Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2010 Jan 5;18(3):635–642. doi: 10.1038/mt.2009.295

Inhibition of Tumor Growth and Metastasis by a Combination of Escherichia coli–mediated Cytolytic Therapy and Radiotherapy

Sheng-Nan Jiang 1,2, Thuy X Phan 3, Taek-Keun Nam 4, Vu H Nguyen 1,2, Hyung-Seok Kim 5, Hee-Seung Bom 2, Hyon E Choy 3, Yeongjin Hong 3, Jung-Joon Min 1,2,6
PMCID: PMC2839435  PMID: 20051939

Abstract

We have reported that Escherichia coli K-12 colonizes hypoxic and necrotic tumor regions after intravenous injection into tumor-bearing mice. In this study, we established a novel strategy for cancer therapy using engineered bacteria to enhance the therapeutic effects of radiation. E. coli strain K-12 was engineered to produce cytolysin A (ClyA), and its effects on tumor growth in primary and metastatic tumor models were evaluated. A single treatment with E. coli–expressing ClyA significantly decreased tumor growth rates initially (9 days after treatment); however, the tumors tended to grow thereafter. With only radiotherapy (RT; 21 Gy), the tumor growth rates were retarded, but not the tumor sizes. A combination of therapy with E. coli–expressing ClyA and radiation [a total of 5 × 107 colony-forming units (CFU) and 21 Gy] resulted in significant tumor shrinkage and even complete disappearance of tumors in mice with tumors derived from murine CT26 colon cancer. Furthermore, treatment with E. coli–expressing ClyA markedly suppressed metastatic tumor growth and prolonged the survival time in mice. The results described here indicate that therapy with engineered E. coli could significantly improve the results of RT, and could exert a striking inhibitory effect on the development of lung metastasis.

Introduction

Radiotherapy (RT) was the first effective adjuvant treatment for cancer, and numerous improvements over the past several decades have made it a mainstay of oncology. However, hypoxic cells in malignant tumors are often resistant to RT.1 Experimental studies have shown that hypoxic cells are up to three times more resistant to ionizing radiation than normoxic cells.2,3 On the basis of this information, intensive studies are currently underway to develop new strategies with synergistic therapeutic effects when combined with ionizing radiation.3,4,5

The long-term efficacy of current anticancer treatments involving cytotoxic genes and drugs remains unsatisfactory. This is partly due to inadequate methods of delivery to the tumor sites and/or poor selectivity for tumor cells. The problem is compounded by the fact that newly formed blood vessels in tumors are highly disorganized, with incomplete endothelial linings and blind loops, resulting in sluggish blood flow and inefficient delivery of nutrients and oxygen to regions within the tumor tissues. This leads to the formation of multiple regions of hypoxia or anoxia.2 Thus, new delivery methods, including the use of viral or other vectors, are being developed for selective tumor targeting.6,7

Certain strains of bacteria such as Escherichia coli,8,9,10 Salmonella,10,11,12,13 and Clostridium14,15 selectively colonize and grow in tumors. A number of recent reports have demonstrated that bacteria are capable of targeting both primary tumors and metastases,8,9,10,16 and this feature is being exploited for tumor-selective drug delivery.7,17,18,19,20 To facilitate the monitoring of these strains in vivo, bacteria have been engineered to express reporter genes encoding bioluminescent8,9,10 or fluorescent12,21 products. These enable investigators to track migration patterns and determine the fates of the bacteria in ways that are simple, noninvasive, and amenable to repeated observations. Previously, we8 and others11,16 reported that facultative anaerobic bacteria such as E. coli and attenuated strains of Salmonella typhimurium were located in hypoxic and necrotic areas rather than peripheral proliferative areas of tumors. This suggested that the hypoxic regions of solid tumors could be targeted for treatments using genetically engineered E. coli or Salmonellae that carry therapeutic molecules.

In the present study, we engineered E. coli strain K-12 (MG1655), a nonpathogenic commensal bacterium, to produce the cytotoxic protein cytolysin A (ClyA) for killing tumor cells, and the bacterial luciferase (Lux) operon for imaging infected tissues. ClyA is a 34 kd pore-forming hemolytic protein that is produced by E. coli and Salmonella enterica serova Typhi and Paratyphi A.22 This toxin is transported to the bacterial surface and secreted without post-translational modification.22 Due to its pore-forming activity, ClyA is cytotoxic toward cultured mammalian cells (Supplementary Figure S1) and induces macrophage apoptosis.23,24 This suggests that E. coli engineered to produce ClyA might have the potential to enhance the therapeutic effects of radiation by killing hypoxic regions of tumors, which are resistant to RT due to low oxygen availability. We employed well-characterized mouse models of both primary tumor development and metastasis establishment, involving CT26 colon cancer cells, to investigate the efficacy of engineered bacterial therapy (BT). Here we report that engineered E. coli exerts a striking inhibitory effect on metastasis development. We also show that a combination of BT and RT significantly reduces the rate of tumor growth and prolonged the survival time in mice.

Results

Engineering of E. coli strain K-12 to express and secrete ClyA

We engineered E. coli strain K-12 (MG1655) to express the genes encoding ClyA and/or bacterial luciferase (Lux). In the absence of selection, very few E. coli cells maintained the plasmid, especially in infected animals (see later text). Therefore, we employed a balanced-lethal host-vector system using the gene encoding aspartate β-semialdehyde dehydrogenase (Asd).25 E. coli asd mutants have an obligate requirement for diaminopimelic acid and undergo lysis in its absence. In order to retain plasmids in vivo, the chromosomal copy of Asd in the host strain was mutated and complemented by a vector carrying both the Asd gene and the Lux gene (Asd+pLux; pALux) or the Asd gene and the ClyA gene (Asd+pClyA; pAClyA).8,25,26,27

E. coli K-12 was first transformed with pUC19 containing the Lux gene (pALux), and the bioluminescent signal in the transformed bacteria was detected using a cooled charge-coupled device camera (Xenogen-IVIS 100; Caliper, Hopkinton, MA). A selected clone was subsequently transformed with pAClyA (Figure 1a). Western blot analysis using an anti-ClyA antibody revealed that a 34-kd protein corresponding to ClyA was present in the bacterial pellet and the culture medium, indicating that ClyA was successfully expressed, and the ClyA protein secreted from the engineered E. coli (Figure 1b). This protein was not present in the control cells transformed with a vector carrying only the Asd gene (pAsd). As shown in Figure 1c, E. coli producing Lux and ClyA can lyse blood cells (left) and give a clear bioluminescent signal in areas corresponding to the hemolysis (right).

Figure 1.

Figure 1

Open in a new tab

Engineering of E.coli k-12 to express and secrete cytolysin A. (a) Map of the bacterial expression plasmid containing the gene encoding aspartate β-semialdehyde dehydrogenase (Asd) and the cytolysin A gene (pAClyA). (b) The E. coli asd::kan strain (HJ1020) was transformed with pAClyA (E. coli pAClyA) or the empty vector containing only the Asd gene (pAsd). The expression and secretion of ClyA (34 kd) was analyzed by western blot using an anti-ClyA antibody. Bacterial pellets (left) and culture media (right) were analyzed. (c) E. coli–expressing ClyA and Lux can lyse blood cells (left) and produce a clear bioluminescent signal in the corresponding area of hemolysis (right).

Engineered E. coli target subcutaneously implanted tumors and produce ClyA

We injected the E. coli K-12 cells carrying pALux and pAClyA [5 × 107 colony-forming units (CFU)] intravenously into immunocompetent BALB/c mice-bearing syngeneic tumors derived from CT26 colon carcinoma cells. Expression of the Lux gene was monitored using the cooled charge-coupled device camera. The bacterial bioluminescent signal was detected only in tumors of the injected mice (Figure 2a). These results indicated that the genetically engineered bacteria maintained their ability to target tumors. Western blot analysis of excised tumor tissues indicated that the ClyA protein was present in tumors colonized by E. coli carrying the pAClyA vector, but not in tumors colonized by control E. coli carrying the pAsd vector (Figure 2b). We also examined the expression of ClyA in the tumors using histological analyses. The ClyA protein was identified in areas between the necrotic and proliferative tumor regions, which were revealed by immunohistochemical and immunofluorescence staining (Figure 2c). Taken together, these results provide strong evidence that engineered E. coli cells selectively target tumors and can express a gene of interest in the hypoxic tumor tissues.

Figure 2.

Figure 2

Open in a new tab

Genetically engineered E. coli can target and deliver ClyA to subcutaneously grafted CT26 tumors. (a) Noninvasive in vivo imaging of bacterial bioluminescence in the targeted tumors of representative tumor-bearing mice (n = 2). (b,c) Detection of the 34-kd ClyA protein in CT26 tumor tissues of mice injected with E. coli–expressing ClyA (E. coli pAClyA). The ClyA protein was detected (b) using western blot analysis, and (c) by immunohistochemical and immunofluorescence staining. ClyA, cytolysin A.

Tumor suppression by engineered E. coli–expressing ClyA

To determine the effect of engineered E. coli–expressing ClyA on tumor growth, immunocompetent BALB/c mice were injected subcutaneously with murine CT26 colon carcinoma cells to create primary tumors. Subsequently, tumor-bearing mice were treated with intravenous injections of phosphate-buffered saline (PBS), control E. coli K-12-bearing empty vector (pAsd), or engineered E. coli K-12 bearing the pAClyA vector (5 × 107 CFU). A notable retardation of tumor growth was observed in mice that received the engineered E. coli (E. coli pAClyA) compared with control groups. However, the tumors tended to continue growing at a delayed rate, indicating that treatment with E. coli producing ClyA by itself was insufficient for a complete eradication of the tumors (Figure 3a,b). E. coli carrying empty vector showed little tumor suppression effect. Histological analyses revealed extensive central necrosis in the tumors of mice injected with E. coli carrying pAClyA. However, in control groups, only focal tumor necrosis was noted (arrows) (Figure 4).

Figure 3.

Figure 3

Open in a new tab

Suppression of tumor growth by engineered E. coli–expressing ClyA. BALB/c mice (n = 15) were inoculated subcutaneously with 106 CT26 cells. When the tumor reached ~150 mm3 in volume or ~10 mm in a diameter, they were injected with PBS or bacteria. (a) Photographs of subcutaneous tumors in mice injected with PBS (control), or 5 × 107 CFU of E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA). Photographs of representative tumors were taken at 12, 17, 21, and 27 days after injection. (b) Effects of the injections of PBS, E. coli pAsd, or E. coli pAClyA on CT26 tumor growth rates (n = 5 each group, *P < 0.05). CFU, colony-forming units; ClyA, cytolysin A; PBS, phosphate-buffered saline.

Figure 4.

Figure 4

Open in a new tab

Histologic examination of syngeneic CT26 before and after treatment. H&E stain of syngeneic CT26 tumor 4 days after intravenous injection of PBS (control), or 5 × 107 CFU of E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA) (bar = 1 mm). CFU, colony-forming units; H&E, hematoxylin–eosin; PBS, phosphate-buffered saline.

Tumor suppression by engineered E. coli when given in combination with RT

To evaluate the tumor suppression effects of combining BT with RT, CT26-bearing BALB/c mice were treated with radiation and injected with E. coli carrying pAClyA. First, we tried a single dose of engineered E. coli (5 × 107 CFU) in combination with various doses of radiation (0, 8, 15, 21 Gy). The combination of this BT with 21 Gy of radiation resulted in remarkable tumor shrinkage and the complete eradication of the CT26 tumors (Figure 5a,b). This shrinkage was clearly evident in photographs of the tumors (Figure 5a). A combination therapy involving 8 or 15 Gy of radiation resulted in significant tumor shrinkage, however, the tumors tended to begin regrowth at ~15 days after bacterial injection (Figure 5b). In the second trial, we used a single radiation dose of 21 Gy and injected various doses of engineered E. coli (0, 5 × 106, 1 × 107, and 5 × 107 CFU). In the group that received RT only, tumor growth was retarded but not significantly suppressed (Figure 5c). After injecting the two lower doses of engineered E. coli (5 × 106 and 1 × 107 CFU), tumor growth was also retarded but not significantly suppressed. The higher dose of engineered E. coli (5 × 107 CFU), in combination with radiation (21 Gy), resulted in complete suppression of tumor growth and elimination of the tumors. The survival was significantly prolonged in the group received combined therapy than in the group that received RT only (Figure 5d).

Figure 5.

Figure 5

Open in a new tab

Effects of combining engineered E. coli therapy with radiation in CT26-bearing mice. BALB/c mice were inoculated subcutaneously with 106 CT26 cells. (a) Photographs of subcutaneous tumors in mice treated with PBS (no treatment) or with a combination of bacteria (BT; 5 × 107 CFU of E. coli pAClyA) and radiation (RT; 21 Gy). Photographs of representative tumors were taken at 12–42 days after the beginning of treatments. (b) Effects on the growth rates of CT26 tumors after treatment with E. coli–expressing ClyA (BT; 5 × 107 CFU) combined with various doses of radiotherapy (RT; 0, 8, 15, 21 Gy). PBS only (filled square), BT only (open square), RT (8 Gy) + BT (filled circle), RT (15 Gy) + BT (open circle) and RT (21 Gy) + BT (filled triangle). (c) Effects on the growth rates of CT26 tumors after treatment with radiation (RT; 21 Gy) and various doses of E. coli–expressing ClyA (0–5 × 107 CFU). PBS only (filled square), RT only (open square), BT (5 × 106 CFU) + RT (filled circle), BT (1 × 107 CFU) + RT (open circle), and BT (5 × 107 CFU) + RT (filled triangle) (n = 5 each group). (d) Kaplan–Meier survival curves between RT (21 Gy) and RT (21 Gy) + BT (5 × 107 CFU) are shown (n = 5 each group). *P < 0.05, **P < 0.01. BT, bacterial therapy; CFU, colony-forming units; PBS, phosphate-buffered saline; RT, radiotherapy.

We next tested two other tumor models, mouse melanoma (B16F10) and murine mammary 4T1 adenocarcinoma, to determine whether engineered E. coli could enhance the effects of RT (21 Gy) on these cancers. Both cell lines were partially responsive to E. coli–expressing ClyA when used alone, and to radiation when used alone. When the therapies were used in combination, the engineered E. coli (5 × 107 CFU) enhanced the effects of RT (Figure 6a,b).

Figure 6.

Figure 6

Open in a new tab

Effects of combining engineered E. coli therapy with radiation in B16F10 and 4T1-bearing mice. Nude mice or BALB/c mice were inoculated subcutaneously with 106 B16F10 cells or 106 4T1 cells, respectively. Effects on (a) B16F10 and (b) 4T1 tumor growth after treatment with E. coli–expressing ClyA (5 × 107 CFU) and/or radiation (21 Gy). Controls were treated with PBS (open circle). BT, treatment with E. coli–expressing ClyA only (circle); RT, radiotherapy only (triangle); RT + BT, combination therapy with radiation and E. coli–expressing ClyA (square). (n = 5 each group, *P < 0.05, **P < 0.01). BT, bacterial therapy; CFU, colony-forming units; ClyA, cytolysin A; PBS, phosphate-buffered saline; RT, radiotherapy.

Inhibition of lung metastasis by E. coli–expressing ClyA

Because metastasis is the leading cause of death in cancer patients, we then induced lung metastasis experimentally to see whether or not the engineered E. coli could affect metastatic growth. This assay involved injecting CT26 cells, which stably expressed firefly luciferase, into the tail veins of mice. Metastasis establishment in the lungs was observed using a cooled charge-coupled device camera. The mice were also intravenously injected with PBS, E. coli carrying empty vector, or E. coli carrying the ClyA vector at day 5 after the cancer cells were injected. In intact mice, the cellular bioluminescence was detected specifically in metastatic lung lesions (Figure 7a). The metastatic lesions were also observed using bioluminescence imaging of isolated organs (Figure 7b). Bioluminescence from metastatic nodules was significantly reduced in mice treated with engineered E. coli (E. coli pAClyA), compared with the empty vector and the PBS controls (Figure 7a,b, P < 0.01). The effects of BT were also evaluated by measuring the weights of isolated lungs, by the metastasis scoring method,28 and by Kaplan–Meier survival curve. The treatment with engineered E. coli–expressing ClyA markedly suppressed metastatic tumor growth (Figure 7c,d, P < 0.05) and prolonged the survival time (Figure 6e, P < 0.01), when compared with the control treatments. The results of treatment with E. coli carrying the empty vector were not significantly different from those of the PBS treatment (P = 0.525 for lung weight, P = 0.548 for metastasis score). This indicated that the presence of E. coli by itself in metastatic tumors had no antitumor effects.

Figure 7.

Figure 7

Open in a new tab

Effects of E. coli–expressing ClyA on lung metastases. BALB/c mice were injected with CT26 cells that were stably producing firefly luciferase. Mice were intravenously injected with engineered (E. coli pAClyA) or nonengineered bacteria (E. coli pAsd), or PBS at day 5 after the cancer cells were injected. The cooled CCD camera was used to analyze metastasis establishment in lungs of the mice after intraperitoneal injection of 3 mg of D-luciferin per animal. (a) Bioluminescence images of lung metastasis development in mice at 4, 7, and 11 days after each treatment. (b) Lungs were excised from the mice 6 days after the treatments. Top: photographs of representative lungs. Bottom: bioluminescence images of the same lungs. (c) Lung weights and (d) metastasis scores were measured in the mice 6 days after each treatment (n = 3 each group). (e) Kaplan–Meier survival curves are shown (n = 8 each group). *P < 0.05, **P < 0.01. CCD, charge-coupled device; ClyA, cytolysin A; PBS, phosphate-buffered saline.

Discussion

In the present study, we evaluated the therapeutic effects of injection of engineered bacteria, in combination with RT, on primary tumor growth and metastasis in mouse tumor models. The results described above indicate that engineered E. coli carrying ClyA can significantly improve the results of RT, and can exert a striking inhibitory effect on the development of lung metastasis.

The improved antitumor effects of engineered E. coli in combination with RT suggest that this strategy could allow patients to be treated with lower doses of radiation than those used in current clinical practice. This could reduce the negative effects of radiation on normal tissues. For a gross tumor, conventional RT is usually given on a fractionated schedule with a daily fraction of 1.8–2 Gy for 7–8 weeks, and a cumulative total dose of up to 65–70 Gy.29 Theoretically, if a tumor follows a typical cell-survival curve and there are no changes in tumor oxygenation or in the accelerated repopulation of tumor cells, we would need a minimum cumulative dose of 60 Gy with a 2 Gy fraction to completely remove a tumor of 1 cm diameter, containing about 109 cells.30 In the present study, totals of 21 Gy were delivered to tumors of ~1 cm diameter, using 7 Gy fractions that were delivered three times at 4-day intervals. This cumulative dose of 21 Gy with a 7 Gy fraction is biologically equivalent to about 30 Gy with a 2 Gy fraction, and is far less than the curable dose of 60 Gy with a 2 Gy fraction. The 21 Gy of radiation alone failed to suppress tumor growth (Figure 5). However, administration of the engineered E. coli significantly enhanced the therapeutic effect of radiation, resulting in the complete suppression of tumor growth.

The preferential accumulation of E. coli in tumors could be exploited to improve the efficiency of gene delivery. Previous reports have shown that strains of S. typhimurium, Listeria monocytogenes, and E. coli can be utilized to deliver short hairpin RNA,19 DNA,31 immunomodulatory proteins,17,28 cytotoxic proteins,18 and prodrugs32 to tumors. Ryan et al. used attenuated S. typhimurium to deliver a cytolysin gene, whose expression was restricted to the hypoxic regions of 4T1 tumors, using a FNR-responsive promoter.18 In that study the mean tumor volumes were decreased by 43% within 10 days. Similar results were obtained in the present study. The 4T1 tumor-bearing mice injected with E. coli–expressing ClyA showed partial retardation of tumor growth when BT was used alone, and when BT was used in combination with RT, tumor growth was significantly inhibited. Furthermore, this combination therapy showed a striking effect on mice with murine colon cancer (CT26). Hoffman and colleagues have exploited the nutritional needs of S. typhimurium to target and kill tumor cells33,34,35. They selected strains of S. typhimurium that are dependent on the presence of the amino acids leucine and arginine for growth. This strain was applied to treat many types of metastatic cancers in mouse models and observed regression of tumor after intravenous administration.36,37,38,39

The destruction of necrotic tissues is a hallmark response in colonized tumors that may also be a result of host defense mechanisms against invading bacteria, due to indirect tissue destruction by specific immune cells. In our previous microscopic analysis,8 high densities of bacteria were found in the border regions between the peripheral proliferative and central necrotic regions of tumors, but such high densities were not observed in the peripheral proliferative regions of the tumors. Weibel et al.16 described large areas of necrosis in colonized tumors that were presumably triggered by bacterial-activated tumor necrosis factor α-producing M1 macrophages. The engineered E. coli in this study exaggerated the enlargement of tumor necrosis, through secretion of the cytotoxic protein ClyA (Figure 4). However, the restriction of bacterial colonization to the hypoxic regions may lead to insufficient destruction of the rapidly proliferating tumor tissues. This may explain why the therapeutic effect was exacerbated by RT, which would destroy the remaining normoxic area.

Tumor metastasis is the primary cause of mortality in cancer patients. BT might be clinically more acceptable in cancer patients with distant metastases rather than in patients with only primary tumors. Our current results revealed that treatment with E. coli–expressing ClyA markedly suppressed metastatic tumor growth and prolonged the survival time in lung metastasis models. Yu et al.10 also observed that bacteria are naturally capable of targeting small metastatic nodules, as small as 0.5 mm3, on the surfaces of the lungs in tumor-bearing mice. Consistently, other studies17,28,36,37,38,39,40,41 have revealed that diverse strains of S. typhimurium markedly suppressed metastatic tumor growth.

Another encouraging feature of the BT used in this study is that we obtained positive tumor suppression using E. coli strain K-12 (MG1655), which is a canonical E. coli strain. Its entire chromosomal DNA sequence is available42 and it is far less virulent than other facultative anaerobic bacteria, such as S. typhimurium. The observed body weight of treated mice was not significantly different from that of control group (Supplementary Figure S2). We are currently testing E. coli strains expressing cytotoxic proteins under the control of diverse promoters that are preferentially activated inside tumors.

In conclusion, we describe here a novel cancer treatment involving BT, utilizing E. coli strain K-12 engineered to produce a cytotoxic protein, in combination with RT. Because bacteria can be produced cost-effectively, such a treatment might provide an alternative treatment for clinical use, particularly in advanced cancer patients with multiple metastases.

Materials and Methods

Cell lines. The murine CT26 colon carcinoma cells, 4T1 mammary carcinoma cells, and B16F10 melanoma cells were obtained from the American Type Culture Collection (CRL-2638, 2539, and 6475, respectively; Rockville, MD). The CT26 and 4T1 cells were grown in high-glucose Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and 1% penicillin–streptomycin. The murine B16F10 melanoma cells were grown in RPMI 1640, containing 10% fetal bovine serum and 1% penicillin–streptomycin.

Bacterial strains and plasmids. The bacterial strains and plasmids used in this study are summarized in Table 1. Bacterial strains were constructed using P1 transduction as described previously.8,9,43 The E. coli asd::kan strain (HJ1020) was constructed from MG1655 by the linear DNA transformation method as described previously.44 PCR amplification of pKD13 was used to replace the Asd open reading frame with the Kan gene. The primers were: forward, 5′-CACTTGCGACTTTGGCTGCTTTTTGTATGGTGAAAGATGTGCCAAGAGGAGACCGGCACATTTATACAGCACGTGTAGGCTGGAGCTGCTTC-3′ and reverse, 5′-CCCTTAAAGAATAGCCAATGCTCTATTTAACTCCCGGTAAATCATGAAACATCTGCGCTTACTCCTGTATTACGCTTCCGGGGATCCGCTGACC-3′. The Kan gene was then removed to generate Δasd according to the method described by Datsenko and Wanner.44

Table 1.

E. coli strains and plasmids

graphic file with name mt2009295t1.jpg

Open in a new tab

The expression vector for ClyA was constructed as follows. The ClyA gene was amplified from S. typhi genomic DNA45 using the forward primer 5′AGTCCATGGTTATGACCGGAATATTTGC and the reverse primer 5′GATGTTTAAACTCAGACGTCAGGAACCTC. The PCR product was cloned directly into the pGEM-T Easy vector (Promega, Madison, WI) to generate pClyA. In order to construct a plasmid containing both the ClyA cassette and the Asd gene,26 we PCR-amplified Asd from S. typhimurium genomic DNA using the primers ASD1 (5;-CGCGCAGGGCCCGCACATCTCTTTGCAGGAAAA-3′) and ASD2 (5′-CTGCAAGCATGCCTACGCCAACTGGCGCAGCAT-3′). This 1.1-kb fragment was cloned into the pGEM-T Easy vector, then digested with ApaI and SphI and ligated into the same site in pClyA, resulting in the construct pAClyA.

The luciferase-expressing plasmid pLux was constructed as described previously.8,9

Animal models. Five- to six-week-old male BALB/c and BALB/c athymic nu−/nu− mice (20–30 g body weight) were purchased from the Orient Company (Seongnam, Korea). All animal care, experiments, and euthanasia were performed in accordance with protocols approved by the Chonnam National University Animal Research Committee (Gwangju, Korea). Anesthesia was performed using isoflurane (2%) for imaging or a mixture of ketamine (200 mg/kg) and xylasine (10 mg/kg) for RT. BALB/c mice carrying subcutaneous tumors were generated as follows: CT26, 4T1, and B16F10 cells were harvested and then 106 cells were suspended in 100 µl PBS and injected subcutaneously into the right thigh of each mouse. Tumor volumes (mm3) were estimated using the formula (L × H × W)/2 where L is the length, W is the width, and H is the height of the tumor in millimeters.10

Radiotherapy. RT was commenced when the subcutaneous tumor reached ~10 mm in a longest diameter or 150 mm3 in volume. A 6-MV X-ray was used via a linear accelerator (CLINAC 21EX; Varian, Palo Alto, CA). The source to skin distance was 100 cm with a field size of 5 × 5 cm2 with a dose rate of 3 Gy/minute. Water equivalent boluses of 1 cm thickness were placed under and above the mouse thigh bearing the tumor to establish dose homogeneity. Radiation was delivered using two AP/PA parallel opposing fields. To assess the tumor regression effects of different radiation doses, we irradiated tumors in fractions of 4, 5, and 7 Gy, reaching total doses of 8, 15, and 21 Gy, respectively. RT was performed every 4 days until the total doses were reached. Bacteria were injected 1 day after the first RT.

Western blot analysis. Total proteins (40 µg) were separated by electrophoresis and blotted as described previously.46 For the analysis of ClyA in tumor tissues, homogenized tissue samples were standardized according to protein content, and samples of 200 µg protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 12% linear gradient gels. Proteins were transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA), and the membranes were first probed using a mouse anti-ClyA monoclonal antibody (1:250 dilution), and then a horseradish peroxidase-conjugated anti-rabbit secondary antibody (1:2,000 dilution) (Amersham, UK). Immunoreactive proteins were detected using luminol reagent (Santa Cruz Biotechnology, Santa Cruz, CA).

Histopathological study. All the mice were anesthetized and perfused transcardially with 4% paraformaldehyde in PBS. The tumor was removed, fixed in the same solution overnight at room temperature. The tumors were blocked in longitudinal section and processed for paraffin embedding. Representative sections were sliced into 4-µm thickness sections and stained with hematoxylin–eosin. Tumor necrosis areas were measured using a DXM1200 digital camera system (Nikon, Tokyo, Japan) mounted on a Nikon microscope (Nikon 80i; Nikon, Tokyo, Japan).

Briefly, for immunohistochemistry, 4-µm thick paraffin-embedded tissue sections were collected on aminopropyltriethoxysilane-coated slides and immunostained with the avidin–biotin conjugation method using Sequenza Rack (Shandon, UK).47 Pretreatment of tissues with heat-induced epitope retrieval was carried out for 5 minutes at 125 °C pressure cooker in 10 mmol/l citrate buffer, pH 6.0. Endogenous peroxidase activity was blocked by incubating samples in PBS (pH 7.4) containing 1.5% H2O2. The slides were incubated with primary antibody, rabbit anti-ClyA (1:80, distributed by Y.H.48) overnight at 4 °C, followed by incubation with anti-rabbit immunoglobulin G labeled with biotin (Sigma, St Louis, MO), at room temperature for 80 minutes. Subsequently, streptavidin-horseradish peroxidase (Dako, Glostrup, Denmark) detection system was applied. For immunofluorescent staining, Alexa Fluor 488 chicken anti-rabbit (1:100, Invitrogen) was used as a secondary antibody. The samples were stained with TexasRed-X phalloidin (Invitrogen, Eugene, OR) and DAPI/Antifade (1:200; Invitrogen). Images of immunohistochemically labeled or fluorescently immunolabeled sections were acquired using a Nikon 80i microscope (Nikon). Images were captured using Cell-P imaging software (Olympus, Tokyo, Japan) in both the fluorescein isothiocyanate and tetramethylrhodamine isothiocyanate channels.

Optical bioluminescence imaging. To obtain images of bacterial bioluminescence, anesthetized animals were placed in a light-tight chamber of the IVIS100 imaging system (Caliper), equipped with a cooled charge-coupled device camera. Photons emitted from luciferase-expressing bacteria were collected and integrated over 1-minute periods. Pseudocolor images indicating photon counts were overlaid on photographs of the mice using the Living Image software v. 2.25 (Caliper). A region of interest was selected manually based on the signal intensity. The area of the region of interest was kept constant, and the intensity was recorded as maximum radiance within each region of interest.

Statistical analyses. Two-tailed Student's t-tests were used to determine the statistical significances of differences in primary tumor growth between control and treatment groups. A P value < 0.05 was considered significant for all analyses. The survival analysis was performed using the Kaplan–Meier curve and log-rank test. All data are expressed as means ± SD.

SUPPLEMENTARY MATERIALFigure S1. In vitro CT26 cell death after administration of bacterial culture medium. CT26 mouse colon cancer cells were grown in 24-well tissue culture plates to a density of 105 cells per well. E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA) were grown in LB and harvested at late-logarithmic phase. Bacteria were removed by filtration. Then, the bacterial filtrate (50 μl) was added to cultured CT26 cells and incubated for 24 hours. Microscopic observation revealed significant cell death following addition of the filtrate of E. coli pAClyA (b), but not with that of E. coli pAsd (a). Western blot analysis revealed that a ClyA protein was present only in the culture medium of E. coli pAClyA, not in that of E. coli pAsd, indicating the ClyA protein was expressed and secreted from the E. coli pAClyA (see Figure 1b).Figure S2. Body weight changes in CT26-bearing mice treated with PBS, or E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA).

Supplementary Material

Figure S1.

In vitro CT26 cell death after administration of bacterial culture medium. CT26 mouse colon cancer cells were grown in 24-well tissue culture plates to a density of 105 cells per well. E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA) were grown in LB and harvested at late-logarithmic phase. Bacteria were removed by filtration. Then, the bacterial filtrate (50 μl) was added to cultured CT26 cells and incubated for 24 hours. Microscopic observation revealed significant cell death following addition of the filtrate of E. coli pAClyA (b), but not with that of E. coli pAsd (a). Western blot analysis revealed that a ClyA protein was present only in the culture medium of E. coli pAClyA, not in that of E. coli pAsd, indicating the ClyA protein was expressed and secreted from the E. coli pAClyA (see Figure 1b).

Click here for supplemental data (17.2MB, tiff)
Figure S2.

Body weight changes in CT26-bearing mice treated with PBS, or E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA).

Click here for supplemental data (2.4MB, tiff)

Acknowledgments

We gratefully acknowledge the excellent technical assistance of Jae-Man Yoo (Department of Radiation Oncology) for radiotherapy. This research was supported by the Bio R&D program through the Korean Science and Engineering Foundation funded by the Ministry of Education, Science and Technology (2008-04131); the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (No. 2009-0091729); the National R&D Program for Cancer Control (0620330-1); the Ministry of Health & Welfare, Republic of Korea. Y.H. was supported by grant no. RTI05-01-01 from the Regional Technology Innovation Program of the Ministry of Commerce, Industry and Energy (MOCIE), H.-S.B. was supported by KOSEF grant funded by MOST, Republic of Korea, through its National Nuclear Technology Program (M20702010003-07N0201-00300), and H.E.C. was supported by a Korean Science and Engineering Foundation (KOSEF) grant funded by the Korean government (MOST) (No. 2007-04213).

REFERENCES

  1. Harrison LB, Chadha M, Hill RJ, Hu K., and , Shasha D. Impact of tumor hypoxia and anemia on radiation therapy outcomes. Oncologist. 2002;7:492–508. doi: 10.1634/theoncologist.7-6-492. [DOI] [PubMed] [Google Scholar]
  2. Brown JM. The hypoxic cell: a target for selective cancer therapy–eighteenth Bruce F. Cain Memorial Award lecture. Cancer Res. 1999;59:5863–5870. [PubMed] [Google Scholar]
  3. Wachsberger P, Burd R., and , Dicker AP. Tumor response to ionizing radiation combined with antiangiogenesis or vascular targeting agents: exploring mechanisms of interaction. Clin Cancer Res. 2003;9:1957–1971. [PubMed] [Google Scholar]
  4. Chmura SJ, Gupta N, Advani SJ, Kufe DW., and , Weichselbaum RR. Prospects for viral-based strategies enhancing the anti-tumor effects of ionizing radiation. Semin Radiat Oncol. 2001;11:338–345. doi: 10.1053/srao.2001.26019. [DOI] [PubMed] [Google Scholar]
  5. McGinn CJ., and , Lawrence TS. Recent advances in the use of radiosensitizing nucleosides. Semin Radiat Oncol. 2001;11:270–280. doi: 10.1053/srao.2001.26002. [DOI] [PubMed] [Google Scholar]
  6. Roth JA., and , Cristiano RJ. Gene therapy for cancer: what have we done and where are we going. J Natl Cancer Inst. 1997;89:21–39. doi: 10.1093/jnci/89.1.21. [DOI] [PubMed] [Google Scholar]
  7. Seow Y., and , Wood MJ. Biological gene delivery vehicles: beyond viral vectors. Mol Ther. 2009;17:767–777. doi: 10.1038/mt.2009.41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Min JJ, Kim HJ, Park JH, Moon S, Jeong JH, Hong YJ, et al. Noninvasive real-time imaging of tumors and metastases using tumor-targeting light-emitting Escherichia coli. Mol Imaging Biol. 2008;10:54–61. doi: 10.1007/s11307-007-0120-5. [DOI] [PubMed] [Google Scholar]
  9. Min JJ, Nguyen VH, Kim HJ, Hong Y., and , Choy HE. Quantitative bioluminescence imaging of tumor-targeting bacteria in living animals. Nat Protoc. 2008;3:629–636. doi: 10.1038/nprot.2008.32. [DOI] [PubMed] [Google Scholar]
  10. Yu YA, Shabahang S, Timiryasova TM, Zhang Q, Beltz R, Gentschev I, et al. Visualization of tumors and metastases in live animals with bacteria and vaccinia virus encoding light-emitting proteins. Nat Biotechnol. 2004;22:313–320. doi: 10.1038/nbt937. [DOI] [PubMed] [Google Scholar]
  11. Low KB, Ittensohn M, Le T, Platt J, Sodi S, Amoss M, et al. Lipid A mutant Salmonella with suppressed virulence and TNFα induction retain tumor-targeting in vivo. Nat Biotechnol. 1999;17:37–41. doi: 10.1038/5205. [DOI] [PubMed] [Google Scholar]
  12. Zhao M, Yang M, Li XM, Jiang P, Baranov E, Li S, et al. Tumor-targeting bacterial therapy with amino acid auxotrophs of GFP-expressing Salmonella typhimurium. Proc Natl Acad Sci USA. 2005;102:755–760. doi: 10.1073/pnas.0408422102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Pawelek JM, Low KB., and , Bermudes D. Bacteria as tumour-targeting vectors. Lancet Oncol. 2003;4:548–556. doi: 10.1016/s1470-2045(03)01194-x. [DOI] [PubMed] [Google Scholar]
  14. Agrawal N, Bettegowda C, Cheong I, Geschwind JF, Drake CG, Hipkiss EL, et al. Bacteriolytic therapy can generate a potent immune response against experimental tumors. Proc Natl Acad Sci USA. 2004;101:15172–15177. doi: 10.1073/pnas.0406242101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dang LH, Bettegowda C, Huso DL, Kinzler KW., and , Vogelstein B. Combination bacteriolytic therapy for the treatment of experimental tumors. Proc Natl Acad Sci USA. 2001;98:15155–15160. doi: 10.1073/pnas.251543698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Weibel S, Stritzker J, Eck M, Goebel W., and , Szalay AA. Colonization of experimental murine breast tumours by Escherichia coli K-12 significantly alters the tumour microenvironment. Cell Microbiol. 2008;10:1235–1248. doi: 10.1111/j.1462-5822.2008.01122.x. [DOI] [PubMed] [Google Scholar]
  17. Loeffler M, Le'Negrate G, Krajewska M., and , Reed JC. Attenuated Salmonella engineered to produce human cytokine LIGHT inhibit tumor growth. Proc Natl Acad Sci USA. 2007;104:12879–12883. doi: 10.1073/pnas.0701959104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ryan RM, Green J, Williams PJ, Tazzyman S, Hunt S, Harmey JH, et al. Bacterial delivery of a novel cytolysin to hypoxic areas of solid tumors. Gene Ther. 2009;16:329–339. doi: 10.1038/gt.2008.188. [DOI] [PubMed] [Google Scholar]
  19. Xiang S, Fruehauf J., and , Li CJ. Short hairpin RNA-expressing bacteria elicit RNA interference in mammals. Nat Biotechnol. 2006;24:697–702. doi: 10.1038/nbt1211. [DOI] [PubMed] [Google Scholar]
  20. Akin D, Sturgis J, Ragheb K, Sherman D, Burkholder K, Robinson JP, et al. Bacteria-mediated delivery of nanoparticles and cargo into cells. Nat Nanotechnol. 2007;2:441–449. doi: 10.1038/nnano.2007.149. [DOI] [PubMed] [Google Scholar]
  21. Hoffman RM., and , Zhao M. Whole-body imaging of bacterial infection and antibiotic response. Nat Protoc. 2006;1:2988–2994. doi: 10.1038/nprot.2006.376. [DOI] [PubMed] [Google Scholar]
  22. Wai SN, Lindmark B, Söderblom T, Takade A, Westermark M, Oscarsson J, et al. Vesicle-mediated export and assembly of pore-forming oligomers of the enterobacterial ClyA cytotoxin. Cell. 2003;115:25–35. doi: 10.1016/s0092-8674(03)00754-2. [DOI] [PubMed] [Google Scholar]
  23. Lai XH, Arencibia I, Johansson A, Wai SN, Oscarsson J, Kalfas S, et al. Cytocidal and apoptotic effects of the ClyA protein from Escherichia coli on primary and cultured monocytes and macrophages. Infect Immun. 2000;68:4363–4367. doi: 10.1128/iai.68.7.4363-4367.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Oscarsson J, Mizunoe Y, Li L, Lai XH, Wieslander A., and , Uhlin BE. Molecular analysis of the cytolytic protein ClyA (SheA) from Escherichia coli. Mol Microbiol. 1999;32:1226–1238. doi: 10.1046/j.1365-2958.1999.01435.x. [DOI] [PubMed] [Google Scholar]
  25. Galán JE, Nakayama K., and , Curtiss R., 3rd Cloning and characterization of the asd gene of Salmonella typhimurium: use in stable maintenance of recombinant plasmids in Salmonella vaccine strains. Gene. 1990;94:29–35. doi: 10.1016/0378-1119(90)90464-3. [DOI] [PubMed] [Google Scholar]
  26. Kang HY, Srinivasan J., and , Curtiss R., 3rd Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuated Salmonella enterica serovar typhimurium vaccine. Infect Immun. 2002;70:1739–1749. doi: 10.1128/IAI.70.4.1739-1749.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Curtiss R, 3rd, Nakayama K., and , Kelly SM. Recombinant avirulent Salmonella vaccine strains with stable maintenance and high level expression of cloned genes in vivo. Immunol Invest. 1989;18:583–596. doi: 10.3109/08820138909112265. [DOI] [PubMed] [Google Scholar]
  28. Loeffler M, Le'Negrate G, Krajewska M., and , Reed JC. Inhibition of tumor growth using Salmonella expressing Fas ligand. J Natl Cancer Inst. 2008;100:1113–1116. doi: 10.1093/jnci/djn205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. DeVita V, Lawrence T., and , Rosenberg S.eds) (2008Cancer: Principles and Practice of Oncology Lippincott C: Philadelphia, PA; 307–336. [Google Scholar]
  30. Halperin E, Perez C., and , Brady L.eds) (2007Principles and Practice of Radiation Oncology Lippincott C: Philadelphia, PA; 2–75. [Google Scholar]
  31. Grillot-Courvalin C, Goussard S, Huetz F, Ojcius DM., and , Courvalin P. Functional gene transfer from intracellular bacteria to mammalian cells. Nat Biotechnol. 1998;16:862–866. doi: 10.1038/nbt0998-862. [DOI] [PubMed] [Google Scholar]
  32. Nemunaitis J, Cunningham C, Senzer N, Kuhn J, Cramm J, Litz C, et al. Pilot trial of genetically modified, attenuated Salmonella expressing the E. coli cytosine deaminase gene in refractory cancer patients. Cancer Gene Ther. 2003;10:737–744. doi: 10.1038/sj.cgt.7700634. [DOI] [PubMed] [Google Scholar]
  33. Arrach N, Zhao M, Porwollik S, Hoffman RM., and , McClelland M. Salmonella promoters preferentially activated inside tumors. Cancer Res. 2008;68:4827–4832. doi: 10.1158/0008-5472.CAN-08-0552. [DOI] [PubMed] [Google Scholar]
  34. Zhao M, Geller J, Ma H, Yang M, Penman S., and , Hoffman RM. Monotherapy with a tumor-targeting mutant of Salmonella typhimurium cures orthotopic metastatic mouse models of human prostate cancer. Proc Natl Acad Sci USA. 2007;104:10170–10174. doi: 10.1073/pnas.0703867104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhao M, Yang M, Ma H, Li X, Tan X, Li S, et al. Targeted therapy with a Salmonella typhimurium leucine-arginine auxotroph cures orthotopic human breast tumors in nude mice. Cancer Res. 2006;66:7647–7652. doi: 10.1158/0008-5472.CAN-06-0716. [DOI] [PubMed] [Google Scholar]
  36. Yam C, Zhao M, Hayashi K, Ma H, Kishimoto H, McElroy M, et al. 2009Monotherapy with a Tumor-Targeting Mutant of S. typhimurium inhibits liver metastasis in a mouse model of pancreatic cancer J Surg Resepub ahead of print). [DOI] [PMC free article] [PubMed]
  37. Nagakura C, Hayashi K, Zhao M, Yamauchi K, Yamamoto N, Tsuchiya H, et al. Efficacy of a genetically-modified Salmonella typhimurium in an orthotopic human pancreatic cancer in nude mice. Anticancer Res. 2009;29:1873–1878. [PubMed] [Google Scholar]
  38. Hayashi K, Zhao M, Yamauchi K, Yamamoto N, Tsuchiya H, Tomita K, et al. Systemic targeting of primary bone tumor and lung metastasis of high-grade osteosarcoma in nude mice with a tumor-selective strain of Salmonella typhimurium. Cell Cycle. 2009;8:870–875. doi: 10.4161/cc.8.6.7891. [DOI] [PubMed] [Google Scholar]
  39. Hayashi K, Zhao M, Yamauchi K, Yamamoto N, Tsuchiya H, Tomita K, et al. Cancer metastasis directly eradicated by targeted therapy with a modified Salmonella typhimurium. J Cell Biochem. 2009;106:992–998. doi: 10.1002/jcb.22078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Loeffler M, Le'Negrate G, Krajewska M., and , Reed JC. IL-18-producing Salmonella inhibit tumor growth. Cancer Gene Ther. 2008;15:787–794. doi: 10.1038/cgt.2008.48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Loeffler M, Le'Negrate G, Krajewska M., and , Reed JC.2009Salmonella typhimurium engineered to produce CCL21 inhibit tumor growth Cancer Immunol Immunother 58769–775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Blattner FR, Plunkett G, 3rd, Bloch CA, Perna NT, Burland V, Riley M, et al. The complete genome sequence of Escherichia coli K-12. Science. 1997;277:1453–1462. doi: 10.1126/science.277.5331.1453. [DOI] [PubMed] [Google Scholar]
  43. Silhavy TJ, Berman ML., and , Enquist LW.1984Experiments with Gene Fusions. Cold Spring Harbor Laboratory Press: New York [Google Scholar]
  44. Datsenko KA., and , Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Oscarsson J, Westermark M, Löfdahl S, Olsen B, Palmgren H, Mizunoe Y, et al. Characterization of a pore-forming cytotoxin expressed by Salmonella enterica serovars typhi and paratyphi A. Infect Immun. 2002;70:5759–5769. doi: 10.1128/IAI.70.10.5759-5769.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Song M, Kim HJ, Kim EY, Shin M, Lee HC, Hong Y, et al. ppGpp-dependent stationary phase induction of genes on Salmonella pathogenicity island 1. J Biol Chem. 2004;279:34183–34190. doi: 10.1074/jbc.M313491200. [DOI] [PubMed] [Google Scholar]
  47. Kim HS, Lee JS, Freund JN, Min KW, Lee JS, Kim W, et al. CDX-2 homeobox gene expression in human gastric carcinoma and precursor lesions. J Gastroenterol Hepatol. 2006;21:438–442. doi: 10.1111/j.1440-1746.2005.03933.x. [DOI] [PubMed] [Google Scholar]
  48. Piao HH, Seong J, Song MK, Kim YU, Shin D-J, Choy HE. The bacterial surface expression of SARS viral epitope using Salmonella typhi Cyotolysin A. J Bacteriol Virol. 2009;39:103–112. [Google Scholar]
  49. Lee CY, Szittner RB., and , Meighen EA. The lux genes of the luminous bacterial symbiont, Photobacterium leiognathi, of the ponyfish. Nucleotide sequence, difference in gene organization, and high expression in mutant Escherichia coli. Eur J Biochem. 1991;201:161–167. doi: 10.1111/j.1432-1033.1991.tb16269.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1.

In vitro CT26 cell death after administration of bacterial culture medium. CT26 mouse colon cancer cells were grown in 24-well tissue culture plates to a density of 105 cells per well. E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA) were grown in LB and harvested at late-logarithmic phase. Bacteria were removed by filtration. Then, the bacterial filtrate (50 μl) was added to cultured CT26 cells and incubated for 24 hours. Microscopic observation revealed significant cell death following addition of the filtrate of E. coli pAClyA (b), but not with that of E. coli pAsd (a). Western blot analysis revealed that a ClyA protein was present only in the culture medium of E. coli pAClyA, not in that of E. coli pAsd, indicating the ClyA protein was expressed and secreted from the E. coli pAClyA (see Figure 1b).

Click here for supplemental data (17.2MB, tiff)
Figure S2.

Body weight changes in CT26-bearing mice treated with PBS, or E. coli carrying empty vector (E. coli pAsd) or the ClyA vector (E. coli pAClyA).

Click here for supplemental data (2.4MB, tiff)

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES