Skip to main content
American Journal of Physiology - Cell Physiology logoLink to American Journal of Physiology - Cell Physiology
. 2009 Dec 2;298(3):C486–C495. doi: 10.1152/ajpcell.00251.2009

Electrophysiological properties of human induced pluripotent stem cells

Peng Jiang 1,2, Stephanie N Rushing 1,2, Chi-wing Kong 1,2,3,4, Jidong Fu 1,2, Deborah Kuo-Ti Lieu 1,2,✉, Camie W Chan 1,2, Wenbin Deng 1,2, Ronald A Li 1,2,3,4
PMCID: PMC2838581  PMID: 19955484

Abstract

Human embryonic stem cells (hESCs) can self-renew while maintaining their pluripotency. Direct reprogramming of adult somatic cells to induced pluripotent stem cells (iPSCs) has been reported. Although hESCs and human iPSCs have been shown to share a number of similarities, such basic properties as the electrophysiology of iPSCs have not been explored. Previously, we reported that several specialized ion channels are functionally expressed in hESCs. Using transcriptomic analyses as a guide, we observed tetraethylammonium (TEA)-sensitive (IC50 = 3.3 ± 2.7 mM) delayed rectifier K+ currents (IKDR) in 105 of 110 single iPSCs (15.4 ± 0.9 pF). IKDR in iPSCs displayed a current density of 7.6 ± 3.8 pA/pF at +40 mV. The voltage for 50% activation (V1/2) was −7.9 ± 2.0 mV, slope factor k = 9.1 ± 1.5. However, Ca2+-activated K+ current (IKCa), hyperpolarization-activated pacemaker current (If), and voltage-gated sodium channel (NaV) and voltage-gated calcium channel (CaV) currents could not be measured. TEA inhibited iPSC proliferation (EC50 = 7.8 ± 1.2 mM) and viability (EC50 = 5.5 ± 1.0 mM). By contrast, 4-aminopyridine (4-AP) inhibited viability (EC50 = 4.5 ± 0.5 mM) but had less effect on proliferation (EC50 = 0.9 ± 0.5 mM). Cell cycle analysis further revealed that K+ channel blockers inhibited proliferation primarily by arresting the mitotic phase. TEA and 4-AP had no effect on iPSC differentiation as gauged by ability to form embryoid bodies and expression of germ layer markers after induction of differentiation. Neither iberiotoxin nor apamin had any function effects, consistent with the lack of IKCa in iPSCs. Our results reveal further differences and similarities between human iPSCs and hESCs. A better understanding of the basic biology of iPSCs may facilitate their ultimate clinical application.

Keywords: ion channels, potassium currents, patch-clamp recording


human embryonic stem cells (hESCs), isolated from the inner cell mass of blastocysts, can self-renew while maintaining their pluripotency to differentiate into all cell types (22). Although hESCs may provide an unlimited ex vivo source for cell-based therapies, numerous hurdles must be overcome before their clinical application. For instance, generation of patient-specific cells for autologous transplantation has been pursued to avoid immune rejection of the transplanted grafts. Direct reprogramming of adult somatic cells to become pluripotent hESC-like cells (aka induced pluripotent stem cells or iPSCs) has been recently reported, eliminating potential ethical concerns: forced expression of four pluripotency genes, namely, Oct3/4, Sox2, c-Myc, and Klf4 (12, 18) or Oct3/4, Sox2, Nanog, and Lin28 (26), suffices to reprogram mouse and human fibroblasts into iPSCs. Human iPSCs are similar to hESCs in their morphology, proliferation, feeder dependence, surface markers, gene expression, epigenetic status, formation of embryoid bodies in vitro, promoter activities, telomerase activities, and in vivo teratoma formation (12, 18, 26). Transcriptomic analysis of human iPSCs and hESCs showed that their global gene expression patterns are also remarkably similar. Technically, iPSCs are cultured under conditions virtually identical to those for hESCs and have the capability of differentiating into all three germ layers and their derivatives.

Although hESCs and human iPSCs have been shown to be similar in many aspects, such basic properties as the electrophysiology of iPSCs have not been explored. Ion channels are membrane-bound signaling proteins that play crucial biological roles in excitable as well as inexcitable cells. For instance, the complex interplays of ionic channels in neuronal, muscle, and pancreatic cells shape their action potential profiles and, subsequently, physiological functions from cognition to heart pumping and insulin secretion. As for inexcitable cells, several K+ channels have been implicated in the proliferation, cell cycle transition, and apoptosis of mesenchymal stem cells (MSCs) and tumor cells (3, 5, 6, 9, 10, 19, 20). Previously, we reported (24) that several specialized ion channels are functionally expressed in hESCs. When ion channels are blocked, proliferation of hESCs is significantly inhibited. Given that the concern of tumorigenicity primarily arises from pluripotent cells (14), the results suggest that targeted inhibition of specific K+ channel activity may lead to novel strategies for arresting undesirable cell division in tumorigenic cells. Here we report the presence of functional ion channels in human iPSCs. Our results reveal further differences and similarities between human iPSCs and hESCs. A better understanding of the basic biology of iPSCs may facilitate their ultimate clinical application.

MATERIALS AND METHODS

Culturing and differentiation of iPSCs.

Human iPSCs (foreskin, clone 3) (26), a kind gift from Dr. James Thomson (University of Wisconsin-Madison, Madison, WI), were maintained on irradiated mouse embryonic fibroblasts (MEFs) in Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% knockout serum replacement, 1 mM l-glutamine, 0.1 mM β-mercaptoethanol, 1% nonessential amino acid, and 20 ng/ml human basic fibroblast growth factor (bFGF) (all from GIBCO-BRL, Gaithersburg, MD). The medium was changed every day. To isolate single iPSCs for experiments, only iPSC colonies with morphology typical of undifferentiated cells were manually dissected out with glass needles followed by enzymatic dissociation with 0.25% trypsin-EDTA (GIBCO-BRL). Before ionic current recordings, single cells were allowed to attach to poly-d-lysine (Sigma-Aldrich, St. Louis, MO)-coated glass coverslips for 30 min.

To induce the formation of embryoid bodies (EBs), iPSCs were detached with 1 mg/ml type IV collagenase (GIBCO-BRL) and transferred to Costar ultra-low-attachment six-well plates (Corning, Schiphol-Rijk, The Netherlands) in DMEM supplemented with 20% fetal bovine serum defined (Hyclone, Logan, UT), 2 mM l-glutamine, and 1% nonessential amino acid stock in the absence of human bFGF. The aggregates were cultured in suspension for 7 days, and the medium with or without K+ channel blockers was changed every day.

Immunostaining.

Human iPSC colonies were fixed in 4% paraformaldehyde for 15 min at room temperature (21–22°C), washed with PBS, and permeabilized with 0.1% Triton X-100-PBS. The colonies were then blocked with 4% goat serum in PBS for 2 h at room temperature. Fixed colonies were incubated with primary antibodies at a dilution of 1:25 (for SSEA-4, Chemicon) or 1:100 (for Oct4, Santa Cruz Biotechnology) overnight at 4°C, followed by incubation with fluorescence-labeled secondary antibodies for 1 h at room temperature and visualization by laser-scanning confocal microscopy.

Cell proliferation assay.

To examine the role of K+ channels in cell proliferation, human iPSCs were treated with specified concentrations of tetraethylammonium (TEA), 4-aminopyridine (4-AP), iberiotoxin (IBTX), or apamin for 24, 48, or 72 h as indicated. Cell proliferation was determined in 96-well plates with a nonradioactive chemiluminescent bromodeoxyuridine (BrdU) kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's protocols. Briefly, BrdU labeling solution was added to give a final concentration of 10 μM BrdU. Medium was then removed after 2 h, and cells were fixed with ethanol p.a. (70%) in HCl (final concentration 0.5 M) for 30 min at −20°C. After the fixative was removed, 100 μl of freshly diluted 1:100 anti-BrdU peroxidase solution was added to each well for 30 min, followed by washing three times. Finally, 100 μl of substrate solution was added, and luminescence was read at 405 nm by a multiwell scanning spectrophotometer automatic luminometer.

Cell viability was determined in 96-well plates with a colorimetric 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) kit (Roche Diagnostics). Briefly, specified concentrations of TEA, 4-AP, IBTX, or apamin were added for 24, 48, or 72 h as indicated. MTT (10 μl) labeling reagent (5 mg/ml in PBS) was then added to each well, followed by incubation at 37°C for 4 h. Solubilization solution (100 μl) was added to dissolve the formazan crystals formed. Absorbance at 540 nm was read by a spectrophotometer. Untreated cells were used as control.

DNA cytometric analysis.

After incubation of iPSCs in control versus K+ channel blocker-containing medium for 24 h, iPSC colonies were manually isolated from the underlying MEFs and trypsinized to obtain a single-cell suspension. Univariate analysis of the cellular DNA content was performed on propidium iodide-stained nuclei from ice-cold 70% ethanol-fixed iPSCs with a Cytomics FC500 (Beckman Coulter). Appropriate doublet discrimination was achieved through proper gating. DNA contents were measured in >10,000 cells/sample for generating single parameter histograms. Cell cycle distribution was deconvoluted by fitting with the mathematical models in ModFit LT (version 3.1).

Electrophysiology.

Whole cell voltage-clamp recordings were performed at room temperature. Pipette electrodes (TW120F-6; World Precision Instruments, Sarasota, FL) were fabricated with a Sutter P-97 horizontal puller and had final tip resistances of 4–6 MΩ. Membrane currents were measured with a patch-clamp amplifier (Axon 200B, Axon Instruments, Foster City, CA), sampled, and analyzed with a Digidata 1320A interface and a personal computer with Clampex and Clampfit software (version 9.0.1, Axon Instruments). In most experiments, 70–90% series resistance was compensated. All recordings were performed in Tyrode solution consisting of (in mM) 140 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 HEPES, and 10 glucose, pH adjusted to 7.4 with NaOH. The internal solution contained (in mM) 4 NaCl, 130 KCl, 0.5 MgCl2, 10 HEPES, 10 EGTA, and 5 MgATP, pH adjusted to 7.3 with KOH. For recording Ca2+-activated K+ current (IKCa), the EDTA in the internal solution was decreased to 1 mM. For recording Na+ or Ca2+ currents, K+ in the internal solution was replaced by equimolar Cs+. Blockers were diluted to final concentrations in the bath solution as indicated and administrated via superfusion (at least 10 ml) with a fast-exchange perfusion system. The current amplitude at +50 mV was monitored every 30 s after 5 min of incubation until steady-state current blockage was achieved.

Clampfit software was used for data analysis. Half-blocking concentrations (IC50) were determined from the following equation: E = Emax[1 + (IC50/C)nH], where E is the inhibition of K+ current in percentage at concentration C, Emax is the maximum inhibition, and nH is the Hill coefficient. The curves presented in Figs. 2, 3, and 5 were fitted to averaged data points pooled from all experiments.

Reverse transcription-polymerase chain reaction.

Total RNA was prepared from iPSCs with the RNeasy Mini Kit (Qiagen, Valencia, CA). Single-stranded cDNA was synthesized from ∼1 μg of total RNA with random hexamers and SuperScript reverse transcription (RT) (Invitrogen, Carlsbad, CA) according to the manufacturer's protocols, followed by polymerase chain reaction (PCR) amplification with gene-specific primers. Primers, annealing temperature, and product sizes are given in Table 1. cDNA was replaced by sterile nuclease-free water for negative control in each pair of primers, and no significant band was observed in the negative control. The reaction was conducted using the following protocol: initial denaturing of the template for 5 min at 94°C followed by 32 repeating cycles of denaturing for 1 min at 94°C, annealing for 1 min, extension for 1 min at 72°C, and a final elongation at 72°C for 7 min. PCR products were size-fractionated by 1% agarose gel electrophoresis and visualized by ethidium bromide staining. For semiquantitative analysis, GAPDH was employed as a reference gene since its expression has been shown not to vary significantly during hESC differentiation and among developmental stages (15). PCR products were quantified by scanning densitometry.

Table 1.

Primers used in RT-PCR analysis (annealing temperature 55°C)

Gene Accession No. Forward Sequence Reverse Sequence Length, bp
CACNA1H (Cav3.2) NM_001005407 ACTAATGCTCTGGAGATCAGCAAC GATGCTGAAGATGAAAATGAAGAGC 330
CACNA2D1 (Cav, α2/δ-subunit1) NM_000722 AGCAGTCCATATTCCTACTGACATC GACAGATGTTCGGATCAGTTTAAGT 337
CACNA2D2 (Cav, α2/δ-subunit2) NM_001005505 AGAACAAGGTCAACTATTCATACGC ATTCACATAGTCATCATCAGACAGC 392
CACNG4 (Cav, γ4-subunit) NM_014405 CACTTCCCAGAGGACAATGACTAC GTAAAAAGACCAGCCGTAGTTGTAA 306
CACNG7 (Cav, γ7-subunit) NM_031896 ACTGACTACTGGCTGTACATGGAA CGTAGCGATAATGAAAATACTGCTC 439
HCN4 NM_005477 AGGAGATCATCAACTTTAACTGTCG TCTCATTCTCCTGGTAGTTGAAGA 486
KCNC4 (Kv3.4) NM_153763 CTCTTCGAGGATCCCTACTCCT ATGATGTTGAGCAGGTTCTTGAC 308
KCNK1 (K2P1.1) NM_002245 GTCACTGTGTCCTGCTTCTTCTT ACAGTTGGTCATGCTCTATGATGT 446
KCNK12 (K2P12.1) NM_022055 GCTCATCGGCCTCTACCTG AAGAGGTTGAAGAACAGGATGGT 360
KCNK5 (K2P5.1) NM_003740 GAGGCCAAGAAAAACTACTACACAC AGTAGTAGAGGCCCTCGATGTAGTT 493
KCNK6 (K2P6.1) NM_004823 ACTTCTGCTTTATCTCTCTGTCCAC GATGGAAGCGTAGTCGGTGT 317
KCNMB4 (BK, M, β4) NM_014505 GAACAACTCTGAGTCCAACTCTAGG CAGCTTCTGTACTTTGCTTTCTACA 320
KCNN2 (KCa2.2) NM_170775 TGGTGACATGGTACCTAACACATAC TCTTCACTCCTTTCGTTTAAGTCAG 423
KCNQ2 (Kv7.2) NM_172109 CTACATCCTGGAAATCGTGACTATC CTCTGCCAAGTACACCAGGAAC 385
KCNS3 (Kv9.3) NM_002252 GTACAACCAGAGAACAGGATTCTTC CACATTCAGGTTGACAAGTTCCT 281
SCN8A (Nav1.6) NM_014191 GATTCAGTCTGTGAAGAAACTGTCA AGAACTGTTCCCACAGAGTAAAGGT 253
NEFH NM_021076 AGGTGAACACAGACGCTATGC GCCTCTTTCTCCTCTTCTTCAGTC 520
α-Actinin NM_001103 GATCCAGAACAAGATGGAGGAG AGCCGTCTCTCTAGTCATGAAGTC 514
C-actin NM_005159 GACTCTGGGGATGGTGTAACTC CTGGAAGGTAGATGGAGAGAGAAG 698
Albumin NM_000477 GACTATCTATCCGTGGTCCTGAAC CTCATGGTAGGCTGAGATGCTT 443
Caspase-3 NM_004346 AGAGGGGATCGTTGTAGAAG GTTGCCACCTTTCGGTTAAC 304
GAPDH NM_002046 TGGAAGGACTCATGACCACA AGGGGTCTACATGGCAACTG 628

Bioinformatics.

Normalized microarray data were analyzed with Gene Cluster (Stanford University) and TreeView (Eisen Software; Stanford University). The microarray data sets of human iPSC (GSM230054, GSM230233, GSM230235, GSM230236, GSM230237, GSM230238, GSM230239, GSM230240, GSM230241, GSM230243, GSM230245, and GSM230246), ESC (H1 GSM230264, H7 GSM230265, H9 GSM230266, H13B GSM230267, and H14A GSM230279), and MSC (GSM230260, GSM230261, GSM230262, and GSM230263) lines were from NCBI GEO GSE9071 (//www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE9071).

Statistics.

All data reported are means ± SE. Paired and unpaired Student's t-tests were performed to evaluate the statistical significance of differences between two groups. Analysis of variance (ANOVA) was used for multiple comparisons. Values of P < 0.05 were considered statistically significant.

RESULTS

Transcriptomic analysis of ion channel genes in human iPSCs.

As a first step, we analyzed the transcriptomes of iPSCs to obtain insights into the expression profiles of ion channel transcripts. For voltage-dependent ion channels, a total of 32, 16, 75, 13, 18, and 4 transcripts were identified to encode voltage-gated calcium channel (CaV), voltage-gated sodium channel (NaV), voltage-gated potassium channel (KV), calcium-activated potassium channel (KCa), two-pore domain potassium channel (K2P), and hyperpolarization-activated cyclic nucleotide-modulated nonselective ion channel (HCN) genes, respectively, on the microarray chips employed for the transcriptomic analyses of human iPSCs, ESCs, and MSCs. After normalization, the data indicated that among the total of 158 voltage-dependent ion channels mentioned, the transcripts of 5 Cav, 1 Nav, 3 Kv, 2 KCa, 4 K2P, and 1 HCN channel were significantly expressed in iPSCs (Fig. 1A). Specifically, the corresponding gene products were CACNA1H (Cav3.2), CACNA2D1 (Cav α2/δ-subunit1), CACNA2D2 (Cav α2/δ-subunit2), CACNG4 (Cav γ4-subunit), CACNG7 (Cav γ7-subunit), SCN8A (Nav1.6), KCNC4 (Kv3.4), KCNK1 (K2P1.1), KCNK12 (K2P12.1), KCNK5 (K2P5.1), KCNK6 (K2P6.1), KCNQ2 (Kv7.2), KCNS3 (Kv9.3), KCNMB4 (BK, subfamily M, β4), KCNN2 (KCa2.2), and HCN4. Figure 1B shows that RT-PCR confirmed the array results for 15 of the 16 transcripts. Of note, with differential expression analysis among the human iPSC, ESC, and MSC cell lines, the ion channel transcriptome of iPSCs could not be distinguished from that of hESC lines (P > 0.05) but was distinct from human MSCs (P < 0.05) as shown by the averaged signal intensity plots (Fig. 1C).

Fig. 1.

Fig. 1.

Transcript expression of voltage-dependent ion channels in human induced pluripotent stem cells (iPSCs). A: normalized transcript levels of the substantially expressed ion channel genes in iPSCs. Each bar represents the average value of all iPSC cell lines analyzed from the data set GSE9071. B: expression of ion channel transcripts in iPSCs probed by semiquantitative RT-PCR. C, left: 21 channel genes were differentially expressed among human iPSC, embryonic stem cell (ESC), and mesenchymal stem cell (MSC) cell lines. Right: average expression levels of these genes were at similar levels in iPSC and ESC lines, while they were significantly different from those of MSC cell lines.*P < 0.05 compared with iPSC and ESC cell lines.

Ionic currents in human iPSCs.

Human iPSCs maintained a normal karyotype in culture (Fig. 2A), and their colonies were positive for the pluripotency markers Oct4 and SSEA-4 (Fig. 2B), the same as hESCs (22). To functionally probe their electrophysiological properties, patch-clamp recordings were performed on single isolated iPSCs. The averaged membrane capacitance was 15.4 ± 0.9 pF (n = 110), comparable to hESCs (24). When iPSCs were held at −80 mV and stepped to a family of 300-ms voltages from −70 mV to +70 mV, depolarization-activated, time-dependent outwardly rectifying currents that increased progressively with positive voltages and resembled the delayed rectifier K+ currents (IKDR) could be readily recorded (Fig. 2C) in 95.5% of iPSCs (105 of 110 cells). Compared with IKDR measured in hESCs, the K+ current density in iPSCs was approximately sixfold smaller (7.6 ± 3.8 pA/pF at +40 mV in iPSCs vs. 47.5 ± 7.9 pA/pF at +40 mV in hESCs; Ref. 24). Inactivation of K+ currents in iPSCs became apparent when depolarization was prolonged to 3 s (Fig. 2D), with a linear current-voltage (I-V) relationship and threshold potential of −20 mV (Fig. 2E). As shown in Fig. 2G, normalized conductance (g/gmax) was determined from the I-V relationship of the tail current (Fig. 2F) for each cell and fitted to the Boltzmann equation to obtain the voltage for 50% activation (V1/2 = −7.9 ± 2.0 mV) and slope factor (k = 9.1 ± 1.5; n = 8). These gating properties were comparable to those of KCNQ potassium channels expressed in mammalian cell lines (16) and IKDR in hESCs (24).

Fig. 2.

Fig. 2.

Ionic currents recorded in human iPSCs. The iPSCs cultured under our conditions displayed a normal karyotype (A) and were positive for pluripotent markers Oct4 and SSEA-4 (B). C: representative whole cell current tracings recorded from iPSCs. Inset, electrophysiological protocol: 300 ms voltage depolarizing steps between −70 and +70 mV with 10-mV increments were given from a holding potential of −80 mV. Frequency was 0.2 Hz. The current was slowly activated on depolarization with a significant tail current at −40 mV. D: representative current tracing recorded from a typical experiment with 3-s depolarization and showing slight inactivation. E: current-voltage (I-V) relationship of whole cell currents determined as an average of 8 iPSCs. Vm, membrane potential. F: I-V relationship of tail currents measured at −40 mV. G: steady-state activation of the current (normalized conductance, g/gmax) determined with tail current, and g/gmax fit to Boltzmann functions: y = 1/{1 + exp[(Vm − V1/2)/k]}, where V1/2 is the estimated midpoint and k is the slope factor. Mean V1/2 for activation of the current was −7.9 ± 2.0 mV, and k was 9.1 ± 1.5 (n = 8).

Figure 3, A and B, further shows that outwardly rectifying currents in iPSCs could be dose-dependently inhibited by the known K+ channel blocker TEA with a half-blocking concentration (IC50) of 3.3 ± 2.7 mM (n = 10). In the presence of 5 mM 4-AP, a known blocker of several K+ channel subtypes but not KCNQ (13), a modest but detectable transient outward current (Ito)-like outward inactivating current was revealed (Fig. 3, C and D; n = 6). Such 4-AP-sensitive currents progressively increased in amplitude on depolarization until saturation was reached at +80 mV. The large-conductance Ca2+-activated K+ channel-specific blocker IBTX (100 nM) and the small-conductance Ca2+-activated K+ channel-specific blocker apamin (100 nM) had no effect on the outward currents (Fig. 4, A and B), suggestive of the absence of IKCa. The hyperpolarization-activated pacemaker current (If), which has been shown to express in hESCs (15), was absent in iPSCs (Fig. 4C; n = 15). Neither NaV nor CaV currents could be detected (Fig. 4D; n = 10), even when the holding potential was hyperpolarized to −120 mV to enable recovery from any inactivation that might have been present.

Fig. 3.

Fig. 3.

Dissecting the individual ionic component. A: representative tracings showing that whole cell current could be inhibited by the K+ channel blocker tetraethylammonium (TEA). The tracing at bottom was obtained by subtracting the tracing at middle from that at top to show the TEA-sensitive component. B: dose-response relationship for TEA-sensitive whole cell current (n = 6–10). nH, Hill coefficient. C: representative tracings showing the current blocked by the outward transient K+ current-selective blocker 4-aminopyridine (4-AP). The tracing at bottom was obtained by subtracting the tracing at middle from that at top. This current was much smaller than the TEA-sensitive current (note difference in scale bars). D: I-V relationship of 4-AP-sensitive current (n = 6).

Fig. 4.

Fig. 4.

Absence of Ca2+-activated K+ current (IKCa), hyperpolarization-activated currents, and inward currents in iPSCs. A: IKCa was recorded in a typical experiment under conditions of lower concentration of EGTA (1 mM) in the pipette solution. However, as shown in representative current tracings, no obvious IKCa was revealed by Ca2+-activated K+ channel (KCa) blockers iberiotoxin (IBTX) and apamin. B: I-V relationship was not significantly changed in the presence of IBTX or apamin (n = 5). C: stimulation protocol and representative tracing showing that no hyperpolarization-activated current was observed. D: stimulation protocol and representative tracing showing no inward currents (INa or ICa).

Effects of ion channel blockers on iPSC proliferation and differentiation.

To explore the biological roles of the ionic currents identified in iPSCs, we next studied the functional consequences of their pharmacological blockade by assessing the effects of extracellular application of K+ channel blockers on cell proliferation as well as differentiation. For proliferation, we measured DNA synthesis as an index for replication by quantifying the incorporation of BrdU into the genomic DNA during the S phase of the cell cycle that is proportional to the rate of cell division (25). To assess the cytotoxic effect of K+ channel blockers, a colorimetric MTT assay was also employed. As shown in Fig. 5A1, TEA treatment for 24 h inhibited iPSC proliferation in a dose-dependent manner. However, such inhibitory effects could not be distinguished from their cytotoxic effect as reflected by MTT assay (effective concentrations at 50% inhibition or EC50 were 7.8 ± 1.2 and 5.5 ± 1.0 mM for inhibiting proliferation and cytotoxic effect, respectively; P > 0.05, n = 4). However, 4-AP inhibited viability but had much less effect on proliferation (EC50 = 4.5 ± 0.5 and 0.9 ± 0.5 mM, respectively). In contrast, IBTX and apamin had significant effects on neither proliferation nor viability (P > 0.05, n = 6), consistent with the lack of IKCa in iPSCs.

Fig. 5.

Fig. 5.

A: effect of TEA (1), 4-AP (2), IBTX (3), and apamin (4) on iPSC proliferation after 24-h incubation assessed by bromodeoxyuridine (BrdU) incorporation and cytotoxicity by MTT assay after an incubation period of 24 h. B and C: effects of 48-h (B) and 72-h (C) treatments assessed by BrdU and MTT assay. *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 5, B and C, shows that longer treatments of iPSCs with TEA, 4-AP, apamin, or IBTX for 48 and 72 h did not alter the inhibitory effects on proliferation, or the lack thereof, observed after 24 h (P > 0.05, except for 1 mM 4-AP after 72 h). However, 48- and 72-h treatments enhanced the cytotoxic effects of both TEA and 4-AP (P < 0.05), although directionally similar results were still observed. Consistent with their lack of effect on viability, longer incubations with apamin or IBTX had no further effect (P > 0.05).

Role of K+ channels in cell cycle of iPSCs.

For mechanistic insights, we have also characterized the effects of K+ channel blockers on the cell cycle distribution of iPSCs. As shown in Fig. 6, all K+ channel blockers tested at the same concentrations used for our proliferation and viability experiments significantly reduced the proportion of cells in the G0/G1 phase (P < 0.05) but without affecting the S phase (P < 0.05). Also, compared with the untreated controls (21.7 ± 1.2%), an increased proportion of G2/M cells was observed after treatments with TEA (28.5 ± 1.3% and 30.2 ± 1.4% by 1 mM and 3 mM, respectively, n = 3 each; P < 0.05) or XE-991, a potent KCNQ channel-selective inhibitor (23) (35.7 ± 1.4% by 1 μM, n = 3; P < 0.01). These results support the notion that TEA and XE-991, but not 4-AP, blunted the proliferation of iPSCs and further suggest that iPSCs were arrested in the mitotic phase.

Fig. 6.

Fig. 6.

Effects of K+ channel blockers on human iPSC cell cycle distribution. A: representative histograms showing the DNA contents of propidium iodide (PI)-labeled fixed cells. Control iPSCs were highly proliferative with ∼20% in G0/G1 phase. Relative proportions of G0/G1, S, and G2/M phase are shown. B: DNA content analysis of iPSCs in control vs. K+ channel blocker-treated conditions and % of cells in each of the cell cycle phases. *P < 0.05, **P < 0.01.

Effects of K+ channel blockers on differentiation.

To further probe the roles of 4-AP- and TEA-sensitive currents, we cultured iPSCs in suspension to form three-dimensional EBs for inducing differentiation. As shown in Fig. 7A, iPSCs could readily form EBs with or without TEA or 4-AP. Of note, low concentrations of TEA (1 mM) and 4-AP (0.3 mM) were employed according to the cell viability MTT assays to eliminate any potential effect due to cytotoxicity of K+ channel blockers. RT-PCR analysis further showed that iPSC-derived EBs formed in the presence or absence of TEA or 4-AP similarly expressed the ectodermal (NEFH), mesodermal (α-actinin and C-actin), and endodermal (albumin) germ layer markers (Fig. 7B), indicating that pluripotency was unaltered. Consistently, the expression levels of several germ layer markers, the cardiac-specific marker α-actinin, the liver-specific marker albumin, as well as the apoptotic marker caspase-3 (21), were not changed (P > 0.05, n = 3).

Fig. 7.

Fig. 7.

Effects of blocking ion channels on human iPSCs differentiation. A: in the presence and absence of K+ channel blockers TEA (1 mM) and 4-AP (0.3 mM), iPSCs could form embryoid bodies (EBs) in suspension culture. Scale bars, 100 μm. B: RT-PCR result showed that the iPSC EBs (7 days) expressed ectodermal (NEFH), mesodermal (α-actinin and C-actin), and endodermal (albumin) germ layer markers. GAPDH was used as loading control. Caspase-3 was used to compare cell death among the groups. C: after semiquantitative analysis using GAPDH as loading control, expression levels of the germ layer markers and caspase-3 were not significantly altered compared with the control group (n = 3).

DISCUSSION

In the present study, we demonstrate that pluripotent human iPSCs functionally express several specialized ion channels. In our previous study (24), we reported that IKDR is expressed in all undifferentiated H1 hESCs. Furthermore, KCNQ2 (KV7.2) that underlies the noninactivating, slowly deactivating M current (2) or IKDR shows the highest transcript expression in both human iPSCs and hESCs (24). Indeed, IKDR is the major ionic component of the depolarization-activated currents recorded in all iPSCs and had kinetics similar to what have been reported for undifferentiated hESCs (15, 24). Another previous study (15) reported the expression of HERG channels in H1 hESCs. However, the same was not observed in iPSCs either functionally by patch-clamp recordings or in our RT-PCR experiments (data not shown). The lack of significant sensitivity of IKDR in iPSCs to 4-AP, a blocker that inhibits several K+ channel types but not KCNQ (13), lends further support to the notion that KCNQ2 is a molecular component of the IKDR recorded in iPSCs. In addition to KCNQ2, CNC4 and KCNS3, which encode for delayed rectifier KV3.4 channels and the silent modulatory α-subunit of IKDR channels (17), respectively, were also expressed. Collectively, these ion channel genes are prime candidates that underlie the currents identified in iPSCs.

Our results have indicated that iPSCs appear to be highly electrophysiologically homogenous: almost 100% of cells recorded display IKDR and 4-AP-sensitive currents but not INa, ICa, If, and IKCa. As such, this functional homogeneity of iPSCs mirrors that of hESCs but starkly contrasts those of MSCs and fibroblasts. In human MSCs (1, 7, 10) and newborn foreskin fibroblasts (4), the expression levels of a range of ion channels such as INa, ICa, IKDR, Ito, and IKCa, etc, have been reported to vastly vary even within the same population subsets. Of note, the iPSC line investigated in the present study has been reprogrammed from newborn foreskin fibroblast, further implicating that reprogramming to the pluripotent state returns cells to a primitive state that is relatively functionally homogeneous, at least from the electrophysiological viewpoint.

Unlike its effect on hESCs, TEA inhibits proliferation and affects viability of iPSCs with comparable EC50 values that parallel that for current blockade (IC50 = 3.3 ± 2.7 mM), raising the possibility that their binding to the channel receptor leads to a cascade of events that subsequently result in the functional consequences observed. Our cell cycle analysis further suggests that K+ channel blockade inhibits iPSC proliferation by affecting the mitotic phase. Our experiments, however, do not enable us to exclude the alternative possibility that K+ channel antagonists exert their effects on cell cycle, proliferation, and cytotoxicity via cellular uptake (e.g., endocytosis) followed by interacting with intracellular targets other than K+ channels. Indeed, the latter possibility may apply to 4-AP, which displays significant cytotoxicity but exerts much less effect on proliferation and cell cycle. This observation is in accordance with the role of K+ channels in proliferation, given the relatively small 4-AP-sensitive currents expressed in iPSCs. IBTX and apamin have significant effects on neither proliferation nor cell viability, consistent with the absence of IKCa.

Ion channels have been demonstrated to be crucial in initiating cell differentiation (8). A recent study demonstrates the link of KCNQ1 potassium channel functions to the control of migration, shape, and mitotic rate during mouse embryonic morphogenesis (11). KCNQ1 is not shown to express in human iPSCs and ESCs according to microarray analyses. Indeed, the channel blockers investigated in the present study exhibit no discernible effect on pluripotency and differentiation as gauged by EB morphology and expression of markers for the primitive germ layers as well as their tissue derivatives. Considering the cytotoxicity of the K+ blockers, low concentrations of K+ channel blockers, at which the ionic currents could not be vigorously blocked, were used to probe their roles in iPSC differentiation. As a result, the roles of the K+ channel could be masked. To further address the functional roles of ion channels in iPSC differentiation, specific knockout/knockdown of K+ channels with small interfering RNA during the formation of iPSC EBs needs to be employed in future studies.

Taken collectively, our present results reveal electrophysiological similarities and differences between human iPSCs, ESCs, and MSCs. Although the ionic components in human iPSCs largely resemble those in hESCs, specific differences in their properties and biological roles still exist. While the similarities likely reflect the known effect of IKDR on cell proliferation, other differences could be attributed to poorly defined factors such as the differential expression of ion channel and other accessory proteins and subunits.

GRANTS

This work was in part supported by grants from the National Institutes of Health (R01-NS-059043, R01-ES-015988 to W. Deng and R01-HL-72857 to R. A. Li), the California Institute for Regenerative Medicine (to R. A. Li), the National Multiple Sclerosis Society (to W. Deng), Shriners Hospitals for Children (to W. Deng), and the CC Wong Foundation Stem Cell Fund (to R. A. Li).

DISCLOSURES

The authors are not aware of financial conflict(s) with the subject matter or materials discussed in this manuscript with any of the authors, or any of the authors' academic institutions or employers.

ACKNOWLEDGMENTS

We thank Dr. Daniel Feldman for helpful discussion.

REFERENCES

  • 1.Boheler KR. Functional markers and the “homogeneity” of human mesenchymal stem cells. J Physiol 554: 592, 2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Cooper EC, Jan LY. M-channels: neurological diseases, neuromodulation, and drug development. Arch Neurol 60: 496–500, 2003 [DOI] [PubMed] [Google Scholar]
  • 3.Deng XL, Sun HY, Lau CP, Li GR. Properties of ion channels in rabbit mesenchymal stem cells from bone marrow. Biochem Biophys Res Commun 348: 301–309, 2006 [DOI] [PubMed] [Google Scholar]
  • 4.Estacion M. Characterization of ion channels seen in subconfluent human dermal fibroblasts. J Physiol 436: 579–601, 1991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fiske JL, Fomin VP, Brown ML, Duncan RL, Sikes RA. Voltage-sensitive ion channels and cancer. Cancer Metastasis Rev 25: 493–500, 2006 [DOI] [PubMed] [Google Scholar]
  • 6.Fraser SP, Pardo LA. Ion channels: functional expression and therapeutic potential in cancer. Colloquium on Ion Channels and Cancer. EMBO Rep 9: 512–515, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Heubach JF, Graf EM, Leutheuser J, Bock M, Balana B, Zahanich I, Christ T, Boxberger S, Wettwer E, Ravens U. Electrophysiological properties of human mesenchymal stem cells. J Physiol 554: 659–672, 2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hinard V, Belin D, Konig S, Bader CR, Bernheim L. Initiation of human myoblast differentiation via dephosphorylation of Kir2.1 K+ channels at tyrosine 242. Development 135: 859–867, 2008 [DOI] [PubMed] [Google Scholar]
  • 9.Li GR, Deng XL, Sun H, Chung SS, Tse HF, Lau CP. Ion channels in mesenchymal stem cells from rat bone marrow. Stem Cells 24: 1519–1528, 2006 [DOI] [PubMed] [Google Scholar]
  • 10.Li GR, Sun H, Deng X, Lau CP. Characterization of ionic currents in human mesenchymal stem cells from bone marrow. Stem Cells 23: 371–382, 2005 [DOI] [PubMed] [Google Scholar]
  • 11.Morokuma J, Blackiston D, Adams DS, Seebohm G, Trimmer B, Levin M. Modulation of potassium channel function confers a hyperproliferative invasive phenotype on embryonic stem cells. Proc Natl Acad Sci USA 105: 16608–16613, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Okita K, Ichisaka T, Yamanaka S. Generation of germline-competent induced pluripotent stem cells. Nature 448: 313–317, 2007 [DOI] [PubMed] [Google Scholar]
  • 13.Robbins J. KCNQ potassium channels: physiology, pathophysiology, and pharmacology. Pharmacol Ther 90: 1–19, 2001 [DOI] [PubMed] [Google Scholar]
  • 14.Sales KM, Winslet MC, Seifalian AM. Stem cells and cancer: an overview. Stem Cell Rev 3: 249–255, 2007 [DOI] [PubMed] [Google Scholar]
  • 15.Sartiani L, Bettiol E, Stillitano F, Mugelli A, Cerbai E, Jaconi ME. Developmental changes in cardiomyocytes differentiated from human embryonic stem cells: a molecular and electrophysiological approach. Stem Cells 25: 1136–1144, 2007 [DOI] [PubMed] [Google Scholar]
  • 16.Selyanko AA, Hadley JK, Wood IC, Abogadie FC, Jentsch TJ, Brown DA. Inhibition of KCNQ1–4 potassium channels expressed in mammalian cells via M1 muscarinic acetylcholine receptors. J Physiol 522: 349–355, 2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Stocker M, Kerschensteiner D. Cloning and tissue distribution of two new potassium channel alpha-subunits from rat brain. Biochem Biophys Res Commun 248: 927–934, 1998 [DOI] [PubMed] [Google Scholar]
  • 18.Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131: 861–872, 2007 [DOI] [PubMed] [Google Scholar]
  • 19.Tao R, Lau CP, Tse HF, Li GR. Functional ion channels in mouse bone marrow mesenchymal stem cells. Am J Physiol Cell Physiol 293: C1561–C1567, 2007 [DOI] [PubMed] [Google Scholar]
  • 20.Tao R, Lau CP, Tse HF, Li GR. Regulation of cell proliferation by intermediate-conductance Ca2+-activated potassium and volume-sensitive chloride channels in mouse mesenchymal stem cells. Am J Physiol Cell Physiol 295: C1409–C1416, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tewari M, Quan LT, O'Rourke K, Desnoyers S, Zeng Z, Beidler DR, Poirier GG, Salvesen GS, Dixit VM. Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81: 801–809, 1995 [DOI] [PubMed] [Google Scholar]
  • 22.Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science 282: 1145–1147, 1998 [DOI] [PubMed] [Google Scholar]
  • 23.Wang HS, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, Dixon JE, McKinnon D. KCNQ2 and KCNQ3 potassium channel subunits: molecular correlates of the M-channel. Science 282: 1890–1893, 1998 [DOI] [PubMed] [Google Scholar]
  • 24.Wang K, Xue T, Tsang SY, Van Huizen R, Wong CW, Lai KW, Ye Z, Cheng L, Au KW, Zhang J, Li GR, Lau CP, Tse HF, Li RA. Electrophysiological properties of pluripotent human and mouse embryonic stem cells. Stem Cells 23: 1526–1534, 2005 [DOI] [PubMed] [Google Scholar]
  • 25.Yu CC, Woods AL, Levison DA. The assessment of cellular proliferation by immunohistochemistry: a review of currently available methods and their applications. Histochem J 24: 121–131, 1992 [DOI] [PubMed] [Google Scholar]
  • 26.Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA. Induced pluripotent stem cell lines derived from human somatic cells. Science 318: 1917–1920, 2007. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Cell Physiology are provided here courtesy of American Physiological Society

RESOURCES