivity to camptothecin (CPT), impaired CPT-induced topoisomerase I (Topo I) degradation and ubiquitination, thereby suggesting Topo I to be a novel Cul4-dependent substrate. Consistent with this, we also find that these cells exhibit increased levels of CPT-induced DNA breaks. Furthermore, over-expression of known CUL4-dependent substrates including Cdt1 and p21 appear to be a feature of these patient-derived cells. Collectively, our findings highlight the interplay between CUL4A and CUL4B and provide insight into the pathogenesis of CUL4B-deficiency in humans.

INTRODUCTION

Defects in several E3-ubiquitin ligases are associated with human disorders including Angelman syndrome (UBE3A), Parkinsonism (PARK2) and von-Hippel–Lindau disease (VHL) (1). As part of a large project to identify genes causative of X-linked mental retardation (MR), high throughput sequencing of all coding genes on the X chromosome from 250 families with multiple members exhibiting X-linked MR resulted in the identification of several mutations in CUL4B in affected patients (2). Individuals with a CUL4B mutation exhibit a syndromal MR condition, that is, MR associated with additional clinical features including growth retardation, relative macrocephaly and motor neuron impairment (2–4) (Table 1). This suggests that defective CUL4B function in humans has a pleiotropic impact affecting both cognition and physical development.

Table 1.

Clinical comparison between CUL4B-mutated syndromal X-linked MR and SCAN1

CUL4B-dependent syndromal X-linked MR SCAN1
Gene CUL4B TDP1
Intelligence Moderate–severe MR Normal
Brain Relative macrocephaly without overt structural abnormalities Cerebellar atropy
Gait Ataxia, pes cavus, tremor, wasting of lower leg muscles Moderate ataxia, mild muscle weakness
Speech Impaired/non-verbal communication Dysarthria
Others Short stature, gynecomastia, small testes, aggressive outbursts, seizures
CPT sensitivity Cellular sensitivity Cellular sensitivity
Topo I Impaired Topo I degradation Impaired removal of DNA bound Topo I-cleavable complexes
CPT-induced DNA breakage Increased Increased

The Cullin gene family encodes structural subunits for several distinct E3 ubiquitin ligases that have been implicated in diverse processes including nucleotide excision repair (NER), regulating gene expression and controlling DNA replication fork licensing. In mammals, several closely related cullin family proteins exist (CUL1-3, CUL4A, CUL4B, CUL5 and CUL7) (5,6). Mammals possess two distinct Cullin 4 genes (CUL4A and CUL4B). The degree of functional redundancy between their products and whether they operate as distinct E3-ubiquitin ligases is unclear. It had been assumed that CUL4A knockout in mice exhibited embryonic lethality but this has recently been questioned (7,8). A mouse model for CUL4B has not been described.

Most mammalian-based work concerning CUL4 E3 ligases rarely make a definitive functional distinction between CUL4A and CUL4B, although there are exceptions (8,9). Therefore, lymphoblastoid cell lines (LBLs) from patients with CUL4B mutations offer a unique tool to investigate the cellular consequences of CUL4B deficiency specifically and also within a clinically relevant context. We show that these LBLs are in general compromised for CUL4B expression, whereas that of CUL4A remains unaffected. We find increased sensitivity to camptothecin (CPT) in CUL4B-deficient LBLs which is associated with compromised CPT-induced topoisomerase I (Topo I) degradation, increased levels of DNA bound Topo I complexes and increased levels of DNA breaks. This suggests that Topo I turnover can be CUL4B-dependent and that pathogenic mutations in CUL4B in humans are associated with increased DNA breaks following CPT. Furthermore, we find that several known CUL4-E3 targets including Cdt1 and p21 are over-expressed in these CUL4B-mutated patient derived LBLs. Interestingly, following siRNA mediated knockdown of CUL4A and/or CUL4B, we find that CPT sensitivity, CPT-induced Topo I degradation and CPT-induced DNA breakage can be influenced by both cullins. Using siRNA of CUL4A and/or CUL4B, we also show that both cullins can control the levels of Cdt1 and p21.

RESULTS

Mutations in CUL4B result in reduced CUL4B expression in LBLs but normal CUL4A expression

Figure 1A shows the location of the various CUL4B mutations in our patient group (4B-1 to 4B-7), also highlighting their impact on CUL4B protein. Using quantitative reverse–transcription PCR (qRT–PCR) of CUL4B, we find that CUL4B mRNA levels are reduced in most CUL4B-mutated LBLs compared with three unrelated control LBLs (Con 1–3), with the exception of 4B-5 and 4B-7 (Fig. 1B). These latter LBLs are derived from patients with mis-sense CUL4B mutations. Pre-treatment with cycloheximide results in increased CUL4B levels in all CUL4B-mutated LBLs that originally showed reduced transcript levels. This suggests that the CUL4B transcripts from most CUL4B-mutated patients are potentially subject to nonsense mediated decay NMD (Fig. 1B). CUL4A levels, as determined by qRT–PCR, were unchanged between all mutant LBLs and controls (data not shown). Using an antibody that detects both CUL4A and CUL4B proteins (epitope highlighted in Fig. 1A), we find that most CUL4B mutations result in virtually undetectable levels of CUL4B whilst CUL4A protein levels remain normal (Fig. 1C).

Figure 1.

Figure 1.

CUL4B expression is reduced in CUL4B-mutated patient LBLs, whereas CUL4 remains unaffected. (A) Schematic representation of CUL4A and CUL4B including patient-specific CUL4B mutations, where ‘p’ refers to protein and ‘X’ to termination. The characteristic ‘cullin’ super-family domain that identifies this family of E3 structural components is highlighted in the grey box. The common epitope for the anti-CUL4 (C-19) antibody is underlined for CUL4A (residues 235–284) and CUL4B (residues 370–420). (B) qRT–PCR determination of CUL4B-specific transcript levels in the absence of cycloheximide (CHX; black bars) or the presence of CHX (open bars). (C) Western blot analysis of CUL4B and CUL4A expression using whole cell extracts (WCE) from various CUL4B-mutated LBLs. The anti-CUL4 (C-19) antibody detects both CUL4A and CUL4B.

LBLs from CUL4B-mutated patients exhibit increased CPT sensitivity

Topo I is strongly expressed in human Purkinje neurons whose progressive degeneration underlies ataxia telangiectasia (10). Increased Topo I-dependent DNA breakage has been implicated in the pathology of the peripheral neuropathy SCAN1 (spinocerebellar ataxia with axonal neuropathy-1) (11,12). A single mutation in TDP1 (H493R), which encodes tyrosyl-phosphodiesterase, the enzyme that cleaves Topo I from the DNA, is causative of SCAN1 (11) (Table 1, Fig. 2A). The older CUL4B-mutated patients have neurological signs including a gait ataxia, tremor and pes cavus (2–4). CPT toxicity derives from its ability to stabilize Topo I complexes on DNA where it normally functions to introduce single-strand nicks to relieve torsional tension. When CPT-stabilized Topo I complexes collide with replication or transcription forks, they can collapse generating overt DNA double-strand breaks (13) (Fig. 2A). Repair of DNA nicks induced by Topo I involves a partial proteolytic degradation of Topo I prior to optimal functioning of TDP1 (Fig. 2A). In fact, this feature of Topo I action is being exploited clinically whereby the combined use of proteosome inhibitors such as bortezomib (PS-341) with Topo I-directed drugs such as irinotecan seems to enhance tumour killing (14). Indeed, one established mechanism of resistance to CPT is enhanced degradation of Topo I following CPT treatment (15). Interestingly, Cul3 has previously been implicated in Topo I degradation following CPT (16). We therefore investigated the response of the CUL4B-derived patient LBLs to CPT to determine whether impaired Topo I regulation could be a feature of this condition. Interestingly, the CUL4B-mutated LBLs exhibit increased sensitivity to cell killing by CPT (Fig. 2B and C). Consistent with this, siRNA-mediated knockdown of CUL4B in A549 cells also resulted in increased CPT sensitivity (Fig. 2D and E). Interestingly, siRNA-mediated knockdown of CUL4A yielded a similar phenotype.

Figure 2.

Figure 2.

CUL4B-mutated LBLs exhibit increased CPT sensitivity. (A) A schematic illustration of the repair of Topo I-induced DNA nicks and consequences of prolonged/stabilized Topo I–DNA complex formation. Removal of covalently bound Topo I from DNA involves partial degradation to facilitate optimal TDP1-induced Topo I cleavage and consequent resealing of the Topo I-induced DNA nick by the base excision repair machinery. If Topo I complexes inappropriately persist on the DNA, as, for example, following CPT treatment or if Topo I-induced nicks are adjacent to damaged bases/abasic sites, this increases the likelihood of collision with DNA replication (DNA Pol: DNA polymerase) or transcription machinery (RNA Pol: RNA polymerase), thereby potentially converting the Topo I-induced single-strand nick into frank DNA double-strand breaks (DSBs) (shown in grey). (B) LBLs were treated with 10 µm CPT for 48 h before sub-G1 DNA content was determined by FACS. Error bars represent the standard deviation from three separate experiments (P < 0.05; 4B-6 to <0.4; 4B-1 for CPT treated versus WT). (C) LBLs, seeded into 96-well plates (50–103 cell/well), were continually exposed to 2 nM CPT and incubated for up to 4 weeks for colony formation and survival by limiting dilution relative to untreated LBLs. Error bars represent the standard deviation from three separate experiments (CPT treated; 4B-1 P < 0.0001, 4B-3 P < 2×10−5, 4B-6 P < 4×10−5). (D) Unt; untreated, untransfected. Con; control transfected (scrambled siRNA). CUL4A; CUL4A-specific siRNA, CUL4B; CUL4B-specific siRNA. WCEs were examined for expression levels 72 h post-transfection into human lung carcinoma line A549. (E) Con, control transfected (scrambled siRNA); CUL4A, CUL4A-specific siRNA; CUL4B, CUL4B-specific siRNA as in (D). Following siRNA, cells were continually exposed to CPT and seeded for clonogenic survival. Error bars represent the standard deviation from three separate experiments (P < 0.002 for CUL4B CPT 2.5 nm).

LBLS from CUL4B-mutated patients exhibit delayed CPT-induced Topo I degradation and reduced Topo I ubiquitination

The repair of Topo I-induced DNA nicks typically involves a partial proteolytic degradation of Topo I to facilitate optimal TDP1 activity (Fig. 2A). We find here that CPT-induced Topo I degradation is significantly impaired in whole cell extracts from CUL4B-mutated LBLs compared with WT (Fig. 3A). Topo I degradation in this context is dependent on the proteosome as pre-treatment of WT LBLs with MG132 significantly impaired Topo I degradation following CPT (Fig. 3B). Furthermore, we find that degradation of the DNA-bound Topo I fraction is impaired in CUL4B-mutated patient-derived cells following CPT (Fig. 3C). This suggest that CUL4B-dependent E3 activity plays a role in CPT-induced proteosome-mediated Topo I degradation and that a defect in this process is evident in LBLs from patients with CUL4B mutations. Similarly, we find that siRNA knockdown of CUL4B in human cells also results in impaired CPT-induced Topo I degradation (Fig. 3D and E). Interestingly, the siRNA data indicate that both CUL4A and CUL4B can each affect CPT sensitivity and Topo I degradation (Fig. 3D and E).

Figure 3.

Figure 3.

CUL4B-mutated LBLs exhibit impaired CPT-induced Topo I degradation and reduced CPT-induced Topo I ubiquitination. (A) LBLs were treated with 30 µm CPT and WCE analysed for Topo I expression 3 h post-CPT. (B) LBLs were treated as in (A) (−MG132), but for +MG132, WT LBLs were pre-treated with 10 µm MG132 for 2 h. (C) Cells were treated with 25 µM CPT for 3hrs and DNA-bound Topo I fraction was determined following micrococcol nuclease digestions as described (Lin et al., 2008). (D) Unt, untreated, untransfected; Con, control transfected (scrambled siRNA); CUL4A, CUL4A-specific siRNA; CUL4B, CUL4B-specific siRNA; CUL4 A + B, co-transfection of CUL4A and CUL4B-specific siRNAs. WCE examined for expression levels 72 h post-transfection into human osteosarcoma line MG-63. (E) siRNA-mediated knockdown of CUL4A and CUL4B as indicated in MG-63 cells. Unt, untreated; CPT 10 µm for 3 h. Topo I levels were investigated 72 h post-transfection. (F) LBLs were untreated (Unt) treated with CPT (30 µm for 1 h). Topo I was immunoprecipitated using anti-Topo I (H-300) for 3 h. Ubiquitinated Topo I was detected using anti-ubiquitin (P4D1, Cell Signaling).

In support of a role for CUL4B specifically in Topo I degradation, we find decreased levels of immunoprecipitated ubiquitinated-Topo I from CUL4B-mutant LBLs compared with WT following treatment with CPT under conditions that do not result in significant Topo I degradation in WT LBLs (Fig. 3F). We did not find any evidence for a stable interaction between CUL4B and Topo I by reciprocal immunoprecipitation (data not shown). Collectively, our data suggest that CUL4A and/or CUL4B can control Topo I degradation following CPT. Furthermore, Topo I ubiquitination and degradation is impaired in CUL4B-mutant patient-derived LBLs following CPT resulting in more Topo I complexes remaining covalently bound to DNA in these cells, phenotypes that are associated with increased CPT sensitivity of these patient-derived cells.

CUL4B-mutated LBLs exhibit increased levels of CPT-induced DNA breaks

Increased CPT-induced DNA breaks are detectable in SCAN1 patient-derived LBLs by standard COMET assay as they are also impaired in the repair of CPT-induced breaks (12). To investigate the significance of impaired CPT-induced Topo I degradation in CUL4B-mutated LBLs we used a modified version of the alkaline COMET assay involving proteinase K digestion of DNA-bound Topo I complexes, thereby revealing DNA breaks that are otherwise masked by Topo I. Strikingly, we find increased levels of CPT-induced DNA breaks in CUL4B-mutated LBLs, similar to that of SCAN1 LBLs, compared with WT under these conditions (Fig. 4A and B). These results suggest that the impaired CPT-induced ubiquitination and delayed CPT-induced degradation of Topo I seen in the CUL4B-mutated LBLs can result in increased levels of DNA breakage. Interestingly, pre-treatment with the proteosomal inhibitor MG132 does not significantly enhance CPT-induced mean COMET tail moment in CUL4B-mutated LBLs under these conditions, unlike WT, suggesting that CUL4B activity plays a major role in reducing CPT-induced DNA breakage in these cells (Fig. 4C). Independent knockdown of CUL4B in A549 cells also results in increased CPT-induced DNA breakage using this modified COMET assay further reinforcing a role for CUL4B in preventing CPT-induced DNA damage (Fig. 4D). Knockdown of CUL4A again also resulted in a similar phenotype to that observed for CUL4B knockdown (Fig. 4D).

Figure 4.

Figure 4.

CUL4B-mutated LBLs exhibit increased levels of DNA breakage following CPT treatment. (A) LBLs were treated with 14 µm CPT for 1 h and subject to modified COMET analysis. The tail moment for 100 cells is shown for WT and 4B-2 LBLs. The dashed line indicates the maximum range of tail moments observed in WT LBLs. (B) Plot of the mean COMET tail moment from 100 different cells either untreated (Unt) or following CPT treatment (CPT) as described in (A) for WT, CUL4B-mutated (4B-1, 4B-2, 4B3) and TDP1-mutated SCAN1 LBLs. Error bars represent the standard deviation from four separate experiments (4B-1 P < 0.02, 4B-2 P < 0.007, 4B-6 P < 0.02). (C) Plot of the mean COMET tail moment from 100 different cells either untreated (Unt), CPT treated (CPT) or pre-treated with 50 µm MG132 for 1 h prior to CPT treatment (14 µm for 1 h). The MG132 was not removed during the course of this experiment. (D) Plot of mean COMET tail moment from 100 cells following knockdown of CUL4A and CUL4B in A549 cells. Knockdown was carried out as in Figure 2D and COMET as in (A) (CUL4A P < 0.04., CUL4B P < 0.1).

To further characterize the impact of defective CUL4-dependent function in the CUL4B-mutated patient-derived LBLs, we investigated the expression of several known CUL4-dependent substrates in these cells. Furthermore, using siRNA of CUL4A and CUL4B, we sought to examine the functional overlap between both cullins in regulating these substrates.

CS-B is degraded normally following UV irradiation in CUL4B LBLs

Mutations in two components of known CUL4-containing E3s are causative of the human NER deficiency conditions Cockayne syndrome (CS) (complementation group A; CUL4-Ddb1CS-A) and Xeroderma pigmentosum (XP) (complementation group E; CUL4-Ddb1Ddb2). A characteristic feature of human NER-deficiency syndromes is overt hypersensitivity to sunlight and in the case of XP, dramatically increased levels of carcinoma on sun exposed areas of the body. Interestingly, none of these clinical features are apparent in individuals with a CUL4B mutation (2). This suggests that CUL4B deficiency in these patients probably does not have a major impact on NER proficiency at the clinical level, possibly due to functional compensation by CUL4A activity in these patients (8). To investigate this, we monitored degradation of CS-B following UV which occurs normally in a programmed manner during transcription-coupled NER via CUL4-Ddb1CS-A (17–19). We find that CS-B is degraded normally following UV irradiation of CUL4B-mutated LBLs further suggestive of grossly functional NER in these patients (Fig. 5A). In support of this, Liu et al. (8) have recently shown that CUL4B siRNA-mediated knockdown in mouse embryonic fibroblasts does not affect the global NER of 6-4-pyrimidine-pyrimidone or cyclobutane pyrimidine dimers.

Figure 5.

Figure 5.

CUL4B-mutated LBLs over-express Cdt1. (A) UV-induced degradation of CS-B occurs normally in 4B-2 LBLs. Cells were irradiated at 25 J/m2 and CS-B levels determined 4 h post-UV. (B) Cdt1 is over-expressed in 4B-2 LBLs compared with WT 24 h post-nocodazole (0.1 µm) and cytochalasin B (1.5 µg/ml), whereas levels of Cdc6 and Geminin are unaffected (C) LBLs were blocked at G1-S using a double thymidine block. At time 0, Cdt1 (lower band) is detectable in both WT and 4B-2 LBLs. The upper band is a non-specific cross-reactant that serves as a loading control. Left-hand panel: upon release from the block into normal untreated medium (Unt), Cdt1 is mostly degraded after 1 h in the WT distinct to 4B-2 LBLs. Right-hand panels: upon release from the thymdine block into Camptothecin containing medium (CPT; 10 µm), again Cdt1 is degraded rapidly in the WT distinct to 4B-2 LBLs. (D) MG63 cells as Con; control transfected (scrambled siRNA). CUL4A, CUL4A-specific siRNA; CUL4B, CUL4B-specific siRNA; CUL4 A + B, co-transfection of CulA and CUL4B-specific siRNAs; Geminin, Geminin-specific siRNA. WCE examined for expression levels 72 h post-transfection.

Cdt1 expression is mis-regulated in CUL4B LBLs

The replication licensing factor Cdt1 was one of the first CUL4-dependent substrates identified (20,21). Cdt1 protein levels are extremely tightly regulated during the cell cycle by at least two distinct ubiquitin ligase systems, CUL4-DDB1Cdt2 and SCFSkp2 (22,23). Once Cdt1 has licensed DNA replication origins, it is rapidly degraded to prevent origin re-firing (23,24). In Caenorhabditis elegans, which only has a single CUL4 gene, siRNA-mediated knockout of CUL4 resulted in increased levels of CDT1 and consequently dramatically elevated levels of re-replication (20). We find Cdt1 inappropriately over-expressed in CUL4B-mutated LBLs, whereas levels of another origin licensing factor, Cdc6, remain unaffected (Fig. 5B). Similarly, levels of Geminin, the Cdt1 inhibitor, were unaffected in CUL4B-mutatated patient-derived LBLs (Fig. 5B). Over-expression of Cdt1 did not, however, result in a skewed cell cycle (Supplementary Material, Fig. S1A). Furthermore, Cdt1 over-expression in CUL4B-mutated LBLs was not simply a consequence of an increased number of cells in G1 (Supplementary Material, Fig. S1A).

To maximize the amount of Cdt1 detectable in WT LBLs we used double thymidine block to arrest cells at the G1-S boundary. WT LBLs released from this block show rapid decrease in Cdt1 levels unlike the CUL4B-mutated LBL, 4B-2 (Fig. 5C; Unt, untreated). Cdt1 has also been shown to be rapidly degraded following DNA damage (21,25–27). We find that CUL4B-mutated LBLs, unlike WT, are delayed in their ability to degrade Cdt1 following release from G1-S block into CPT, which can induce DNA breakage during S-phase (Fig. 5C; CPT, camptothecin treated). In WT LBLs, 1 h post-treatment with CPT, Cdt1 levels are virtually undetectable. In contrast, residual Cdt1 is evident in 4B-2 LBLs even 3hrs post CPT treatment (Fig. 5C).

Similar to CUL4B-mutant LBLs, siRNA-mediated knockdown of CUL4B specifically can also recapitulate Cdt1 over-expression (Fig. 5D). Consistent with previous findings, Geminin siRNA induces Cdt1 over-expression. We also found that CUL4A-specific siRNA results in increased Cdt1 expression in these cells (Fig. 4D).

CUL4B-mutated LBLs do not exhibit re-replication but over-express p21 and p27

Despite increased levels of Cdt1 in CUL4B-mutated LBLs, we did not detect any evidence of re-replication as indicated by increased levels of bromodeoxyuridine (BrdU) positive cells with >4N DNA content (Fig. 6A and B; Unt, untreated). Furthermore, while treatment with CPT resulted in a clear reduction in S-phase content in both WT and CUL4B-mutant LBLs indicative of a functional intra-S-phase arrest, no CPT-induced re-replication was detectable (Fig. 6C; CPT, CPT treated). Similarly, treatment of LBLs with nocodazole to block the cell cycle in mitosis did not reveal a significant increase in BrdU positive cells with >4N DNA content (Supplementary Material, Fig. 1B).

Figure 6.

Figure 6.

CUL4B-mutated LBLs do not exhibit elevated levels of re-replication but over-express p21 and p27. (A) BrdU-FACS using WT LBLs. Re-replication in this assay is indicated by an increase in BrdU staining cells with >4N DNA content (dashed box). Treatment of WT LBLs with cytochalasin B (1.5 µg/ml for 24 h) results in an increase in BrdU staining cells with >4N DNA content (dashed box). (B) Spontaneous re-replication is not detected in untreated exponentially growing 4B-2 LBLs (dashed box). (C) WT and 4B-2 LBLs were treated with CPT (10 µm for 3 h) prior to BrdU labelling and FACS. CPT did not induce re-replication in either LBL. (D) Multiple CUL4B LBLs show elevated endogenous expression of p21 and p27 compared with WT LBLs. (E) siRNA-mediated knockdown of CUL4A and CUL4B expression in hTERT-immortalized human skin fibroblasts from a normal individual. Con, control transfected (scrambled siRNA); CUL4A, CUL4A-specific siRNA; CUL4B, CUL4B-specific siRNA; CUL4 A + B, co-transfection of CulA and CUL4B-specific siRNAs. WCE examined for expression levels 72 h post-transfection. (F) siRNA-mediated knockdown of CUL4A and CUL4B expression in hTERT-immortalized normal human skin fibroblasts results in increased endogenous levels of p21. Labels as in (E).

Extensive spontaneous uncoordinated re-replication is incompatible with viability in mammals (28). The failure to detect extensive re-replication here, despite inappropriate Cdt1 over-expression, is probably not surprising since these cells are derived from viable individuals. Nevertheless, it does suggest that these cells have somehow adapted to limit any adverse impact of Cdt1 over-expression using a mechanism that does not involve altering the levels of either Geminin or Cdc6 (Fig. 5B). One established means to limit inappropriate DNA replication licensing is via a corresponding increase in expression of cyclin-dependent kinase inhibitors, thereby limiting the ability of Cdk's to drive the cell cycle (23,29,30). Both p21 and p27 levels have been reported to be influenced by Cullin-containing E3 activity (31–34). Indeed, p21 is a direct substrate of a CUL4-containing E3 ligase (35–37). In fact, siRNA-mediated simultaneous knockdown of both CUL4A and CUL4B has been shown to increase expression of p21 in the absence of exogenously applied DNA damage (35). We therefore investigated whether expression of these CDK inhibitors were indeed mis-regulated and found a dramatic increase in endogenous levels of p21, and in most cases also that of p27 in the CUL4B-mutated LBLs (Fig. 6D).

To investigate the overlap between CUL4A and CUL4B in influencing expression levels of p21 we used siRNA of CUL4A and/or CUL4B in hTERT-immortalized human skin fibroblasts from a clinically normal individual as these cells retain a functional p53–p21 axis (Fig. 6E). We find that siRNA of either CUL4A or CUL4B can result in increased p21 expression suggesting that both cullins can influence the levels of this known CUL4 substrate, similar to our siRNA results regarding Topo I and Cdt1 (Figs 3E and 5D). This suggests that both CUL4A and CUL4B can epistatically function in controlling the expression of the proteins examined here.

DISCUSSION

Our findings identify novel cellular consequences of CUL4B deficiency in human patient-derived cells including increased CPT-induced toxicity, impaired CPT-induced Topo I degradation and increased Topo I-mediated DNA breakage. These cellular features may potentially underlie some of the clinical phenotypes associated with CUL4B mutations in humans and provide a basis for future studies with respect to understanding their underlying aetiology. For example, patients with CUL4B mutations exhibit MR, tremor and clinical evidence of a peripheral neuropathy, and it is tempting to speculate that a failure to regulate Topo I may underlie these clinical features (2,4). In fact, prolonged treatment of cancer patients with Topo I inhibitors such as irinotecan is associated with a peripheral neuropathy suggesting alterations in Topo I function can impact on neuronal capacity in humans (38,39). Precedent for an impaired ability to respond to Topo I-induced DNA damage being associated with a congenital human disorder is provided by SCAN1, which is characterised by a peripheral neuropathy and cerebellar degeneration (11) (Table 1). A direct role for impaired Topo I degradation in MR is unclear, although provocatively, Topo I has previously been implicated in neuronal excitation (39).

Liu et al. have recently described a viable CUL4A knockout mouse suggesting that the previously reported embryonic CUL4A knockout-induced lethality in mice was an indirect consequence of an unanticipated down-regulation of an essential adjacent gene (7,8). Interestingly, this viable CUL4A knockout animal does not exhibit any overt developmental abnormalities over the course of its lifetime, and the authors have suggested that functional redundancy with CUL4B may be responsible for this (8). However, others have provided convincing evidence for a role for CUL4A in maintaining genomic stability in mouse cells (40). In our study, using human material, we find that knockdown of CUL4A (similar to CUL4B) appears to reproduce all of the cellular phenotypes we have uncovered using our CUL4B-mutated patient-derived LBLs. This suggests, at least for the cellular phenotypes described here, that CUL4A and CUL4B exhibit significant epistatic functional overlap, and importantly, that mutations in CUL4B alone can result in cellular phenotypes. It will be interesting to find out if mutations in CUL4A are associated with (an as-yet undescribed) human disorder with clinical overlap to that of CUL4B-mutated syndromal MR. Nevertheless, there is evidence for CUL4B-specific E3 ubiquitin ligases that when defective could also potentially contribute to the CUL4B-mutated patient phenotype. For example, a novel CUL4B-specific containing E3 ligase has recently been described involving the aryl hydrocarbon receptor that functions in the regulation of androgen and oestrogen steroid sex hormone receptor turnover (9). Interestingly, CUL4B-mutated patients exhibit clinical evidence potentially consistent with abnormal androgen–oestrogen axis including small testes and gynecomastia. Regarding the origin of MR in these patients, we know that specific cullin-containing E3s are already implicated in the regulated degradation of neuronal-specific proteins (41). For example, NMDA receptor subunit NR1 is degraded by SCFFbx2 and degradation of the glutamate receptor clustering promoting factor KEL-8 occurs via a Cullin 3-containing SCF (42,43). It is possible, though entirely speculative, that there also exists neuronal-specific protein(s) whose degradation occurs via as-yet undescribed CUL4B-specific containing E3(s), which when mis-regulated could impair proper neuronal function.

Considering the established role of CUL4-dependent E3 activity during NER, it is somewhat surprising that CUL4B-mutations in humans result in a syndromal MR condition and not an XP/CS-like disorder. We find that CS-B is degraded normally following UV irradiation in CUL4B-mutated patient-derived LBLs, suggesting that deficiency of CUL4B function alone, in this context (i.e. along with normal CUL4A expression), is unlikely to significantly impact upon NER proficiency. This may explain why CUL4B-mutated patients do not overtly clinically resemble XP/CS and is consistent with recent findings in a knockout mouse model for CUL4A (8).

We show that CUL4B-mutated patient-derived LBLs are also characterized by increased expression of Cdt1, a known CUL4-dependent substrate. Forced over-expression of Cdt1 in human cells can result in significant chromosome breakage and activation of the DNA damage response (DDR) (44). However, we did not detect karyotypic abnormalities, chromosomal breakage or increased endogenous levels of phospho-Chk1 (Ser 317) or phospho-Chk2 (Thr 68) suggestive of chronic activation of the DDR in CUL4B-mutated LBLs (data not shown). Furthermore, both DNA damage-induced G2-M (Supplementary Material, Fig. S1C) and nocodazole-induced spindle checkpoint activation (data not shown) appear to be normal in CUL4B-mutated LBLs. Increased Cdt1 expression in CUL4B-mutated LBLs is not associated with extensive re-replication. Consistent with this, we observe over-expression of the CDK inhibitors p21 and p27 in these cells. Interestingly, no increased incidence in malignancy was observed in patients with mutations in CUL4B (2). In summary, using a combination of cells with germline mutations in CUL4B and siRNA we find that Topo I, Cdt1 and p21 levels can be affected by CUL4A and CUL4B. This is consistent with a model whereby CUL4A and CUL4B can function epistatically in regulating these proteins.

Copy number variation (CNV) of CUL4A (13q34) or CUL4B (Xq23) does not appear, as yet, to be associated with any clinical phenotype according to DECIPHER (DatabasE of Chromosomal Imbalance and Phenotype in Humans using Emsembl Resources), although short insertion–deletion ‘benign’ CNV's incorporating CUL4A (13q34) are reported in DGV (Database of Genomic Variation). But, Tarpey et al. (2) found eight families with distinct CUL4B mutations representing 3% out of the 250 families from whom their X-chromosomes were sequenced. This suggests that CUL4B dysfunction (by mutation) may be one of the more frequent causes of X-linked syndromal MR.

In conclusion, our findings identify novel cellular consequences of CUL4B-deficiency in human patient-derived cells such as CPT sensitivity, impaired CPT-induced Topo I degradation and increased Topo I-mediated DNA breakage. Understanding the mechanism of defective CUL4B-mediated MR and how defects in this protein also result in other clinical features such as growth retardation and peripheral neuropathy represents important future challenges.

MATERIALS AND METHODS

Cell culture

LBLs were cultured in RPMI with 15% fetal calf serum (FCS). CUL4B LBLs used were 4B-1 (family 307), 4-B2 (family 310), 4B-3 (family 42), 4B-4 (family 43), 4B-5 (family 180), 4B-6 (family 329) and 4B-7 (family 432). SCAN1 LBLs (JRL1) are from a SCAN1 patient with the H493R mutation in TDP1 as described previously (11,12). MG-63 and 1BR-hTERT control cells were grown in MEM containing 10% FCS, whereas A549 was grown in Ham's F12 with 10% FCS.

Knockdowns

siCUL4A: UAUCUAGUGAGUCUUCUCUAAACGG; siCUL4B: AAGCCUAAAUUACCAGAAATT; siGeminin: UUUGAUUCCAGAGUUGGCATT. Transfections were performed with 50 nm of siRNA using Metafectene Pro (Biontex). We also confirmed knockdown phenotypes using direct transfection of shRNA-pSM2 system from Open Biosystems for CUL4A (hairpin V2HS_32526) and CUL4B (hairpin V2HS_32514).

CPT sensitivity

Clonogenic survival to continuous exposure to CPT was performed 72 h post-siRNA mediated knockdown of CUL4A and CUL4B. Colonies were stained with Methylene blue after 2 weeks. For LBLs, CPT survival was determined by colony formation in 96-well plates by limiting dilution. Briefly, cells were exposed continuously to 2 nm CPT and seeded into 96-well plates at 50–103 cells/well. Plates were incubated for up to 4 weeks and positive colonies scored by light microscopy. P-values were calculated using Student's t-test.

Quantitative RT–PCR

LBLs were treated with/without 100 µg/ml cycloheximide for 6 h and RNA extracted using the RNAeasy mini kit (Qiagen). One microgram of total RNA was used as a template for oligo-dT-primed reverse-transcription using Superscript II (Invitrogen). Expression levels for CUL4A and CUL4B were normalized against β-2-microglobulin levels using the relative standard curve method.

  • CUL4A: TaqMan Gene Expression Assay Hs00757716_m1 (Applied Biosystems)

  • CUL4B: TaqMan Gene Expression Assay Hs00186086_m1 (Applied Biosystems)

  • β2M: hβ2MF 5′-TGCTCGCGCTACTCTCTCT-3′

  • hβ2MR 5′-TCCATTCTCTGCTGGATGAC-4′

  • hβ2MProbe 5′–6′-Fam-CTGGAGGCTATCCAGCGTACTCCAA-TAMRA-3′

Each reaction contained 1/256 cDNA template, 1× FastStart TaqMan® Probe Master (Roche Applied Science) and either 1× TaqMan gene expression assay or 300 nm each primer and 200 nm TaqMan probe. Reactions were performed in a 20 µl total volume using a 7900HT Real-time PCR system (Applied Biosystems) with 10 minutes at 95°C, then 40 cycles of 95°C/15 s followed by 60°C/1 min. Three separate quantification experiments were performed, each with duplicate reactions for each data point.

Flow cytometry

LBLs were fixed in ice-cold 70% ethanol for 24 h and re-suspended in PBS containing 0.5% Tween-20, 10 µg/ml propidium iodide and 500 µg/ml RNaseA. Data were collected using a Becton Dickinson FACS Calibur machine and were analysed with CellQuest software. For BrdU incorporation cells were labelled with 50 µM BrdU for 15 min. Incorporated BrdU was detected using FITC-conjugated anti-BrdU antibody (Becton-Dickson).

Cell lysis

Cells were lysed in IP buffer [50 mm Tris–HCl at pH 7.5, 150 mm NaCl, 2 mm EDTA, 2 mm EGTA, 25 mm NaF, 25 mm b-glycerolphoshate, 0.1 mm sodium orthovanadate, 0.2% Triton X-100, 0.3% IPEGAL and protease inhibitor cocktail (Roche Applied Science)] for 1 h on ice. For Topo I analysis, cells were harvested in 2× SDS–PAGE sample buffer and sonicated. The isolation of Topo I–DNA complexes has been described previously (45).

Antibodies

CUL4 (C-19), Cdc6 (180.2), Cdt1 (H-300), Geminin (FL-209) and β-Tubulin (H-235) were from Santa Cruz. Anti-p21 Waf1/Cip1 (12D1) were from Cell Signaling Technology. Anti-CSB/ERCC6 and 53BP1 were from Bethyl Laboratories. Anti-p27 (CDKN1B) (4B4-E6) were from Autogen Bioclear and anti-Topo I (ab3825) from Abcam.

Topo I ubiquitination

LBLs were treated with 30 µm CPT for 1 h and lysed in IP buffer for 30 min on ice followed by sonication. Three hundred micrograms of extract was incubated with 4 µg of anti-TOPO1 (H-300, Santa Cruz) for 3 h followed by incubation with 50 µl protein G Sepharose, Fast Flow (Sigma) overnight at 4°C. Beads were washed three times with IP buffer and bound proteins were released by the addition of 2× sample buffer. Proteins were separated on a 6% SDS–PAGE gel, blotted onto a PVDF and probed for Topo I (ab3825). The membrane was treated with 6 m guanidium-HCl for 45 min and re-probed with anti-ubiquitin (P4D1, Cell Signaling).

Treatments and cell cycle block

UV irradiation was carried out using a UV-C source (0.6 J/m2/s). Gamma irradiation was performed using a 137Cs γ-ray source at a dose rate of 7.5 Gy/min. For the G2 checkpoint assay, cells were irradiated with 7 J/m2 UV-C in PBS or 3 Gy IR and immediately seeded into complete medium supplemented with 0.2 µg/ml colcemid for 4 h. Cells were swollen with 75 mm KCl for 10 min and then with Carnoys solution before counterstaining with DAPI. Double thymidine block was performed as previously described (46).

COMET assay

CPT-induced DNA breaks were determined by alkaline COMET as described in (12) with modification involving treatment with 400 µg/ml Proteinase K for 2 h at 37°C then incubation in alkaline electrophoresis buffer (pH 12.6) for 1 h at 4°C. This modified COMET assay will be characterized in detail elsewhere (El-Khamisy, manuscript in preparation).

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

FUNDING

F.L.R.'s group is supported by Action Medical Research and NIHR, C.E.S.'s group by NICHD (HD26202) and the South Carolina Department of Disabilities and Special Needs (SCDDSN) and S.E.K. by the Wellcome Trust (085384). M.O.D. is a CRUK Senior Cancer Research Fellow whose group is supported by Cancer Research UK (CRUK) and UK Medical Research Council.

Supplementary Material

[Supplementary Data]
ddq008_index.html (825B, html)

ACKNOWLEDGEMENTS

Thanks to AR Lehman and AM Carr for critical reading of the manuscript and to KW Caldecott for very helpful discussions regarding practicalities of CPT-induced Topo I turnover. Thanks also to G McGraw at Santa Cruz for epitope information concerning CUL4 antibodies.

Conflict of Interest statement. None declared.

REFERENCES

  • 1.Ciechanover A., Brundin P. The ubiquitin–proteasome system in neurodegenerative diseases: sometimes the chicken, sometimes the egg. Neuron. 2003;40:427–446. doi: 10.1016/s0896-6273(03)00606-8. [DOI] [PubMed] [Google Scholar]
  • 2.Tarpey P.S., Raymond F.L., O'Meara S., Edkins S., Teague J., Butler A., Dicks E., Stevens C., Tofts C., Avis T., et al. Mutations in CUL4B, which encodes a ubiquitin E3 ligase subunit, cause an X-linked mental retardation syndrome associated with aggressive outbursts, seizures, relative macrocephaly, central obesity, hypogonadism, pes cavus, and tremor. Am. J. Hum. Genet. 2007;80:345–352. doi: 10.1086/511134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cabezas D.A., Slaugh R., Abidi F., Arena J.F., Stevenson R.E., Schwartz C.E., Lubs H.A. A new X linked mental retardation (XLMR) syndrome with short stature, small testes, muscle wasting, and tremor localises to Xq24-q25. J. Med. Genet. 2000;37:663–668. doi: 10.1136/jmg.37.9.663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zou Y., Liu Q., Chen B., Zhang X., Guo C., Zhou H., Li J., Gao G., Guo Y., Yan C., et al. Mutation in CUL4B, which encodes a member of Cullin–RING ubiquitin ligase complex, causes X-linked mental retardation. Am. J. Hum. Genet. 2007;80:561–566. doi: 10.1086/512489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.O'Connell B.C., Harper J.W. Ubiquitin–proteasome system (UPS): what can chromatin do for you? Curr. Opin. Cell Biol. 2007;19:206–214. doi: 10.1016/j.ceb.2007.02.014. [DOI] [PubMed] [Google Scholar]
  • 6.Petroski M.D., Deshaies R.J. Function and regulation of cullin–RING ubiquitin ligases. Nat. Rev. Mol. Cell Biol. 2005;6:9–20. doi: 10.1038/nrm1547. [DOI] [PubMed] [Google Scholar]
  • 7.Li B., Ruiz J.C., Chun K.T. CUL-4A is critical for early embryonic development. Mol. Cell. Biol. 2002;22:4997–5005. doi: 10.1128/MCB.22.14.4997-5005.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liu L., Lee S., Zhang J., Peters S.B., Hannah J., Zhang Y., Yin Y., Koff A., Ma L., Zhou P. CUL4A abrogation augments DNA damage response and protection against skin carcinogenesis. Mol. Cell. 2009;34:451–460. doi: 10.1016/j.molcel.2009.04.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ohtake F., Baba A., Takada I., Okada M., Iwasaki K., Miki H., Takahashi S., Kouzmenko A., Nohara K., Chiba T., et al. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature. 2007;446:562–566. doi: 10.1038/nature05683. [DOI] [PubMed] [Google Scholar]
  • 10.Gorodetsky E., Calkins S., Ahn J., Brooks P.J. ATM, the Mre11/Rad50/Nbs1 complex, and topoisomerase I are concentrated in the nucleus of Purkinje neurons in the juvenile human brain. DNA Repair. 2007;6:1698–1707. doi: 10.1016/j.dnarep.2007.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Takashima H., Boerkoel C.F., John J., Saifi G.M., Salih M.A.M., Armstrong D., Mao Y., Quiocho F.A., Roa B.B., Nakagawa M., et al. Mutation of TDP1, encoding a topoisomerase I-dependent DNA damage repair enzyme, in spinocerebellar ataxia with axonal neuropathy. Nat. Genet. 2002;32:267–272. doi: 10.1038/ng987. [DOI] [PubMed] [Google Scholar]
  • 12.El-Khamisy S.F., Saifi G.M., Weinfeld M., Johansson F., Helleday T., Lupski J.R., Caldecott K.W. Defective DNA single-strand break repair in spinocerebellar ataxia with axonal neuropathy-1. Nature. 2005;434:108–113. doi: 10.1038/nature03314. [DOI] [PubMed] [Google Scholar]
  • 13.Pourquier P., Pommier Y. Topoisomerase I-mediated DNA damage. Adv. Cancer Res. 2001;80:189–216. doi: 10.1016/s0065-230x(01)80016-6. [DOI] [PubMed] [Google Scholar]
  • 14.Lenz J. Clinical update: proteasome inhibitors in solid tumors. Cancer Treat. Rev. 2003;29:41–48. doi: 10.1016/s0305-7372(03)00082-3. [DOI] [PubMed] [Google Scholar]
  • 15.Desai S.D., Li T.-K., Rodriguez-Bauman A., Rubin E.H., Liu L.F. Ubiquitin/26S proteasome-mediated degradation of topoisomerase I as a resistance mechanism to camptothecin in tumor cells. Cancer Res. 2001;61:5926–5932. [PubMed] [Google Scholar]
  • 16.Zhang H.-F., Tomida A., Koshimizu R., Ogiso Y., Lei S., Tsuruo T. Cullin 3 promotes proteasomal degradation of the topoisomerase I–DNA covalent complex. Cancer Res. 2004;64:1114–1121. doi: 10.1158/0008-5472.can-03-2858. [DOI] [PubMed] [Google Scholar]
  • 17.Groisman R., Polanowska J., Kuraoka I., Sawada J.i., Saijo M., Drapkin R., Kisselev A.F., Tanaka K., Nakatani Y. The ubiquitin ligase activity in the DDB2 and CSA complexes is differentially regulated by the COP9 signalosome in response to DNA damage. Cell. 2003;113:357–367. doi: 10.1016/s0092-8674(03)00316-7. [DOI] [PubMed] [Google Scholar]
  • 18.El-Mahdy M.A., Zhu Q., Wang Q.e., Wani G., Praetorius-Ibba M., Wani A.A. Cullin 4A-mediated proteolysis of DDB2 protein at DNA damage sites regulates in vivo lesion recognition by XPC. jbc.M511834200. J Biol Chem. 2006;281:13404–13411. doi: 10.1074/jbc.M511834200. [DOI] [PubMed] [Google Scholar]
  • 19.Fousteri M., Mullenders L.H.F. Transcription-coupled nucleotide excision repair in mammalian cells: molecular mechanisms and biological effects. Cell Res. 2008;18:73–84. doi: 10.1038/cr.2008.6. [DOI] [PubMed] [Google Scholar]
  • 20.Zhong W., Feng H., Santiago F.E., Kipreos E.T. CUL-4 ubiquitin ligase maintains genome stability by restraining DNA-replication licensing. Nature Cell Biology. 2003;423:885–889. doi: 10.1038/nature01747. [DOI] [PubMed] [Google Scholar]
  • 21.Higa L.A.A., Mihaylov I.S., Banks D.P., Zheng J., Zhang H. Radiation-mediated proteolysis of CDT1 by CUL4-ROC1 and CSN complexes constitutes a new checkpoint. Nature Cell Biology. 2003;5:1008–1015. doi: 10.1038/ncb1061. [DOI] [PubMed] [Google Scholar]
  • 22.Nishitani H., Sugimoto N., Roukos V., Nakanishi Y., Saijo M., Obuse C., Tsurimoto T., Nakayama K.I., Nakayama K., Fujita M., et al. Two E3 ubiquitin ligases, SCF-Skp2 and DDB1-Cul4, target human Cdt1 for proteolysis. EMBO J. 2006;25:1126–1136. doi: 10.1038/sj.emboj.7601002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fujita M. Cdt1 revisited: complex and tight regulation during the cell cycle and consequences of deregulation in mammalian cells. Cell Division. 2006;1:22. doi: 10.1186/1747-1028-1-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Blow J.J., Dutta A. Preventing re-replication of chromosomal DNA. Nat. Rev. Mol. Cell Biol. 2005;6:476–486. doi: 10.1038/nrm1663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jin J., Arias E.E., Chen J., Harper J.W., Walter J.C. A family of diverse Cul4-Ddb1-interacting proteins includes Cdt2, which is required for S phase destruction of the replication factor Cdt1. Mol. Cell. 2006;23:709–721. doi: 10.1016/j.molcel.2006.08.010. [DOI] [PubMed] [Google Scholar]
  • 26.Hu J., McCall C.M., Ohta T., Xiong Y. Targeted ubiquitination of CDT1 by the DDB1-CUL4A-ROC1 ligase in response to DNA damage. Nat. Cell Biol. 2004;6:1003–1009. doi: 10.1038/ncb1172. [DOI] [PubMed] [Google Scholar]
  • 27.Lovejoy C.A., Lock K., Yenamandra A., Cortez D. DDB1 maintains genome integrity through regulation of Cdt1. Mol. Cell. Biol. 2006;26:7977–7990. doi: 10.1128/MCB.00819-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang X., Zou L., Zheng H., Wei Q., Elledge S.J., Li L. Genomic instability and endoreduplication triggered by RAD17 deletion. Genes Dev. 2003;17:965–970. doi: 10.1101/gad.1065103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Porter A. Preventing DNA over-replication: a Cdk perspective. Cell Division. 2008;3:3. doi: 10.1186/1747-1028-3-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu E., Li X., Yan F., Zhao Q., Wu X. Cyclin-dependent kinases phosphorylate human Cdt1 and induce its degradation. J. Biol. Chem. 2004;279:17283–17288. doi: 10.1074/jbc.C300549200. [DOI] [PubMed] [Google Scholar]
  • 31.Yu Z.-K., Gervais J.L.M., Zhang H. Human CUL-1 associates with the SKP1/SKP2 complex and regulates p21CIP1/WAF1 and cyclin D proteins. Proc. Natl Acad. Sci. USA. 1998;95:11324–11329. doi: 10.1073/pnas.95.19.11324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang W., Nacusi L., Sheaff R.J., Liu X. Ubiquitination of p21Cip1/WAF1 by SCFSkp2: substrate requirement and ubiquitination site selection&#x2020. Biochemistry. 2005;44:14553–14564. doi: 10.1021/bi051071j. [DOI] [PubMed] [Google Scholar]
  • 33.Higa L.A., Yang X., Zheng J., Banks D., Wu M., Ghosh P., Sun H., Zhang H. Involvement of CUL4 ubiquitin E3 ligases in regulating CDK inhibitors Dacapo/p27Kip1 and cyclin E degradation. Cell Cycle. 2006;5:71–77. doi: 10.4161/cc.5.1.2266. [DOI] [PubMed] [Google Scholar]
  • 34.Li B., Jia N., Kapur R., Chun K.T. Cul4A targets p27 for degradation and regulates proliferation, cell cycle exit, and differentiation during erythropoiesis. Blood. 2006;107:4291–4299. doi: 10.1182/blood-2005-08-3349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Abbas T., Sivaprasad U., Terai K., Amador V., Pagano M., Dutta A. PCNA-dependent regulation of p21 ubiquitylation and degradation via the CRL4Cdt2 ubiquitin ligase complex. Genes Dev. 2008;22:2496–2506. doi: 10.1101/gad.1676108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kim Y., Starostina N.G., Kipreos E. The CRL4Cdt2 ubiquitin ligase targets the degradation of p21Cip1 to control replication licensing. Genes Dev. 2008;22:2507–2519. doi: 10.1101/gad.1703708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Nishitani H., Shiomi Y., Iida H., Michishita M., Takami T., Tsurimoto T. CDK inhibitor p21 is degraded by a proliferating cell nuclear antigen-coupled Cul4–DDB1Cdt2 pathway during S phase and after UV irradiation. J. Biol. Chem. 2008;283:29045–29052. doi: 10.1074/jbc.M806045200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Morris E.J., Geller H.M. Induction of neuronal apoptosis by camptothecin, an inhibitor of DNA topoisomerase-I: evidence for cell cycle-independent toxicity. J. Cell Biol. 1996;134:757–770. doi: 10.1083/jcb.134.3.757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Plaschkes I., Silverman F.W., Priel E. DNA topoisomerase I in the mouse central nervous system: age and sex dependence. J. Compar. Neurol. 2005;493:357–369. doi: 10.1002/cne.20793. [DOI] [PubMed] [Google Scholar]
  • 40.Kopanja D., Stoyanova T., Okur M.N., Huang E., Bagchi S., Raychaudhuri P. Proliferation defects and genome instability in cells lacking Cul4A. Oncogene. 2009;28:2456–2465. doi: 10.1038/onc.2009.86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Yi J.J., Ehlers M.D. Emerging roles for ubiquitin and protein degradation in neuronal function. Pharmacol. Rev. 2007;59:14–39. doi: 10.1124/pr.59.1.4. [DOI] [PubMed] [Google Scholar]
  • 42.Kato A., Rouach N., Nicoll R.A., Bredt D.S. Activity-dependent NMDA receptor degradation mediated by retrotranslocation and ubiquitination. Proc. Natl Acad. Sci. USA. 2005;102:5600–5605. doi: 10.1073/pnas.0501769102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Schaefer H., Rongo C. KEL-8 is a substrate receptor for CUL3-dependent ubiquitin ligase that regulates synaptic glutamate receptor turnover. Mol. Biol. Cell. 2006;17:1250–1260. doi: 10.1091/mbc.E05-08-0794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Tatsumi Y., Sugimoto N., Yugawa T., Narisawa-Saito M., Kiyono T., Fujita M. Deregulation of Cdt1 induces chromosomal damage without rereplication and leads to chromosomal instability. J. Cell Sci. 2006;119:3128–3140. doi: 10.1242/jcs.03031. [DOI] [PubMed] [Google Scholar]
  • 45.Lin C.P., Bar Y., Lyu Y.L., Desai S.D., Liu L.F. A ubiquitin-proteasome pathway for the repair of topoisomerase I-DNA covalent complexes. J. Biol. Chem. 2008;283:21074–21083. doi: 10.1074/jbc.M803493200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Aldertn G.K., Joerje H., Vason R., Borglum A.D., Jeggo P.A., D'Driscoll M. Seckel syndrome exhibits cellular features demonstrating defection in the ATn signalling pathway. Human Molecular Genetics. 2004;13:3127–3138. doi: 10.1093/hmg/ddh335. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplementary Data]
ddq008_index.html (825B, html)
ddq008_1.pdf (77.2KB, pdf)

Articles from Human Molecular Genetics are provided here courtesy of Oxford University Press

RESOURCES