Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2009 Aug 11;18(1):54–62. doi: 10.1038/mt.2009.178

Deficiency of the Housekeeping Gene Hypoxanthine–Guanine Phosphoribosyltransferase (HPRT) Dysregulates Neurogenesis

Ghiabe-Henri Guibinga 1, Stephen Hsu 1, Theodore Friedmann 1
PMCID: PMC2839227  PMID: 19672249

Abstract

Neuronal transcription factors play vital roles in the specification and development of neurons, including dopaminergic (DA) neurons. Mutations in the gene encoding the purine biosynthetic enzyme hypoxanthine–guanine phosphoribosyltransferase (HPRT) cause the resulting intractable and largely untreatable neurological impairment of Lesch–Nyhan disease (LND). The disorder is associated with a defect in basal ganglia DA pathways. The mechanisms connecting the purine metabolic defect and the central nervous system (CNS) phenotype are poorly understood but have been presumed to reflect a developmental defect of DA neurons. We have examined the effect of HPRT deficiency on the differentiation of neurons in the well-established human (NT2) embryonic carcinoma neurogenesis model. We have used a retrovirus expressing a small hairpin RNA (shRNA) to knock down HPRT gene expression and have examined the expression of a number of transcription factors essential for neuronal differentiation and marker genes involved in DA biosynthetic pathway. HPRT-deficient NT2 cells demonstrate aberrant expression of several transcription factors and DA markers. Although differentiated HPRT-deficient neurons also demonstrate a striking deficit in neurite outgrowth during differentiation, resulting neurons demonstrate wild-type electrophysiological properties. These results represent direct experimental evidence for aberrant neurogenesis in HPRT deficiency and suggest developmental roles for other housekeeping genes in neurodevelopmental disease.

Introduction

Lesch–Nyhan disease (LND) is a rare X-linked genetic disorder caused by mutations in the gene encoding the purine biosynthetic and recycling pathway enzyme hypoxanthine–guanine phosphoribosyltransferase (HPRT). The genetic defect of recycling hypoxanthine and guanine leads to the metabolic and neurological hallmarks of the disease; i.e., hyperuricemia, dystonia, and above all, the severely aberrant neurobehavioral effect of self-mutilation associated with severe basal ganglia dopamine (DA) depletion and defective DA uptake in both the human LND patients and in the HPRT knockout mouse.1,2 The mechanisms responsible for the central nervous system (CNS) disorder are poorly understood. Molecular genetic studies of HPRT deficiency in the mouse knockout model and in human patients with LND have revealed few robust clues to the development of the neurological phenotype. Both the human and mouse HPRT-deficient states are accompanied by hallmark biochemical markers of HPRT deficiency; i.e., severe deficits of DA content and uptake.3 In the HPRT-deficient mouse model, DA deficit is found not only in striatum but also in primary cultures of midbrain neurons.4 The DA deficit does not result from a major degree of degeneration of DA neurons because such cells are present in relatively normal numbers and with relatively normal distribution in both human patients and the HPRT-knockout mouse. Our laboratory has identified a number of aberrantly expressed genes in HPRT-deficient mice and in human HPRT-deficient fibroblasts,5 leading us to a working hypothesis that the complex CNS phenotype results at least partly from complex interacting networks and pathways that affect many aspects of CNS development and function, including possibly defects in the development of DA neurons themselves. Until now, there has been no direct evidence to support such defects of neuronal development and function.

During the past several decades, there has been considerable progress in elucidating gene regulatory pathways leading to the specification of midbrain DA neurons, particularly in the mouse brain. Studies have identified several families of transcription factors involved in the establishment of the DA neuronal phenotype, including LIM homeodomain transcription factors such as Lmx1a, Msx1, and Lmx1b known to be important upstream regulators of DA neuron specification and to activate other pro-neural families of genes such as FoxA1 and Ngn2; basic helix-loop-helix factors that direct cellular differentiation; midbrain DA neuron–specific transcription factors such as Nurr1 and Pitx3 that induce the maturation of DA neuron phenotype.6,7,8,9,10,11,12 FoxA1 and FoxA2 belong to a family of forkhead/winged transcription factors that regulate multiple phases of midbrain DA neuron development, from early regional and neuronal specification to late-stage differentiation, at least partly by activating Nurr1 expression in differentiating neurons.11

Despite this body of information on mechanisms that determine and regulate neurogenesis and the development of the mammalian CNS, extension to the putative complex neurodevelopmental defects in LND has been limited, and it has not been possible yet to identify the nature and cause of the DA defects in LND, the nature of putative purine effectors, and the role of HPRT in that process. We have now used the established cell culture model of neuronal differentiation produced by retinoic acid (RA) treatment of human teratocarcinoma NT (NT2) cells (Supplementary Figure S1),13,14,15 to test the effect of HPRT deficiency on the expression of various transcription factor genes essential to neuronal differentiation and neurogenesis. We have used retroviral-based gene delivery of small hairpin RNA (shRNA) to knock down expression of the HPRT gene in NT2 cells, subjected the cells to RA–induced differentiation in vitro and used quantitative PCR methods to determine the mRNA levels of transcripts of the LIM homeodomain, basic helix-loop-helix- and midbrain DA neuron–specific transcription factors in wild-type and HPRT-knockdown cells. We have also examined the development of neurite outgrowth and electrophysiological function in such cells. We report that HPRT deficiency dysregulates a number of vital transcription factors involved in DA neuron development and in pan-neuronal differentiation. In addition, HPRT deficiency causes morphological cellular changes including impaired neurite development, although the resulting heterogeneous population of neurons shows basic electrophysiological properties similar to those of wild-type cells.

Results

HPRT knockdown

Infection of NT2 cells with the shRNA retrovirus produces a reproducible stable reduction of HPRT activity of ~94% compared with cells infected in parallel with a comparable vector containing the shRNA directed against luciferase (see Supplementary Table S1).

Aberrant expression of transcription factors

For these studies, we have chosen to examine the pattern of gene expression between day 0 (undifferentiated state) and at times when neuron-like morphology first becomes evident on day 18 (early differentiation). Figure 1 illustrates the RNA level of selected DA neuronally relevant transcription factors on days 0 and 18 of RA–induced neuronal differentiation of wild-type and HPRT-knockdown NT2 cells. In most cases, the levels of expression of these transcription factors in wild-type and HPRT-knockdown cells prior to differentiation toward the neuronal phenotype are indistinguishable, with the possible exception of minor upregulation of LIM homeodomain genes Lmx1a and Msx1 in the knockdown cells. However, significant changes of expression between the two cell types and between days 0 and 18 of RA-induced differentiation are apparent. The expression of LIM homeodomain genes Lmx1a and Msx1 is largely unchanged on day 18 in wild-type cells but shows a major degree of upregulation in HPRT-knockdown cells (Figure 1a,b). In contrast, Ngn2 and Mash1 are significantly upregulated in both wild-type and HPRT-knockdown cells. The degree of upregulation of Ngn2 is more pronounced in HPRT-knockdown cells (Figure 1c), whereas upregulation of Mash1 is much less pronounced in the HPRT-deficient cells (Figure 1d). Transcription factors Nurr1 and Pitx3 show expression patterns similar to Mash1 and demonstrate marked upregulation in the wild-type cells and far less upregulation in HPRT-deficient cells (Figure 1e,f). Expression of FoxA1 shows no change of expression in wild-type NT2 cells at day 18 of RA differentiation, but, in contrast, HPRT-deficient cells show a marked upregulation (Figure 1g).

Figure 1.

Figure 1

Open in a new tab

Expression of transcription factors required for specification and development of dopaminergic neurons, as determined by quantitative PCR. Cellular RNA purified from wild-type (open bars) and HPRT-deficient (closed bars) NT2 cells at 0 and 18 days of retinoic acid differentiation were examined by quantitative PCR for the transcription factors (a) Lmx1a, (b) Msx1, (c) Ngn2, (d) Mash1, (e) Nurr1, (f) Pitx3, and (g) FoxA1. * represents statistical significance between wild-type and HPRT-deficient cells (Student's t-test). bHLH, basic helix-loop-helix; HPRT, hypoxanthine–guanine phosphoribosyltransferase; mDA, midbrain dopaminergic neuron.

Figure 2 demonstrates the effect of HPRT deficiency on the expression of additional, more pan-neuronal transcription factors during the time course of RA-induced differentiation. Changes in the expression of these factors are likely to reflect developmental pathways not only for DA neuronal development but also for other classes of neurons such as GABAergic and cholinergic neurons as well as possible development of non-neuronal cells such as glia and astrocytes in the culture. The levels of expression summarized in Figure 2 are normalized to the expression of TATA-binding protein and indicate that expression of these pan-neuronal markers demonstrate very low levels of expression prior to neuronal induction with RA. All factors show markedly increased expression between day 0 prior to neurogenesis and day 18, at which time neurogenesis is actively underway. However, HPRT deficiency is seen to have major effects on the expression of these factors, revealing markedly impaired upregulated expression of LIM but enhanced expression of Ngn1 and FoxA2. The effects of HPRT deficiency on expression of NeuroD cannot be expressed as comparative relative changes from the current results because expression in undifferentiated wild-type cells is below the limits of detection. Both wild-type and HPRT-deficient cells demonstrate very brisk expression of NeuroD on day 18.

Figure 2.

Figure 2

Open in a new tab

Expression of transcription factors required for pan-neuronal development, as determined by quantitative PCR. Wild-type (open bars) and HPRT-deficient (closed bars). (a) Lmx1b, (b) Ngn1, (c) NeuroD, and (d) FoxA2. Gene expression on day 0 was at or near background levels for all four genes. * represents statistical significance between wild-type and HPRT-deficient cells (Student's t-test). bHLH, basic helix-loop-helix.

Dysregulation of DA biosynthetic genes

To determine the combined effects of these transcription factor changes on the generation of DA neurons, we further examined the expression of genes that reflect DA neuronal functions. Figure 3 summarizes some of the complex time-dependent changes in wild-type and HPRT-deficient NT2 cells in the expression of markers that reflect such DA neuronal functions prior to differentiation (day 0) and at the intermediate day 21 stage of neuronal differentiation, at which time RA-induced NT2 cells show a clear neuronal phenotype and express the neuronal marker Tau (data not shown). The DA neuronal markers examined included (i) tyrosine hydroxylase (TH), the rate-limiting enzyme for the conversion of L-tyrosine to L-DOPA; (ii) aromatic L-amino-acid decarboxylase (AADC) that drives the synthesis of DA from L-DOPA; and (iii) vesicular monoamine transporter (VMAT2), the function that regulates sequestration of monoamines into vesicles for release into the synapse.

Figure 3.

Figure 3

Open in a new tab

Quantitative PCR analysis of gene expression of dopamine marker genes in undifferentiated (day 0) and differentiated (day 21) NT2 cells. Cellular RNA purified from wild-type (open bars) and HPRT-deficient (closed bars) NT2 cells at 0 and 21 days of retinoic acid differentiation was examined by quantitative PCR for each of the dopaminergic markers. * represents statistically significant difference between wild-type and HPRT-deficient cells (Student's t-test). AADC, aromatic L-amino-acid decarboxylase; TH, tyrosine hydroxylase.

In contrast to the relatively unchanged expression of the transcription factors prior to RA-induced differentiation as illustrated in Figure 1, HPRT-knockdown cells on day 0 show a consistent but only slight upregulation of TH. AADC and VMAT show little change prior to differentiation. The DA markers—AADC and VMAT2—are expressed at similar levels in the two cell types. During RA-induced differentiation, both wild-type and HPRT-deficient cells, not surprisingly, demonstrate an increased level of TH expression, although the degree of upregulation in wild-type cells is more robust (approximately sixfold) than in HPRT-deficient cells (twofold). Nevertheless, the final level of TH expression is similar in the two cell types. Regulation of AADC expression shows a pattern similar to that of TH, with an upregulation of approximately 12-fold in wild-type cells but a blunted fourfold in HPRT-deficient cells (Figure 3). The final level of AADC expression is markedly reduced in the knockdown cells compared with wild-type cells.

In the case of VMAT2, wild-type and HPRT-deficient cells show similar levels of expression prior to differentiation, but on day 21, VMAT2 expression shows little change in wild-type cells but a marked upregulation of approximately sixfold in HPRT-deficient cells.

Overall, these studies of in vitro neurogenesis from NT2 cells demonstrate that HPRT deficiency leads to dysregulated expression of a number of vital transcription factors required for both general and specifically for DA neurogenesis (Supplementary Figure S3). These developmental effects are reflected in aberrant expression of markers of DA neuron function, such as both major DA biosynthetic functions, i.e., TH and AADC, and sharp upregulation of the vesicular sequestration function VMAT.

Impaired neurite outgrowth in HPRT-deficient neurons

Figure 4 illustrates the effect of HPRT deficiency on neurite outgrowth in RA-treated cells. On day 18, the neurite outgrowth in HPRT-knockdown cells is not significantly higher than those of wild-type cells (see Supplementary Table S2). However, beginning at 21 days and more markedly evident at the more advanced 49-day stage of RA-induced differentiation, there was a significant reduction in the relative frequency of longer neurites in HPRT-knockdown cells compared with wild-type cells. Figure 4a,b represents a phase-contrast image of representative cells in wild-type and HPRT-knockdown cells at 49 days and suggests limited neurite outgrowth in the latter cells. Figure 4c documents the significant length difference between wild-type (open bars) and HPRT-knockdown cells (closed bars) at both 21 and 49 days and reveals that the overall neurite lengths in HPRT-deficient cells are significantly lower than in the wild-type cells. Furthermore, neurite lengths at 49 days are uniformly lower in both cell types than at 21 days, suggesting a degree of neurite instability in aged cultures of both cell types. Figure 4d represents a histogram of the overall distribution of neurite lengths in the two cell types and reveals that at 21 days, the difference suggested in 4A and quantitated in 4C reflects a slight paucity of longer neurites. However, by 49 days, the difference is striking and again reflects a relative absence of long neurites. Supplementary Table S2 summarizes the morphometric analysis of neurite outgrowth for wild-type and HPRT-deficient neurons.

Figure 4.

Figure 4

Open in a new tab

Analysis of neurite outgrowth in wild-type and HPRT-deficient NT2-derived neurons. (a) and (b) represent phase-contrast images of wild-type and HPRT-knockdown cells at 49 days, demonstrating blunted neurite outgrowth and rounded morphology of the latter cells. (c) Quantitation of neurite lengths in wild-type (open bars) and HPRT-knockdown cells (closed bars) at both 21 and 49 days. (d) Histogram of the frequency distribution of neurites in wild-type (open bars) and HPRT-deficient (closed bars) demonstrating a skewed distribution toward the shorter lengths in HPRT-deficient cells, especially evident at 49 days. The frequency distribution of neurite lengths was quantitated by MetaMorph imaging and morphometric and Matrox Intellicam software (see Materials and Methods). HPRT-Kd, hypoxanthine–guanine phosphoribosyltransferase-knockdown. * represents statistical significance between wild-type and HPRT-deficient cells (Student's t-test).

Functional properties of wild-type and HPRT-knockdown neurons

It is well known that the embryonic carcinoma model of neuronal differentiation (NT2) produces a heterogeneous population of neurons with distinct electrophysiological properties. Nevertheless, we wished to examine whether HPRT deficiency causes noticeable functional differences in the broad population of NT2-derived neurons. Cells identified as neurons on morphological grounds were subjected to patch clamp analysis. To evaluate the ability of cells to elicit an action potential, we examined sodium (Na+) currents by depolarizing voltage steps from a hyperpolarized potential of −90 mV (Figure 5a). Wild-type and HPRT-deficient neurons were indistinguishable in their ability to elicit Na+ currents. In both cases, the evoked Na+ currents could be reversibly blocked by the Na+ channel blocker tetrodotoxin (0.3 µmol/l). The current to voltage (I–V) relation of the recorded Na+ current was characteristic of a voltage-gated Na+ current with the maximum current at voltage step to −20 mV (Figure 5b). These studies demonstrated no significant difference in I–V curves between wild-type and HPRT-deficient neurons. The maximum Na+ currents were further investigated in wild-type and HPRT-deficient cells at 21 and 49 days of differentiation (Figure 5c) and again no differences were apparent in the two cell populations. We also evaluated the presence of ligand-gated ionotropic receptors in wild-type and HPRT-deficient NT2-derived neurons. N-methyl-D-aspartic acid, γ-aminobutyric acid (GABA), and the glutamate agonist kainite all evoked currents in both kinds of neurons, indicating that both glutamate and GABA receptors were expressed and accessible in the same neurons (Supplementary Figure S2a). There was no significant difference in the amplitudes of ligand receptor-mediated currents between wild-type and HPRT-deficient neurons (Supplementary Figure S2b).

Figure 5.

Figure 5

Open in a new tab

Analysis of voltage-gated Na+ currents in wild-type and HPRT-deficient NT2-neuronal cells by whole cell patch clamp recordings. (a) Na+ currents (upper traces) were evoked by incremental 20 mV voltage steps (−60 to +40 mV, bottom traces) from a holding potential of −90 mV. The evoked Na+ currents could be totally abolished by the presence of 0.3 µmol/l TTX (middle traces). (b) The current to voltage (I–V) relation of the evoked Na+ currents was shown for wild-type (closed symbols) and HPRT-deficient (open symbols) NT2 cells on day 49 of RA-induced differentiation. The maximum current was obtained at −20 mV for both cell types. (c) Maximum Na+ currents were measured at 21 (open bars) and 49 days (filled bars) of RA induction in wild-type and HPRT-deficient NT2-neuronal cells. There were no reproducibly significant differences between the wild-type and HPRT-knockdown cells (n = 31). HPRT-Kd, hypoxanthine–guanine phosphoribosyltransferase-knockdown; TTX, tetrodotoxin.

Discussion

Decades of biochemical studies have failed to identify specific mechanisms by which HPRT deficiency produces CNS dysfunction and disruption of normal mechanisms and pathways of nigrostriatal DA function. The working hypothesis underlying the current study is that an initial purine abnormality produced by HPRT deficiency causes downstream transcriptional aberrations of other genes vital for development and function of the DA pathways, including possibly the generation and function of DA neurons themselves. In support of this hypothesis, we have recently published evidence that HPRT deficiency in fact does lead to transcriptional defects in a number of other genes in the striatum of the HPRT-deficient knockout mouse and in human HPRT-deficient fibroblasts,5 but those microarray-based studies failed to identify unequivocally any significant and reproducible transcriptional changes in genes known to have major regulatory roles in the development of the DA pathways.

We have previously proposed the concept of impaired development of DA neurons in HPRT deficiency, but until now there has been no direct experimental evidence for aberrant development of DA neurons in HPRT deficiency. Our present results not only lend the first experimental support to the hypothesis that aberrant development of DA neurons per se may contribute significantly to the pathology of HPRT deficiency in the human, but, even more importantly, we propose that they suggest that a “housekeeping gene” such as HPRT, conventionally considered merely to have important metabolic functions, may also play a vital role in some pathways of mammalian development, including neurogenesis.

The human embryonic carcinoma NT2 neuronal differentiation system is a well-established model for studying molecular events during neurogenesis,13,16,17,18 and the model has provided an opportunity in the present study to determine the effect of HPRT expression on in vitro generation and differentiation of DA neurons and other neural cells. Our results demonstrate that HPRT plays a role in the expression of a number of transcription factors known to be necessary or sufficient for the normal development and function of DA neurons. These factors include members of the LIM family of factors (Lmx1a and Msx1), members of the basic helix-loop-helix family (Ngn2 and Mash1), the forkhead FoxA1 transcription factor, midbrain DA neuronal–specific factors (Nurr1 and Pitx3). The exact mechanisms of action and interaction among these factors have previously been well clarified, particularly in the mouse CNS, and a general picture has emerged of the genetic and cellular mechanisms during development and differentiation of DA and other neurons. It has been shown that Lmx1a and Msx1 act on downstream transcription factors such as the pro-neural basic helix-loop-helix factor Ngn2, and together they are required for determination of the midbrain DA neuronal subtype.6,8 The combined effect of these factors is to upregulate expression of Ngn2 that, in turn, induces the appearance of immature neural progenitor cells but not of fully mature DA neurons. Ngn2 has been reported to cooperate with FoxA1 and Fox A2, to induce expression of Nurr1 that in turn leads to the development of immature DA neurons that are further driven to a more mature DA neuronal phenotype through cooperation with other transcription factors such as Mash1 and Pitx3 (refs. 11,19,20).

Our present results demonstrate that HPRT deficiency affects functions of several key transcription factors at several sites in the DA neuronal development pathway. What is not clarified by our studies is the nature of the effector of these aberrations. Based on the biochemically well-understood role of HPRT in purine salvage metabolism, we hypothesize that HPRT deficiency initially produces still ill-defined aberrations in purine metabolism and purine pools, possibly such as altered intracellular pool sizes of guanine nucleotides. We propose that this or other purine biochemical changes may then lead directly or indirectly to transcriptional aberrations in a variety of genes, including upregulation of FoxA1, Lmx1a, and Msx1. These effects in turn lead to or are associated with overexpression of Ngn2 and downregulation of additional downstream transcriptional factors known to be required for generating DA neurons, such as Mash1 and Nurr1, two factors known to be central to the maturation of midbrain DA neurons.20 Nurr1 expression in developing midbrain precedes the appearance of DA neuronal phenotype, and ectopic expression of Nurr1 in such neural precursor cells is sufficient to establish the DA phenotype.21 However, such Nurr1-induced midbrain DA neuronal cells are functionally immature and require the subsequent expression of Mash1 in order to differentiate into mature and functional DA neurons in developing mouse midbrain.20,21,22 Our results demonstrate that in the NT2 model system, HPRT deficiency downregulates Mash1, Nurr1, and Pitx3, which, in turn, could dysregulate normal mechanisms of DA neuronal development. Interestingly, it has been reported that the Pitx3 knockout mouse demonstrates evidence for defective neuronal projection and resulting abnormal neuronal branching.23,24,25,26

Our studies demonstrate that these aberrations of transcription factor genes in HPRT-deficient cells are associated with the generation of neuron-like cells with altered morphology and with aberrant expression of functions characteristic of DA neurons, including AADC, TH, and VMAT2. Most impressive are what seems to be a suggestion of downregulation in HPRT-deficient cells of TH, the rate-limiting function of DA production, and an even more severe impairment of upregulation of AADC, the function that drives the second and final step in synthesis of DA. Our findings of impaired induction of Nurr1 and Pitx3 expression in HPRT-deficient cells (Figure 1), and markedly impaired upregulation of AADC in HPRT-deficient NT2 cells are consistent with published reports that knockout of Nurr1 or Pitx3 in mice leads to deficient expression of the TH and ADDC genes.27 In contrast, we find that VMAT2 is significantly upregulated in HPRT-deficient NT2 cells. This result differs from the published reports of downregulation of VMAT2 in HPRT-deficient DA cell lines.28 One possible explanation for this discrepancy is suggested by the fact that Ngn2, upregulated in HPRT-deficient NT2 cells in our present study, is also known to induce overexpression of VMAT2 independently of Nurr1 (ref. 9).

We propose that the HPRT-induced dysregulated expression of transcription factor genes vital for the development and maturation of the mammalian DA pathways play an important role in producing abnormalities in the DA pathway that in turn may produce parts of the severe neurological phenotype associated with HPRT deficiency in the human. Although the action of these individual transcription factors is well described in the mouse, the precise combinatorial effects of these varied transcriptional changes in HPRT deficiency in human cells have still to be established.

Along with the transcription factors described above, we have also demonstrated a variety of altered patterns of gene expression for additional transcription factors relevant to pan-neural functions, including NeuroD, Ngn1, FoxA2, and Lmx1b (see Figure 2). Their contributions, if any, to the aberrations of DA neuronal development or function in HPRT deficiency are not clarified by our present study.

Under the current conditions, neurons generated from HPRT-deficient NT2 cells demonstrate an impaired ability to generate long neurites, thereby producing cells with a rounded morphology. Nevertheless, the electrophysiological properties of wild-type and HPRT-deficient neurons generated in the NT2 model are similar, as indicated by analysis of voltage-gated Na+ currents by whole cell patch clamp methods (Figure 5). However, interpretation of these findings is complicated by the fact that the NT2 differentiation model is known to generate a heterogeneous population of neurons and non-neuronal cells. The demonstrated neurite outgrowth and electrophysiological properties of generated neurons have not yet been specifically tied to any specific class of neurons, such as DA neurons of special interest to these studies. Interestingly, we have shown that neurons generated from wild-type and HPRT-deficient NT2 cells demonstrate similar responses to kainite, N-methyl-D-aspartic acid, and GABA (Supplementary Figure S2), suggesting that disordered neurogenesis may affect glutaminergic and GABAergic cells as well.

Our results present experimental evidence that HPRT deficiency plays an important role in pathways that generate DA neurons or other type of neurons in the NT2 model system and, by implication, suggest that similar developmental defects may operate in the development of the basal ganglia DA deficiency in the human HPRT deficiency disorder LND. Although aberrations in the expression of a number of transcription factors associated with DA neuron development are very complex, multiphasic, and time-dependent, these described changes are consistent with an overall mechanism through which parts of the DA neuron developmental program are disrupted and thereby disturb the generation and/or function of midbrain DA neurons. We conclude, at least in the differentiating NT2 model, that, as a result of multiple aberrations of transcription factors required for DA neurogenesis, cells with HPRT deficiency are impeded in their progress along the pathway toward DA neuronal development. We further suggest that the basal ganglia DA deficiency in both the HPRT-deficient human and mouse, at least in part, reflects impaired upregulation of both TH and AADC. Finally, and most generally, we suggest that the classical HPRT “housekeeping” gene fulfills not only its major metabolic catalytic function in purine metabolism but also plays a vital neurodevelopmental role by mechanisms still to be elucidated. By extension, we also suggest that similar important developmental roles may be performed by other “housekeeping” genes in other diseases.

Materials and Methods

Cells. Human NTera2 cl. D/1 (NT2) embryonic carcinoma cells were obtained from ATCC and were grown to ~70% confluence in Dulbecco's modified Eagle's medium (DMEM) high-glucose medium supplemented with 10% fetal calf serum and 50 µg/ml penicillin/streptomycin (Invitrogen, Carlsbad, CA) in 5% CO2 atmosphere. Medium was changed every 2–3 days.

HPRT and control small hairpin oligonucleotide. Small hairpin sequences against HPRT gene were selected using the small interfering RNA hairpin oligonucleotide sequence algorithm (Clontech Laboratories, Mountain View, CA) to generate potential 19-mer sequences direct against target messenger RNAs. The HPRT hairpin oligonucleotides selected for this study were directed toward exon 1 of the HPRT gene (Accession No.: NM_000194) and included the following:

 Sense: 5′ATCCGTGGCCATCTGCTTAGTAGATTCAAGAGATCTACTAAGCAGATGGCCATTTTTTG3′

 Antisense: 5′ATTTCAAAAAATGGCCATCTGCTTAGTAGATCTCTTGAATCTACTAAGCAGATGGCCACG′3. The underlined sequences represent the hairpin loop sequence.

A control shRNA against luciferase provided by Clontech Laboratories was used as control luciferase (Clontech RNAi-Ready pSIREN-RetroQ vector, catalog no. 631526).

HPRT-knockdown vectors. Vesicular stomatitis virus G–pseudotyped retrovirus vectors expressing anti-HPRT hairpin oligonucleotides were produced, isolated and titered on HT-1080 as previously described.29 The hairpin oligonucleotides were cloned into RNAi-Ready pSIREN Moloney leukemia virus–based retrovirus vectors that express shRNA from the human U6 promoter (Clontech Laboratories). Virus packaging was carried out in the packaging cell line GP-293 co-transfected with pSIREN vectors and with plasmid encoding the glycoprotein of vesicular stomatitis virus (pCMV-G).29,30

Infection and selection of HPRT-deficient NT2 cell lines. NT2 cells were infected at a multiplicity of infection of ~1 with the retroviral vectors expressing shRNA targeted either to the HPRT or to the luciferase gene. Infected cells were grown for 10 days in complete DMEM medium containing 3 µg/ml of puromycin. Bulk cultures were replated and maintained in DMEM without puromycin selection for an additional 7 days, after which cells were examined for HPRT expression by transfer to DMEM containing 250 µmol/l 6-thioguanine. The cells infected with HPRT shRNA retrovirus were able to grow and expand in 6-thioguanine, whereas the control cells infected with luciferase shRNA were unable to grow in 6-thioguanine. The HPRT-deficiency phenotype of the selected cells was confirmed using quantitative PCR against HPRT (see Supplementary Table S1).

RA-induced differentiation of NT2 cells. HPRT-deficient NT2 cells as well as the control cells were submitted to RA–induced differentiation using an established aggregation method.15 The cells were trypsinized and plated in 104 cells/ml in 24-well ultra-low attachment plates (Corning, Corning, NY) in complete DMEM medium-10% fetal calf serum. In all subsequent molecular analyses, cells at this undifferentiated stage are designated at day 0. After incubation overnight at 37 °C in a 5% CO2 atmosphere, the aggregated cells were treated with 10 µmol/l of all trans-RA (Sigma, St Louis, MO). The RA–containing medium was replaced every 2–3 days for 14 days. The cells were transferred onto plates or coverslips precoated with 10 µg/ml poly-D-lysine (Chemicon, Temecula, CA) and 10 µg/ml mouse laminin (Sigma) and 0.1% gelatin (Sigma) and maintained in complete DMEM medium supplemented with a mixture of the mitosis inhibitors cytosine D-arabinofuranoside (1 µmol/l) and 10 µmol/l uridine (Sigma and Calbiochem, San Diego, CA, respectively) for 4 days during which time there are few apparent morphological changes in the cells and only a small number of cells displayed a neuron-like morphology. Cells were then transferred to precoated plates (gelatin/poly-D-lysine/ laminin) in DMEM containing the aforementioned mitosis inhibitor mixture for an additional 3–4 days during which time an increasing number of cells demonstrated a neuron-like morphology. The resulting cells were maintained thereafter for up to 6 weeks in DMEM with 5 µmol/l uridine (see Supplementary Figure S1).

RNA isolation and quantitative PCR analysis. At various times of RA differentiation (an early stage at 18 days, an intermediate stage at 21 days, and an advanced stage at 49 days), total RNA was isolated using RNeasy minipreps from control and HPRT-deficient NT2 cells according to the manufacturer's instructions (Qiagen, Hilden, Germany). Two micrograms of the resulting RNA were used for synthesis of complementary DNA using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA) in TaqMan RT buffer (5.5 mmol/l MgCl2, 500 µmol/l dNTP mixture, 2.5 µmol/l random hexamer, 0.4 U/ml RNase inhibitor, and 1.25 U/ml reverse transcriptase in a final volume of 50 µl. The reverse transcription was carried using the following thermal cycling parameters: activation at 25 °C for 10 minutes; reverse transcription at 48 °C for 30 minutes; inactivation at 95 °C for 5 minutes. The synthesized cDNA was then used for qPCR analysis using a Qiagen QuantiTect SYBR Green PCR kit (Qiagen) in the presence of primers (see Supplementary Table S3), designed and prepared using web-based software program, OligoPerfect (Invitrogen). PCR reactions were carried out using the Opticon 2 system DNA engine (BioRad, Hercules, CA) in a total reaction volume of 2 µl in the presence of 200 nmol/l concentrations of each of the primers. Primers specific for the housekeeping gene TATA box binding protein as well as the glyceraldehyde-3-phosphate dehydrogenase were used as standardization and quantitation of controls. Primer sequences are listed in Supplementary Table S3.

Neurite outgrowth. Images of HPRT-deficient and control differentiating cells at 18, 21, and 49 days after onset of RA-induced differentiation were captured at ×20 in a phase-contrast digital format (TIFF) and imported into MetaMorph imaging and morphometric software (Molecular Devices, Downingtown, PA) for neurite length measurements. Neurites <5 pixel length (~5 µm) or those for which starting and ending points were not clearly evident were excluded from the quantification. Neurite lengths were measured in a minimum of 10–15 acquired images using an Arcturus microscope/camera (Molecular Devices, Downingtown, PA) and Matrox Intellicam software (Matrox Imaging, Dorval, Quebec, Canada).

Electrophysiology. Wild-type and HPRT-deficient neuronal cells were bathed at room temperature (25 °C) in an extracellular solution containing 137 mmol/l NaCl, 1 mmol/l NaHCO3, 3.4 mmol/l Na2HPO4, 5.36 mmol/l KCl, 0.44 mmol/l KH2PO4, 3 mmol/l CaCl2, 5 mmol/l 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 22.2 mmol/l glucose, and 0.3 × 10−3 mmol/l tetrodotoxin, pH 7.2. The intracellular solution contained 120 mmol/l CsCl, 20 mmol/l tetraethylammonium chloride, 10 mmol/l 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 2.25 mmol/l ethylene glycol tetraacetic acid, 1 mmol/l CaCl2, and 2 mmol/l MgCl2, pH 7.2. The series resistance was compensated 70–80% using multiclamp 700A patch clamp amplifier circuitry from Molecular Devices (Sunnyvale, CA). Currents were acquired using a Digidata 1322 interface and pClamp 10.1 software (Molecular Devices). Cells were held at a potential of −70 mV and currents were digitally sampled at 10 kHz and filtered at 2 kHz under whole cell patch clamp configuration. To record sodium current, first the cell was hyperpolarized to −90 mV for 300 ms, followed by 100 ms step depolarization from −60 mV to +40 mV at 20 mV intervals. Ligand-evoked currents were measured by adding in the bath 100 µmol/l of kainate, N-methyl-D-aspartic acid, and GABA (all from Sigma).

Statistical analysis. Statistical analysis was carried out using KaleidaGraph graphing and data analysis software package (Synergy Software, Reading, PA). The data are reported as mean ± SE. Student's paired t-test was performed for the different experimental setting of HPRT-deficient cells and control. Statistical significance was set at P < 0.05.

SUPPLEMENTARY MATERIALFigure S1. Scheme and timeline for retinoic acid-induced neuronal differentiation of NT2 cells. Culture conditions are described in Materials and Methods and summarized at bottom of figure.Figure S2. Reponses of ligand-gated receptors in wild type and HPRT-deficient NT2-neurons cells. (A) Responses to 100 μM of kainite, NMDA and GABA were recorded in a wild-type NT2 neuron. The horizontal bar indicates the duration of the ligand application and the holding potential was -70 mV. (B) Comparison of kainite-, NMDA-, and GABA-evoked currents in wild type and HPRT deficient NT2-neurons. There were no apparent significant differences between the two groups (n=25).Figure S3. A possible mechanism of dysregulation of DA pathway in HPRT-deficiency. The upward arrow represents up-regulation while the downward arrow represent down-regulation of the transcription factors. By this scheme, disrupted purine metabolism leads to up-regulation of transcription factor such as Lmx1, Msx1, FoxA1/A2 involved in the early specification DA neurons, which in turn affects the expression of the bHLH Ngn2 transcription factor which is also up-regulated. Down-regulation of Mash1, a transcription factor of the bHLH family, may then be directly related to a compensatory mechanism linked to Ngn2 up-regulation. Down-regulation of Mash1 may directly affect DA-specific transcription factors such Nurr1 and Pitx3 associated with low dopamine and reduced neurite outgrowth, two major features of HPRT-deficiency.Table S1. Relative HPRT gene expression in NT2 cells infected with retroviral vectors encoding small hairpin RNA directed toward luciferase (NT2ShLux) and HPRT (NT2Sh-HPRT) genes. Figures represent arbitrary units of gene expression normalized to GAPDH expression.Table S2. Morphometric analysis of neurite outgrowth measured as neurite length in wild type and HPRT-deficient NT2-derived neurons. Neurite lengths are expressed in micrometer (μm). Statistics, student t Test of wild-type versus HPRT-knock-down.Table S3. Sequences of primers selected by web-based software program OligoPerfect (Invitrogen, Carlsbad, CA).

Supplementary Material

Figure S1.

Scheme and timeline for retinoic acid-induced neuronal differentiation of NT2 cells. Culture conditions are described in Materials and Methods and summarized at bottom of figure.

Click here for supplemental data (36.9KB, pdf)
Figure S2.

Reponses of ligand-gated receptors in wild type and HPRT-deficient NT2-neurons cells. (A) Responses to 100 μM of kainite, NMDA and GABA were recorded in a wild-type NT2 neuron. The horizontal bar indicates the duration of the ligand application and the holding potential was -70 mV. (B) Comparison of kainite-, NMDA-, and GABA-evoked currents in wild type and HPRT deficient NT2-neurons. There were no apparent significant differences between the two groups (n=25).

Click here for supplemental data (21KB, pdf)
Figure S3.

A possible mechanism of dysregulation of DA pathway in HPRT-deficiency. The upward arrow represents up-regulation while the downward arrow represent down-regulation of the transcription factors. By this scheme, disrupted purine metabolism leads to up-regulation of transcription factor such as Lmx1, Msx1, FoxA1/A2 involved in the early specification DA neurons, which in turn affects the expression of the bHLH Ngn2 transcription factor which is also up-regulated. Down-regulation of Mash1, a transcription factor of the bHLH family, may then be directly related to a compensatory mechanism linked to Ngn2 up-regulation. Down-regulation of Mash1 may directly affect DA-specific transcription factors such Nurr1 and Pitx3 associated with low dopamine and reduced neurite outgrowth, two major features of HPRT-deficiency.

Click here for supplemental data (27.3KB, pdf)
Table S1.

Relative HPRT gene expression in NT2 cells infected with retroviral vectors encoding small hairpin RNA directed toward luciferase (NT2ShLux) and HPRT (NT2Sh-HPRT) genes. Figures represent arbitrary units of gene expression normalized to GAPDH expression.

Click here for supplemental data (19.5KB, pdf)
Table S2.

Morphometric analysis of neurite outgrowth measured as neurite length in wild type and HPRT-deficient NT2-derived neurons. Neurite lengths are expressed in micrometer (μm). Statistics, student t Test of wild-type versus HPRT-knock-down.

Click here for supplemental data (28.9KB, pdf)
Table S3.

Sequences of primers selected by web-based software program OligoPerfect (Invitrogen, Carlsbad, CA).

Click here for supplemental data (37.9KB, pdf)

Acknowledgments

This work was supported by the NIH NS04454, NIH DK082840, and by Lesch–Nyhan Syndrome Children's Research Foundation. We gratefully acknowledge Peng Xia and Dongxiang Zhang from the Center for Neuroscience and Aging at the Burnham Institute, La Jolla, CA for assistance with the electrophysiology studies.

REFERENCES

  1. Jinnah HA, De Gregorio L, Harris JC, Nyhan WL., and , O'Neill JP. The spectrum of inherited mutations causing HPRT deficiency: 75 new cases and a review of 196 previously reported cases. Mutat Res. 2000;463:309–326. doi: 10.1016/s1383-5742(00)00052-1. [DOI] [PubMed] [Google Scholar]
  2. Harkness RA, McCreanor GM., and , Watts RW. Lesch-Nyhan syndrome and its pathogenesis: purine concentrations in plasma and urine with metabolite profiles in CSF. J Inherit Metab Dis. 1988;11:239–252. doi: 10.1007/BF01800365. [DOI] [PubMed] [Google Scholar]
  3. Visser JE, Bär PR., and , Jinnah HA. Lesch-Nyhan disease and the basal ganglia. Brain Res Brain Res Rev. 2000;32:449–475. doi: 10.1016/s0165-0173(99)00094-6. [DOI] [PubMed] [Google Scholar]
  4. Smith DW., and , Friedmann T.2000Characterization of the dopamine defect in primary cultures of dopaminergic neurons from hypoxanthine phosphoribosyltransferase knockout mice Mol Ther 15 Pt 1): 486–491. [DOI] [PubMed] [Google Scholar]
  5. Song S., and , Friedmann T. Tissue-specific aberrations of gene expression in HPRT-deficient mice: functional complexity in a monogenic disease. Mol Ther. 2007;15:1432–1443. doi: 10.1038/sj.mt.6300199. [DOI] [PubMed] [Google Scholar]
  6. Burbach JP., and , Smidt MP. Molecular programming of stem cells into mesodiencephalic dopaminergic neurons. Trends Neurosci. 2006;29:601–603. doi: 10.1016/j.tins.2006.09.003. [DOI] [PubMed] [Google Scholar]
  7. Kim HJ, Sugimori M, Nakafuku M., and , Svendsen CN. Control of neurogenesis and tyrosine hydroxylase expression in neural progenitor cells through bHLH proteins and Nurr1. Exp Neurol. 2007;203:394–405. doi: 10.1016/j.expneurol.2006.08.029. [DOI] [PubMed] [Google Scholar]
  8. Smidt MP., and , Burbach JP. How to make a mesodiencephalic dopaminergic neuron. Nat Rev Neurosci. 2007;8:21–32. doi: 10.1038/nrn2039. [DOI] [PubMed] [Google Scholar]
  9. Roybon L, Hjalt T, Christophersen NS, Li JY., and , Brundin P. Effects on differentiation of embryonic ventral midbrain progenitors by Lmx1a, Msx1, Ngn2, and Pitx3. J Neurosci. 2008;28:3644–3656. doi: 10.1523/JNEUROSCI.0311-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Park CH, Kang JS, Yoon EH, Shim JW, Suh-Kim H., and , Lee SH. Proneural bHLH neurogenin 2 differentially regulates Nurr1-induced dopamine neuron differentiation in rat and mouse neural precursor cells in vitro. FEBS Lett. 2008;582:537–542. doi: 10.1016/j.febslet.2008.01.018. [DOI] [PubMed] [Google Scholar]
  11. Ferri AL, Lin W, Mavromatakis YE, Wang JC, Sasaki H, Whitsett JA, et al. Foxa1 and Foxa2 regulate multiple phases of midbrain dopaminergic neuron development in a dosage-dependent manner. Development. 2007;134:2761–2769. doi: 10.1242/dev.000141. [DOI] [PubMed] [Google Scholar]
  12. Andersson EK, Irvin DK, Ahlsiö J., and , Parmar M. Ngn2 and Nurr1 act in synergy to induce midbrain dopaminergic neurons from expanded neural stem and progenitor cells. Exp Cell Res. 2007;313:1172–1180. doi: 10.1016/j.yexcr.2006.12.014. [DOI] [PubMed] [Google Scholar]
  13. Pleasure SJ., and , Lee VM. NTera 2 cells: a human cell line which displays characteristics expected of a human committed neuronal progenitor cell. J Neurosci Res. 1993;35:585–602. doi: 10.1002/jnr.490350603. [DOI] [PubMed] [Google Scholar]
  14. Megiorni F, Mora B, Indovina P., and , Mazzilli MC. Expression of neuronal markers during NTera2/cloneD1 differentiation by cell aggregation method. Neurosci Lett. 2005;373:105–109. doi: 10.1016/j.neulet.2004.09.070. [DOI] [PubMed] [Google Scholar]
  15. Cheung WM, Fu WY, Hui WS., and , Ip NY. Production of human CNS neurons from embryonal carcinoma cells using a cell aggregation method. Biotechniques. 1999;26:946–948. 950–952. doi: 10.2144/99265rr04. [DOI] [PubMed] [Google Scholar]
  16. Ferreira S, Dupire MJ, Delacourte A, Najib J., and , Caillet-Boudin ML. Synthesis and regulation of apolipoprotein E during the differentiation of human neuronal precursor NT2/D1 cells into postmitotic neurons. Exp Neurol. 2000;166:415–421. doi: 10.1006/exnr.2000.7510. [DOI] [PubMed] [Google Scholar]
  17. Satoh J., and , Kuroda Y. Differential gene expression between human neurons and neuronal progenitor cells in culture: an analysis of arrayed cDNA clones in NTera2 human embryonal carcinoma cell line as a model system. J Neurosci Methods. 2000;94:155–164. doi: 10.1016/s0165-0270(99)00143-0. [DOI] [PubMed] [Google Scholar]
  18. Kumar M, Bagchi B, Gupta SK, Meena AS, Gressens P., and , Mani S. Neurospheres derived from human embryoid bodies treated with retinoic acid show an increase in nestin and ngn2 expression that correlates with the proportion of tyrosine hydroxylase-positive cells. Stem Cells Dev. 2007;16:667–681. doi: 10.1089/scd.2006.0115. [DOI] [PubMed] [Google Scholar]
  19. Martinat C, Bacci JJ, Leete T, Kim J, Vanti WB, Newman AH, et al. Cooperative transcription activation by Nurr1 and Pitx3 induces embryonic stem cell maturation to the midbrain dopamine neuron phenotype. Proc Natl Acad Sci U S A. 2006;103:2874–2879. doi: 10.1073/pnas.0511153103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Park CH, Kang JS, Kim JS, Chung S, Koh JY, Yoon EH, et al. 2006Differential actions of the proneural genes encoding Mash1 and neurogenins in Nurr1-induced dopamine neuron differentiation J Cell Sci 119Pt 11): 2310–2320. [DOI] [PubMed] [Google Scholar]
  21. Sakurada K, Ohshima-Sakurada M, Palmer TD., and , Gage FH. Nurr1, an orphan nuclear receptor, is a transcriptional activator of endogenous tyrosine hydroxylase in neural progenitor cells derived from the adult brain. Development. 1999;126:4017–4026. doi: 10.1242/dev.126.18.4017. [DOI] [PubMed] [Google Scholar]
  22. Sonntag KC, Simantov R, Kim KS., and , Isacson O. Temporally induced Nurr1 can induce a non-neuronal dopaminergic cell type in embryonic stem cell differentiation. Eur J Neurosci. 2004;19:1141–1152. doi: 10.1111/j.1460-9568.2004.03204.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jacobs FM, Smits SM, Noorlander CW, von Oerthel L, van der Linden AJ, Burbach JP, et al. Retinoic acid counteracts developmental defects in the substantia nigra caused by Pitx3 deficiency. Development. 2007;134:2673–2684. doi: 10.1242/dev.02865. [DOI] [PubMed] [Google Scholar]
  24. Smits SM, Mathon DS, Burbach JP, Ramakers GM., and , Smidt MP. Molecular and cellular alterations in the Pitx3-deficient midbrain dopaminergic system. Mol Cell Neurosci. 2005;30:352–363. doi: 10.1016/j.mcn.2005.07.018. [DOI] [PubMed] [Google Scholar]
  25. Smidt MP, Smits SM, Bouwmeester H, Hamers FP, van der Linden AJ, Hellemons AJ, et al. Early developmental failure of substantia nigra dopamine neurons in mice lacking the homeodomain gene Pitx3. Development. 2004;131:1145–1155. doi: 10.1242/dev.01022. [DOI] [PubMed] [Google Scholar]
  26. Nunes I, Tovmasian LT, Silva RM, Burke RE., and , Goff SP. Pitx3 is required for development of substantia nigra dopaminergic neurons. Proc Natl Acad Sci U S A. 2003;100:4245–4250. doi: 10.1073/pnas.0230529100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Smits SM, Ponnio T, Conneely OM, Burbach JP., and , Smidt MP. Involvement of Nurr1 in specifying the neurotransmitter identity of ventral midbrain dopaminergic neurons. Eur J Neurosci. 2003;18:1731–1738. doi: 10.1046/j.1460-9568.2003.02885.x. [DOI] [PubMed] [Google Scholar]
  28. Lewers JC, Ceballos-Picot I, Shirley TL, Mockel L, Egami K., and , Jinnah HA. Consequences of impaired purine recycling in dopaminergic neurons. Neuroscience. 2008;152:761–772. doi: 10.1016/j.neuroscience.2007.10.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Guibinga GH, Hall FL, Gordon EM, Ruoslahti E., and , Friedmann T. Ligand-modified vesicular stomatitis virus glycoprotein displays a temperature-sensitive intracellular trafficking and virus assembly phenotype. Mol Ther. 2004;9:76–84. doi: 10.1016/j.ymthe.2003.09.018. [DOI] [PubMed] [Google Scholar]
  30. Yee JK, Miyanohara A, LaPorte P, Bouic K, Burns JC., and , Friedmann T. A general method for the generation of high-titer, pantropic retroviral vectors: highly efficient infection of primary hepatocytes. Proc Natl Acad Sci U S A. 1994;91:9564–9568. doi: 10.1073/pnas.91.20.9564. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1.

Scheme and timeline for retinoic acid-induced neuronal differentiation of NT2 cells. Culture conditions are described in Materials and Methods and summarized at bottom of figure.

Click here for supplemental data (36.9KB, pdf)
Figure S2.

Reponses of ligand-gated receptors in wild type and HPRT-deficient NT2-neurons cells. (A) Responses to 100 μM of kainite, NMDA and GABA were recorded in a wild-type NT2 neuron. The horizontal bar indicates the duration of the ligand application and the holding potential was -70 mV. (B) Comparison of kainite-, NMDA-, and GABA-evoked currents in wild type and HPRT deficient NT2-neurons. There were no apparent significant differences between the two groups (n=25).

Click here for supplemental data (21KB, pdf)
Figure S3.

A possible mechanism of dysregulation of DA pathway in HPRT-deficiency. The upward arrow represents up-regulation while the downward arrow represent down-regulation of the transcription factors. By this scheme, disrupted purine metabolism leads to up-regulation of transcription factor such as Lmx1, Msx1, FoxA1/A2 involved in the early specification DA neurons, which in turn affects the expression of the bHLH Ngn2 transcription factor which is also up-regulated. Down-regulation of Mash1, a transcription factor of the bHLH family, may then be directly related to a compensatory mechanism linked to Ngn2 up-regulation. Down-regulation of Mash1 may directly affect DA-specific transcription factors such Nurr1 and Pitx3 associated with low dopamine and reduced neurite outgrowth, two major features of HPRT-deficiency.

Click here for supplemental data (27.3KB, pdf)
Table S1.

Relative HPRT gene expression in NT2 cells infected with retroviral vectors encoding small hairpin RNA directed toward luciferase (NT2ShLux) and HPRT (NT2Sh-HPRT) genes. Figures represent arbitrary units of gene expression normalized to GAPDH expression.

Click here for supplemental data (19.5KB, pdf)
Table S2.

Morphometric analysis of neurite outgrowth measured as neurite length in wild type and HPRT-deficient NT2-derived neurons. Neurite lengths are expressed in micrometer (μm). Statistics, student t Test of wild-type versus HPRT-knock-down.

Click here for supplemental data (28.9KB, pdf)
Table S3.

Sequences of primers selected by web-based software program OligoPerfect (Invitrogen, Carlsbad, CA).

Click here for supplemental data (37.9KB, pdf)

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES