Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Mar 31.
Published in final edited form as: Vision Res. 2009 Sep 16;50(7):643–651. doi: 10.1016/j.visres.2009.09.002

Expression and regulation of enzymes in the ceramide metabolic pathway in human retinal pigment epithelial cells and their relevance to retinal degeneration

DanHong Zhu a,c, Parameswaran G Sreekumar a, David R Hinton a,c,*, Ram Kannan a,b
PMCID: PMC2840213  NIHMSID: NIHMS151314  PMID: 19765607

Abstract

Ceramide and its metabolic derivatives are important modulators of cellular apoptosis and proliferation. Dysregulation or imbalance of their metabolic pathways may promote the development of retinal degeneration. The aim of this study was to identify the expression and regulation of key enzymes of the ceramide pathway in retinal pigment epithelial (RPE) cells. RT-PCR was used to screen the enzymes involved in ceramide metabolism that are expressed in RPE. Over-expression of neutral sphingomyelinase-2 (SMPD3) or sphingosine kinase 1 (Sphk1) in ARPE-19 cells was achieved by transient transfection of SMPD3 or Sphk1 cDNA subcloned into an expression vector. The number of apoptotic or proliferating cells was determined using TUNEL and BrdU assays respectively. Neutral sphingomyelinase-1, neutral sphingomyelinase-2, acidic ceramidase, ceramide kinase, SphK1 and Sphk2 were expressed in both ARPE-19 and early passage human fetal RPE (fRPE) cells, while alkaline ceramidase 2 was only expressed in fRPE cells. Over-expression of SMPD3 decreased RPE cell proliferation and increased cell apoptosis. The percentage of apoptotic cells increased proportionally with the amount of transfected SMPD3 DNA. Over-expression of SphK1 promoted cell proliferation and protected ARPE-19 cells from ceramide-induced apoptosis. The effect of C2 ceramide on induction of apoptosis was evaluated in polarized vs. non-polarized RPE cultures; polarization of RPE was associated with much reduced apoptosis in response to ceramide. In conclusion, RPE cells possess the synthetic machinery for the production of ceramide, sphingosine, ceramide-1-phosphate (C1P), and sphingosine-1-phosphate (S1P). Overexpression of SMPD3 may increase cellular ceramide levels, leading to enhanced cell death and arrested cell proliferation. The selective induction of apoptosis in non-polarized RPE cultures by C2 ceramide suggests that increased ceramide levels will preferentially affect non-polarized RPE, as are found in late age-related macular degeneration lesions, and may spare the normal RPE monolayer. SphK1 over-expression increased cellular S1P, which promoted cell proliferation and protected RPE from ceramide-induced apoptosis. Understanding the relationship between the metabolism of sphingolipids and their effects in RPE cell survival/death may help us to develop effective and efficient therapies for retinal degeneration.

Keywords: ceramide, oxidative stress, cell survival, apoptosis, sphingomyelinase, sphingosine kinase, retinal degeneration

1. Introduction

Data from clinical and basic research have provided evidence that apoptotic cell death plays a critical role in the pathogenesis of age-related macular degeneration (AMD) and other retinal degenerative diseases (Sarks, 1976; Dorey et al., 1989). However, the etiology and mechanism of increased apoptosis in retinal pigment epithelial (RPE) cells in retinal degeneration remain largely unknown. Such knowledge concerning the mechanism of dysregulated apoptosis is critical because it may lead to new approaches for the prevention and treatment of these important disorders.

Ceramide is a central hub for sphingolipid metabolism; its breakdown or modification results in the production of several sphingolipids such as sphingosine, sphingosine-1-phosphate (S1P), and ceramide-1-phosphate (C1P) that, like ceramide itself, can potentially serve as both structural and/or cell signaling molecules (An et al., 2000, Cuvillier et al., 1996, Gulbins and Li, 2006, Ogretmen and Hannun, 2004, Taha et al., 2006, Zheng et al., 2006). In recent years, there has been an upsurge of interest in unraveling the roles of ceramide in the pathophysiology of different human diseases including neurodegenerative and retinal degenerative diseases. It is possible that targeted manipulation of the ceramide metabolic pathway may prove to be a novel strategy for treatment of neurodegenerative disease. Furthermore, in addition to apoptosis, ceramide has been suggested to play important roles in cell cycle arrest, inflammation, and the eukaryotic stress response (Hannun and Luberto, 2000; Gulbins and Kolesnick, 2003). Although ceramide can be generated by de novo synthesis through ceramide synthase, for the majority of cellular responses, it is generated from sphingomyelin by the action of neutral or acid sphingomyelinase (Hannun et al., 2001).

Several sphingomyelinases (SMPDs) have been described in eukaryotes and prokaryotes and they are distinguished by their subcellular localization, pH optima, and requirement for metal ions (Hofmann et al., 2000, Marchesini and Hannun, 2004). To date, four SMPDs have been identified. The best characterized of these enzymes is the acid sphingomyelinase (SMPD1) that is predominantly located in lysosomes but also secreted in response to different ligand-receptor interactions at the cell surface (Schuchman et al., 1991). A total of 3 neutral sphingomyelinases—SMPD2, SMPD3, and SMPD4—are localized in different cellular compartments and expressed in different tissues (Tomiuk et al., 1998; Hofmann et al., 2000). SMPD2 is localized in the endoplasmic reticulum (ER) and expressed in all cell types (Zumbansen and Stoffel, 2002). SMPD3 is expressed at highest levels in the brain, is activated by tumor necrosis factor α (TNFα), and contributes to TNFα-induced apoptosis in cultured cells (Clarke et al., 2007). Smpd3-null mice have significant developmental defects, including dwarfism and delayed puberty (Stoffel et al., 2005). Stable overexpression of SMPD3 in MCF7 cells results in a markedly decreased growth rate at the late exponential phase, suggesting that SMPD3 is involved in the regulation of the cell cycle (Marchesini et al., 2003). SMPD4 is localized in the ER as well as in the Golgi, and has been shown to be activated in response to TNFα, although its physiological role has yet to be defined (Krut et al., 2006).

SphKs are critical enzymes that regulate the cellular levels of S1P and thus ultimately control cell fate. SphKs are ubiquitously expressed and exist in two subtypes, SphK1 and SphK2 (Alemany et al., 2007, Bryan et al., 2008). SphK1 has major roles in cell proliferation and migration and is expressed in different tumors (Alemany et al., 2007). Recent studies implicate endogenous SphK1 as an important survival enzyme. Knocking down the Sphk1 expression by siRNA gene silencing could cause cell cycle arrest and induce apoptosis by the activation of caspases and the oligomerization of Bax on the mitochondrial membrane (Taha et al., 2006). SphK2, on the other hand, has different properties and subcellular locations from Sphk1. Although Sphk1 and Sphk2 are able to complement each other for some key functions, Sphk2 has distinct biological functions, and even has opposing roles in the regulation of cell fate. It has been reported that Sphk2 has pro-apoptotic function and the overexpression of SphK2 in various cell types blocks DNA synthesis (Igarashi et al., 2003, Liu et al., 2003).

Our laboratory recently established that oxidative stress induced by exogenous ceramide leads to apoptosis in human RPE cells and that this effect could be partially prevented by growth factors and antioxidants (Kannan et al., 2004, Sreekumar et al., 2009). However, the precise mechanisms of the cellular action of ceramide and the enzymes that are involved in the sphingolipid pathway in RPE have not been fully explored. Expression and regulation of sphingolipid metabolizing enzymes in the RPE has not been hitherto studied. Because neutral SMPD3 and SphK1 were highly expressed in RPE cells and have opposing functions for evaluating their roles in mediating cell fate, we focused on the regulation and function of SMPD3 and SphK1 in RPE. Our data shows that overexpression of SMPD3 induced RPE cell death and inhibited cell proliferation, whereas overexpression of SphK1 induced cell proliferation and protected RPE cells from cell death after C2 ceramide exposure.

2. Methods

2.1. Cell culture

A. ARPE-19 cell culture

ARPE-19 cells were obtained from American Type Culture Collection (Manassas, VA) and were used between passages 22 and 25. ARPE-19 cells were cultured in DMEM/F12 (1:1) medium supplemented with 100 U/mL penicillin-streptomycin, 2 mM L-glutamine, and 10% FBS.

B. Human fetal RPE (fRPE) cell culture

Human fRPE were isolated from 18-20 week gestation fetal eyes (Advanced Bioscience Resources, Inc. Alameda, CA) and digested with trypsin to single cells (Sonoda et al., 2009). The fRPE cells were then cultured in DMEM supplemented with 100 U/mL penicillin-streptomycin, 2 mM L-glutamine, and 10% FBS. The fRPE cells used for experiments at passage 3 or 4.

C. Polarized fRPE cell culture

Passage 1 human fRPE cells (2×105 for each well) were seeded on fibronectin-coated transwell membranes, and cultured in RPE medium with 1% FBS as previously described (Sonoda et al., 2009). The formation of tight junctions among the cells was determined by measuring the transepithelial resistance (TER) with an EVOM epithelial tissue voltohmmeter. Polarized fRPE cells with a resistance of >170 Ω.cm2 were used in our study.

2.2 Cell treatment

A. GW4869 treatment

After transiently transfection for 24 hours, the SMPD3 overexpressed or vector only control ARPE-19 cells were treated with 20 μM GW4869, a specific neutral sphingomyelinase inhibitor (Luberto et al., 2002), for 45 minutes, then changed to fresh, serum free medium and cultured for another 16 hours.

B. C2 ceramide treatment

After transient transfection for 24 hours, the SphK1 overexpressed or vector only control ARPE-19 cells were challenged with 25 μM C2 ceramide in 1% FBS medium for 16 hours.

2.3. Subcloning and transfection of neutral sphingomyelinase and sphingosine kinase-1

SMPD3 and SphK1 cDNA were amplified by RT-PCR and subcloned into a pcDNA 3.1 mammalian cell expression vector (Invitrogen, Carlsbad, CA). SMPD3 or SphK1 cDNA containing plasmid or pcDNA 3.1 vector only were transfected at different concentrations (0.1 to 1 μg) into ARPE-19 cells by using Fugene 6 transfection reagent (Roche, IN). In representative experiments, ARPE-19 cells were transfected with pEGFP-N1 plasmid (BD Biosciences, Clontech) and the efficiency of transfection was recorded by counting the number of GFP positive cells under a fluorescent microscope. The transfection efficiency was typically 50% or higher in all experiments.

2.4. Conventional RT-PCR

Total RNA was extracted from SMPD3, SphK1, pcDNA3.1 vector only transfected ARPE-19 cells using TRIzol reagent (Invitrogen, Carlsbad, CA) and quantified with a spectrophotometer. The first strand cDNA was synthesized from 1μg total RNA with a cDNA synthesis kit as per manufacturer’s protocol (Promega, Madison, WI). The detection of the ceramide metabolic pathway enzymes was achieved by PCR amplification using specific primers with a PCR kit (Qiagen, Valencia, CA). GAPDH was used as an internal loading control. Specificity of the reaction was verified with no-template negative control. The specific primer pairs used in screening enzymes of the ceramide pathways by RT-PCR are listed in Table 1.

Table1.

Primer pairs used to amplify enzymes involved in ceramide metabolic pathway

Name of genes Forward(F)/
Reverse (R)		 Length of
amplified
cDNA		 Primer sequences
Acid
sphingomyelinase
(SMPD1)		 F 750 bp 5′-CAGCCGACTACAGAGAAGGG
R 5′-GCAGGTCAGTGAGGAAGAGG
Neutral
sphingomyelinase1
(SMPD2)		 F 553 bp 5′-CATGGTGACTGGTTCAGTGG
R 5′-TAGAGCTGGGGTTCTGCTGT
Neutral
sphingomyelinase2
(SMPD3)		 F 526 bp 5′-ACCAACCCTCACTTCACAGG
R 5′-GGCTGCTCTCTGTACCTTGG
Acid ceramidase
(ASAH1)		 F 433 bp 5′-AGTCTGGGGAAGGTTGTGTG
R 5′-CCGCGAGTCTTAGTCTTTGG
Alkaline
ceramidase 1
(ACER1)		 F 498 bp 5′- TGCTATTTCCCCTCCTTCCT
R 5′- TAGTCAAGAGGCTGGCAGGT
Alkaline
ceramidase 2
(ACER2)		 F 338 bp 5′- AGGTTCAAGGTGGTGGTCAG
R 5′- GAGGCAGCATCAAAGTAGGC
Neutral ceramidase
(ASAH2)		 F 402 bp 5′- TGCAGATCAACAGAAGTCCG
R 5′- TAGCAATGCACATGCTAGGC
Ceramide kinase
(CerK)		 F 488 bp 5′- GAGAAGCTGACGTCCAGACC
R 5′- GACACGGAGTAGCGAAGGAG
Ceramide kinase
like
(CERKL)		 F 453 bp 5′- TAGCGAAGTAGCCCATGCTT
R 5′- TCAGATTTGGGAGATCCCTG
Sphingosine
Kinase1
(SphK1)		 F 532 bp 5′-ATCTCCTTCACGCTGATGCT
R 5′-CAGGTGTCTTGGAACCCACT
Sphingosine
Kinase2
(SphK2)		 F 470 bp 5′-CGCTGTTTCTCCTTCCTGTC
R 5′-GAGTGTAGAGCTGCCTTGGG
GAPDH F 420 bp 5′-GTCAGTGGTGGACCTGACCT
R 5′-AGGGGTCTACATGGCAACTG
Open in a new tab

2.5. Western Blot Analysis

The SMPD3 or SphK1 overexpressing and control ARPE-19 cells were homogenized in RIPA buffer (50 mM Tris-HCl, pH8.0, 150mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate and 0.1% SDS) with 1X protease inhibitor cocktail (Sigma). Equal amounts of protein from each sample (10 μg/well) underwent electrophoresis on 10% polyacrylamide gels and were electrically transferred to a PVDF membrane (Millipore Corp, Jeffery, NH). A rabbit anti-SphK1 polyclonal antibody (1:1000 dilution; Cayman Chemical, Ann Arbor, MI) was used to detect the expression levels of the SphK1 protein. Quantification of the SphK1 protein was made by measuring band intensity and area using Scion software (NIH) and normalized to GAPDH.

2.6. TUNEL assay

A. Quantitative measure of apoptotic cells

The cells were collected by trypsinization and fixed with 2 % paraformaldehyde in PBS pH 7.4. Apoptotic cells were labeled using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-fluorescein nick end-labeling (TUNEL) cell death detection kit (Roche, IN) according to the manufacturer’s instructions, and quantitated by flow cytometric analysis.

B. In situ staining of apoptotic cells

Polarized and non-polarized confluent fRPE cells were treated with 25μM C2 ceramide for 24 h in 1% serum containing culture medium. The treated cells were then fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 and 0.1% sodium citrate, and incubated with TdT enzyme mixture using a cell death detection kit (Roche, IN). The number of TUNEL positive cells were counted under a fluorescent microscope and presented as the percentage of dead cells.

2.7. BrdU Incorporation Assay

After being transiently transfected with varying quantities of SMPD3 cDNA, SphK1 cDNA or vector only for 24 hours, the transfected ARPE-19 cells were trypsinized, re-seeded on chamber slides or 96-well plates and continued to be cultured for 16 hours. The cells were then treated with BrdU (10μM) for 6 hours. The BrdU incorporation rates of control and transfected cells were measured with the BrdU Incorporation Assay Kit (Roche, IN) by in situ BrdU immunostaining, or by cell proliferation ELISA according to the manufacturer’s instructions.

2.8. Statistical Analysis

Data presented represent Mean ± SD. ANOVA was used to identify the global differences on data collected from TUNEL and BrdU incorporation assays. Multiple pairwise comparisons with Tukey adjustment were performed to test the differences between the effects of inhibitor treated and non-treated SMPD3 overexpressing cells or C2 ceramide treated and non-treated Sphk1 overexpressing cells. All p-values reported were 2-sided, and p<0.05 was considered statistically significant.

3. Results

3.1. Expression of sphingolipid metabolizing enzymes in ARPE-19 and fRPE cells

Understanding the expression of the spectrum and dominant isoforms of the sphingolipid metabolic pathway enzymes in RPE cells can help us determine which enzymes participate in the sphingolipid metabolism in RPE cells. We screened the sphingolipid metabolic pathway enzymes with RT-PCR amplification, and found that Neutral Sphingomyelinase 1 (SMPD2), and Neutral Sphingomyelinase 2 (SMPD3), acidic ceramidase (ASAH1), ceramide kinase (CERK) and sphingosine kinases (SphKs) were expressed in both ARPE-19 and human fRPE cells, while alkaline ceramidase 2 (ACER2) was only expressed in fRPE (Fig.1). Acidic sphingomyelinase (SMPD1), alkaline ceramidase 1 (ACER1), neutral ceramidase (ASAH2) and ceramide kinase-like (CERKL) were not detectable in the RPE cells with RT-PCR.

Figure 1. Expression of sphingolipid enzymes by ARPE-19 and early passage human fetal RPE (fRPE) cells as determined by RT-PCR.

Figure 1

Open in a new tab

Messenger RNA from human ARPE-19 and fRPE cells was reverse-transcribed and amplified by specific primers for sphingolipid metabolic pathway enzymes (see Table 1). SMPD2, SMPD3, ASAH1, CERK and Sphks are expressed in both ARPE-19 and fRPE cells. ACER2 is only expressed in fRPE cells. Lane 1, DNA marker; 2, acid sphingomyelinase (SMPD1); 3, neutral sphingomyelinase 1(SMPD2); 4, neutral sphingomyelinase 2 (SMPD3); 5, acid ceramidase (ASAH1); 6, alkaline ceramidase 1 (ACER1); 7, alkaline ceramidase 2 (ACER2); 8, neutral ceramidase (ASAH2); 9, ceramide kinase (CERK); 10, ceramide kinase like (CERKL); 11, sphingosine kinase 1 (SphK1); 12, sphingosine kinase 2 (SphK2); 13, GAPDH; 14, negative control.

3.2. Overexpression of SMPD3 renders ARPE-19 cells more susceptible to apoptosis

Increased ceramide levels have been shown to induce cell cycle arrest, apoptosis and cell differentiation (Hannun and Luberto, 2000). In order to assess whether the effects of changes in cellular sphingolipid content would modulate the RPE cell fate, we increased the expression of SMPD3 or SphK1 by transient transfection of SMPD3 and Sphk1 expression vectors into ARPE-19 cells and measured the changes in the rate of RPE cell death and growth. The overexpression of transcripts for SMPD3 and Sphk1, and protein for Sphk1 in ARPE-19 cells was confirmed by RT-PCR and western blot, respectively (Fig. 2A, 2B).

Figure 2. Overexpression of SMPD3 and SphK1 in ARPE-19 cells confirmed by RT-PCR and western blot assays.

Figure 2

Open in a new tab

A. RT-PCR: Total RNA was extracted from ARPE-19 cells transiently transfected with pcDNA3.1-SMPD3, pcDNA3.1-SphK1 or pcDNA3.1 vector only and reversely transcripted to cDNA. The templates were amplified with a PCR kit and the result showed that ARPE-19 cells transfected with SMPD3 or SphK1 expression vector expressed higher level of SMPD3 or SphK1 transcripts than vector only transfected cells.

B. Western blot analysis: The protein from ARPE-19 cells transiently transfected with pcDNA3.1-SphK1 or pcDNA3.1 vector only was electrophoresed using a 10% polyacrymide gel with 10μg of cell lysate loaded in each lane and was transferred to a PVDF membrane. Densitometric analysis of SphK1 immunoreactive bands after normalization with GAPDH, shows 3.6 and 4.1 fold increase in SphK1 expression in 2 independent experiments using SphK1 transfected ARPE-19 cells.

SMPD3-overexpressing ARPE-19 cells exhibited significantly increased apoptosis with serum starvation as compared to vector only controls (46% vs. 4% respectively, p<0.01, Fig. 3). ARPE-19 cells transfected with increasing amounts of SMPD3 DNA showed a dose-dependent increase in apoptotic cells as evident by TUNEL assay. To confirm that the apoptosis was truly induced by the increased SMPD3 expression in ARPE-19 cells, we introduced GW4869, a neutral sphingomyelinase inhibitor, into SMPD3 overexpressing cells. The apoptotic RPE cells were significantly reduced by pre-treatment with 20μM GW4869 in all SMPD3 overexpressing cells transfected with different DNA concentrations (p<0.05) (Fig. 4).

Figure 3. Augmentation and suppression of cell death in SMPD3 overexpressing and SphK1 overexpressing RPE by TUNEL.

Figure 3

Open in a new tab

ARPE-19 cells were transiently transfected with pcDNA 3.1-SMPD3 or pcDNA 3.1-SphK1 for 24h, afterward the cells were continuously cultured in serum-free medium for 16h. The cells were fixed and incubated with TdT enzyme with fluorescein labeled dUTP. The results show that there are more TUNEL positive cells (apoptotic cells) in SMPD3 transfected than vector only transfected ARPE-19 cells, and no significant difference between TUNEL positive cells in Sphk1 and vector only transfected cells. A. Cells transfected with pcDNA3.1 vector only as a control; B. Cells transfected with pcDNA 3.1-SMPD3; C. Cells transfected with pcDNA 3.1-SphK1. The percentage of TUNEL positive cells in each group (3 independent experiments), is shown as a bar graph below (**p<0.01). Bar= 40 μm.

Figure 4. Overexpression of SMPD3 enhances RPE cell death.

Figure 4

Open in a new tab

ARPE-19 cells were transiently transfected with increasing amounts of pcDNA 3.1-SMPD3 plasmid. The control and transfected cells were cultured in serum free medium for 16 h. In SMPD3 inhibition experiments, control and transfected cells were treated with 20μM GW4869, a neutral sphingomyelinase inhibitor for 45 min, and then changed into serum free medium and cultured for 16h. The cells were labeled by fluorescent TUNEL assay. The apoptotic cells were measured by flow cytometry. Overexpression of SMPD3 increased the number of apoptotic cells in a dose dependent manner, while incubation with GW4869 reduced SMPD3-induced ARPE-19 cell apoptosis. Mean values from three independent experiments are presented. Apoptosis was significantly increased in all groups of SMPD3 transfected cells compared to vector only control, and also significantly increased among the groups with ascending DNA concentrations (p<0.05, ANOVA). All values for the GW4869 group were significantly lower than the corresponding SMPD3-DNA values (*p<0.05, Student’s t test).

3.3. SphK1-overexpressing cells are resistant to apoptosis after oxidative insult

Sphk1 is an important enzyme for the formation of S1P, which functions as an extracellular or intracellular messenger that modulates cell fates, including the suppression of apoptosis and the increase of cell proliferation (An et al., 2000). To verify the function of Sphk1 in RPE cells, we overexpressed Sphk1 in ARPE-19 cells by the transient transfection of Sphk1 expression vector. The percentage of apoptotic cells in the SphK1-overexpressing cells was similar to the vector only controls. We then challenged the SphK1-overexpressing cells with 25μM C2 ceramide and measured the number of apoptotic cells by flow cytometric analysis of TUNEL-stained cells. About 36% of cells underwent apoptosis in the vector only control group with C2 ceramide induced oxidative stress, while a dose-dependent decrease in cell death was observed in SphK1 transfected cells (Fig. 5). Only 10% cell death was observed in cells transfected with 0.5 μg SphK1 DNA (p<0.01), suggesting its protective role in ceramide induced oxidative stress in ARPE-19 cells.

Figure 5. SphK1 protects ARPE-19 cells from ceramide-induced cell death.

Figure 5

Open in a new tab

ARPE-19 cells were transiently transfected with increasing amounts of pcDNA 3.1-SphK1 plasmid for 24 h and challenged with C2-ceramide (25μM) for 16 h in 1% serum. The percentage of apoptotic cells was measured by TUNEL stain followed by flow cytometry. The result shows that SphK1 transfection significantly decreased the number of apoptotic cells upon challenge with ceramide in a dose dependent manner compared to vector only control cells (*p<0.05; **p<0.01, ANOVA). Mean data from at least three independent experiments is presented.

3.4. SMPD3 and SphK1 has an opposed effect on cell proliferation in ARPE-19 cells

To understand whether SMPD3 and Sphk1 have opposing effects on RPE proliferation, we overexpressed SMPD3 or Sphk1 in ARPE-19 cells by transient transfection with different amounts of SMPD3 or Sphk1 expression plasmids (0.1 to 1 μg) and treated these overexpressed cells with BrdU for 6 hours. The BrdU incorporation result showed significantly decreased BrdU uptake by SMPD3-overexpressing cells even at the lowest amount of transfected DNA (0.1 μg) (p<0.05) compared to the vector only control cells (Fig. 6A), while SphK1 overexpression, on the other hand, significantly increased BrdU incorporation in a dose-dependent manner in RPE cells. This indicates that SMPD3 inhibits RPE cell proliferation through hydrolysis of sphingomyelin to produce ceramide, and Sphk1 has the opposite function to increase RPE cell proliferation, possibly through phosphorylating sphingosine to form S1P (Fig. 6A, 6B).

Figure 6. BrdU incorporation to assay cell proliferation.

Figure 6

Open in a new tab

A. ARPE-19 cells were transiently transfected with increasing amounts of pcDNA 3.1-SMPD3 or pcDNA 3.1–SphK1 for 24 h, and then treated with BrdU (10μM) for 6 h. The BrdU incorporation rate by ARPE-19 cells were detected by cell proliferation ELISA measured with ELISA Reader. The figure shows that overexpression of SphK1 increased BrdU incorporation, while overexpression of SMPD3 decreased BrdU incorporation compared with vector only control. The significant increases or decreases of BrdU incorporation by Sphk1 or SMPD3, respectively, were at DNA concentration 0.5μg and above (*p<0.05, ANOVA).

B. The transfected cells were immunostained with anti-BrdU antibody. The result shows that there are more BrdU positive cells in SphK1 transfected cells than vector only control, and fewer BrdU positive cells in SMPD3 transfected cells than vector only control cells. A representative image from three independent experiments is presented. Bar = 40 μm.

3.5. Polarized and non-polarized RPE have differential susceptibility to ceramide treatment

To examine whether the upregulation of cellular ceramide might induce cell death in the normal RPE monolayer in vivo, we used highly polarized RPE cells, grown on transwell membranes to mimic the in vivo situation, and non-polarized confluent RPE cells, grown on chamber slides as a representation of activated RPE such as those found in AMD lesions, or in epiretinal membranes such as those found in proliferative vitreoretinopathy (PVR) (Campochiaro et al., 1985, Hinton et al., 1998). Polarity of RPE monolayer was confirmed by measurement of trans-epithelial resistance (TER); mean resistance measured 170 ± 9.5 Ω.cm2 and did not change significantly after 24-hour C2 ceramide treatment. About 23% cell death was observed in non-polarized RPE cells subjected to 24 hour ceramide treatment, while less than 2% cell death was observed in polarized cultures, indicating that the normal RPE monolayer in vivo may have more resistance to ceramide challenge than activated RPE such as those found in AMD lesions or in PVR (p<0.001) (Figs. 7A, 7B).

Figure 7. Exogenously added C2 ceramide induces greater apoptosis in non-polarized RPE cells compared to polarized RPE.

Figure 7

Open in a new tab

A. Polarized fRPE and confluent fRPE were incubated with 25μM C2 ceramide in 1% serum containing medium. Apoptotic cells (red) were determined by fluorescent TUNEL assay as described in the methods. Cell nuclei (blue) were labeled with DAPI. Bar = 40 μm.

B. Semiquantitative measurement of TUNEL positive cells. Apoptosis was significantly higher in non-polarized than in polarized RPE cells subjected to C2 ceramide treatment (**p<0.01, Student’s t test).

4. Discussion

Apoptosis, or programmed cell death, plays a critical role in the pathogenesis of many blinding diseases, including the late stages of AMD (Beatty et al., 2000; Hinton et al., 1998). Understanding the causes and mechanisms of such degenerative disorders will help us to devise new approaches to prevent and treat these diseases. The association between intracellular ceramide production and oxidative injury has been well established. Ceramide plays a critical role in apoptosis, proliferation, cellular senescence, and gene regulation through modulation of a variety of protein kinases and phosphatases and activation of transcription factors such as NFkappaB (Ruvolo, 2003). The close link between reactive oxygen species (ROS) generation, sphingolipid metabolism and ceramide production has been investigated in several cell types that include RPE, retinal pericytes and photoreceptors (Mansat-de Mas et al., 1999, Kannan et al., 2004, Barak et al., 2001, Caciedo et al., 2005, Denis et al., 2002). It was reported that ceramide induced oxidative stress by increasing ROS generation or by inhibiting the ROS scavenger glutathione in lung epithelial cells (Laventiadou et al., 2001). Any dysregulation or imbalance of ceramide or its metabolic products could play a role in the development of apoptosis and disease states such as retinal degeneration (Acharya et al., 2003; Obeid et al., 1993; Tuson et al., 2004).

Ceramide and its metabolic products are generated by a series of enzymatic reactions. The multiple routes of generation and removal of ceramide and its derivates exist in a variety of cell types (Gulbins and Li, 2006). To better understand the ceramide metabolic pathway in RPE cells, we screened the expression of ceramide metabolic pathway enzymes and found that SMPD2, SMPD3, ASAH1, CERK and Sphks were expressed in both ARPE-19 and human fRPE cells indicating that some, but not all, ceramide metabolic pathways, exist in RPE. Our data suggested that RPE cells may utilize SMPD2 and SMPD3 to catalyze sphingomyelin for ceramide generation, ASAH1 to cleave ceramide to form sphingosine, or CERK to phosphorylate ceramide to become C1P, and Sphks, mainly Sphk1, to phosphorylate sphingosine to form S1P. Thus, RPE cells can generate ceramide and sphingosine, which have been demonstrated to induce cell cycle arrest and apoptosis, and can also generate C1P and S1P, which act as antagonists of ceramide and sphingosine to promote cell proliferation and protect cells from a variety of insults.

To establish the association between altered metabolic pathways of major sphingolipids and dysfunction of retinal cells, we artificially manipulated the sphingolipid metabolic pathways by overexpression of specific enzymes in the ceramide pathway, and examined the causal influence of these modulations on the morphology, cell death and survival of RPE in vitro. In this study, we evaluated the induction of apoptosis and cell proliferation after overexpression of SMPD3 or SphK1 in ARPE-19 cells. Our data are consistent with the view that these ceramide metabolic enzymes have opposing functions in regard to cell survival and proliferation; SMPD3 is pro-apoptotic and anti-proliferative, while SphK1 promotes cell proliferation, with no significant change in % apoptosis when compared to vector only control cells. Since these experiments do not address rescue of individual cells, the overall effect of SphK1 overexpression may be due to shifting the balance toward cell proliferation.

In recent years increased attention has been given to neutral sphingomyelinase for its multiple roles in modulating an array of cellular processes such as cell cycle arrest, cell differentiation and apoptosis through the generation of ceramide (Hannun and Luberto, 2000). Our data revealed that SMPD3 overexpressing cells are highly susceptible to apoptosis under serum deprivation conditions, suggesting that ceramide accumulation in cells may be inducing cell death. In support of this view, overexpressing SMPD3 in a human breast cancer cell line, MCF-7, increased cell death induced by the anti-cancer drug daunorubicin, and overexpressing SMPD3 in a human oligodendroglioma derived cell line, HOC, also enhanced cell death induced by staurosporine (Goswami, et al, 2005, Ito et al, 2009). Under our experimental conditions, we found a 25% decrease in cell proliferation rate in SMPD3-overexpressing vs. vector only control ARPE-19 cells, which is similar to the findings in SMPD3-overexpressing MCF7 cells, although different assays were used in the two studies (Marchesini et al., 2003). The biological significance of the role of SMPD3 on the inhibition of cell proliferation needs to be established by further work.

To confirm that the cell death and cell growth arrest were induced by increased SMPD3 expression that, in turn, resulted in increased cellular ceramide level, we inhibited SMPD3 by incubating ARPE-19 cells with GW4869 and found a significant increase in cell proliferation associated with a significant decrease in cell death, which could be attributed to a decrease in ceramide levels. However, GW4869 could not completely prevent the cell death induced by overexpression of SMPD3. The reason for this incomplete, but significant, inhibition of cell death by GW4869 is most likely because, although GW4869 can completely inhibit cellular neutral sphingomyelinase activity in vitro, it only partially prevents the release of cytochrome c from mitochondria (Luberto, et al., 2002). It has been demonstrated that ceramide exerts a direct effect on mitochondria to produce reaction oxygen species (ROS), eventually leading to mitochondrial dysfunction and the release of cytochrome c and Bax to induce apoptosis (Garcia-Ruiz et al., 1997, Quillet-Mary et al., 1997). It is unclear why GW4869 only partially blocks cytochrome c release from mitochondria. It is possible that the mitochondria may have already been partially damaged by the high cellular ceramide levels resulting from SMPD3 action before addition of the inhibitor.

Sphingosine kinases (SphKs) are key enzymes regulating the production of S1P, which determines important cellullar responses, including cell growth and apoptosis (Hait et al., 2006). Our data shows that the overexpression of SphK1 renders cells more resistant to ceramide-induced cell death, with 45% less apoptotic cells observed in SphK1-overexpressing cells that those in vector only control cells. This may arise from a decline in cellular ceramide levels that could trigger apoptotic signaling. A number of studies in various cell types revealed that the overexpression of SphK1 and increased S1P production promote cell growth, enhance the G1/S transition and increase cells in S-phase (Olivera et al., 1999). Furthermore, siRNA mediated gene silencing of SphK1 markedly decreased cell proliferation in glioblastoma cells and increased cell death (Van Brocklyn et al., 2005). The precise mechanisms of SphK1 action in RPE remain to be elucidated.

Our previous work had suggested indirectly that increased ceramide levels might differentially affect polarized RPE, as are found in the normal RPE monolayer, as opposed to non-polarized RPE, as are found in late AMD lesions (Sreekurmar et al., 2008; Vogt et al., 2009). To directly test this hypothesis, we evaluated the effect of C2 ceramide on polarized human RPE cultures in comparison to non-polarized cultures and indeed, found that polarized RPE cultures were much more resistant to the apoptotic effects of C2 ceramide. This suggests that increased ceramide levels may have more profound effects at the site of late AMD lesions where it may promote the progression of the disease by increasing apoptosis.

In summary, we report for the first time the pattern of expression of several ceramide metabolizing enzymes in ARPE-19 cells and early passage fRPE. The role of SMPD3 and SphK1 in cell proliferation and cell death was also studied. SMPD3-overexpressing cells were found to be highly susceptible to cell death even without oxidant injury and exhibited a decrease in cell proliferation. On the other hand, SphK1 was antiapoptotic and protected ARPE cells from ceramide-induced oxidative injury. Furthermore, the proliferation rate of SphK1-overexpressing cells was significantly higher than that of control cells. These findings are likely to have some clinical applications. For example, it was shown that oxidized low density lipoproteins (oxLDL) accumulate in AMD lesions in vivo, and induce significant increases of sphingomyelin, ceramides and cholesteryl esters in ARPE-19 cells in vitro (Yamada et al., 2008). Further, neutral ceramidase was shown to rescue photoreceptor degeneration in Drosophila, while the inhibition of ceramide synthesis prevented paraquat-induced cell death in rat photoreceptor cultures (Acharya et al., 2003; German et al., 2006). Recently, anti-sphingosine-1-phosphate monoclonal antibodies have been shown to inhibit retinal and choroidal angiogenesis in mice (Caballero et al., 2008; Xie et al., 2009). Thus, our present work in RPE, in conjunction with the above mentioned function of ceramide pathway in photoreceptor cell death and rescue, points to a potential therapeutic use of regulators of ceramide metabolism in treatment of retinal degenerative diseases.

Acknowledgements

We thank Christine Spee and Ernesto Barron for their expert technical help. This study was supported in part by Grant EY02061 and by Core grant EY03040 from the National Institutes of Health, Bethesda and an award from the Arnold and Mabel Beckman Foundation.

Footnotes

Portions of this work were presented at the 12th Annual Vision Research Conference on “Mechanisms of Macular Degeneration” at Ft Lauderdale, Fl., May 1-2, 2009.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Acharya U, Patel S, Koundakjian E, Nagashima K, Han X, Acharya JK. Modulating sphingolipid biosynthetic pathway rescues photoreceptor degeneration. Science. 2003;299:1740–1743. doi: 10.1126/science.1080549. [DOI] [PubMed] [Google Scholar]
  2. Alemany R, van Koppen CJ, Danneberg K, TerBraak M, Meyer ZU, Heringdorf D. Regulation and functional roles of sphingosine kinases. Naunyn-Schmiedeberg’s archives of pharmacology. 2007;374:413–428. doi: 10.1007/s00210-007-0132-3. [DOI] [PubMed] [Google Scholar]
  3. An S, Zheng Y. Yuhua, Bleu T. Sphingosine 1-Phosphate-induced Cell Proliferation, Survival, and Related Signaling Events Mediated by G Protein-coupled Receptors Edg3 and Edg5. Journal of Biological Chemistry. 2000;275:288–296. doi: 10.1074/jbc.275.1.288. [DOI] [PubMed] [Google Scholar]
  4. Barak A, Morse LS, Goldkorn T. Ceramide: a potential mediator of apoptosis in human reintal pigment epithelial cells. Investigative Ophthalmology Visual Science. 2001;42:247–254. [PubMed] [Google Scholar]
  5. Beatty S, Koh H, Phil M, Henson D, Boulton M. The role of oxidative stress in the pathogenesis of age-related macular degeneration. Survey of Ophthalmology. 2000;45:115–134. doi: 10.1016/s0039-6257(00)00140-5. [DOI] [PubMed] [Google Scholar]
  6. Bryan L, Kordula T, Spiegel S, Milstien S. Regulation and functions of sphingosine kinases in the brain. Biochimica et biophysica acta. 2008;1781:459–466. doi: 10.1016/j.bbalip.2008.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Caballero S, Swaney J, Moreno K, Afzal A, Kielczewski J, Stoller G, Cavalli A, Garland W, Hansen G, Sabbadini R, Grant MA. Anti-sphingosine-1-phosphate monoclonal antibodies inhibit angiogenesis and sub-retinal fibrosis in a murine model of laser-induced choroidal neovascularization. Experimental Eye Research. 2009;88:367–377. doi: 10.1016/j.exer.2008.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cacicedo JM, Benjachareowong S, Chou E, Ruderman NB, Ido Y. Palmitate-induced apoptosis in cultured bovine retinal pericytes: roles of NAD(P)H oxidase, oxidant stress, and ceramide. Diabetes. 2005;54:1838–1845. doi: 10.2337/diabetes.54.6.1838. [DOI] [PubMed] [Google Scholar]
  9. Campochiaro PA, Kaden IH, Vidaurri-Leal J, Glaser BM. Cryotherapy enhances intravitreal dispersion of viable retinal pigment epithelial cells. Archives of Ophthalmology. 1985;103:434–436. doi: 10.1001/archopht.1985.01050030130038. [DOI] [PubMed] [Google Scholar]
  10. Clarke CJ, Truong TG, Hannun YA. Role for neutral sphingomyelinase-2 in tumor necrosis factor alpha-stimulated expression of vascular cell adhesion molecule-1 (VCAM) and intercellular adhesion molecule-1 (ICAM) in lung epithelial cells: p38 MAPK is an upstream regulator of nSMase2. Journal of Biological Chemistry. 2007;282:1384–1396. doi: 10.1074/jbc.M609216200. [DOI] [PubMed] [Google Scholar]
  11. Cuvillier O, Pirianov G, Kleuser B, Vanek PG, Coso OA, Gutkind S, Spiegel S. Suppression of ceramide-mediated programmed cell death by sphingosine-1-phosphate. Nature. 1996;381:800–803. doi: 10.1038/381800a0. [DOI] [PubMed] [Google Scholar]
  12. Denis U, Lecomte M, Paget C, Ruggiero D, Wiernsperger N, Lagarde M. Advanced glycation end-products induce apoptosis of bovine retinal pericytes in culture: involvement of diacylglycerol/ceramide production and oxidative stress induction. Free Radical Biology and Medicine. 2002;33:236–247. doi: 10.1016/s0891-5849(02)00879-1. [DOI] [PubMed] [Google Scholar]
  13. Dorey CK, Wu G, Ebenstein D, Garsd A, Weiter JJ. Cell loss in the aging retina. Relationship to lipofuscin accumulation and macular degeneration. Investigative ophthalmology & visual science. 1989;30:1691–1699. [PubMed] [Google Scholar]
  14. Garcia-Ruiz C, Colell A, Mari M, Morales A, Fernandez-Checa JC. Direct effect of ceramide on the mitochondrial electron transport chain leads to generation of reactive oxygen species. Journal of Biological Chemistry. 1997;272:11369–11377. doi: 10.1074/jbc.272.17.11369. [DOI] [PubMed] [Google Scholar]
  15. German OL, Miranda GE, Abrahan CE, Rotstein NP. Ceramide is a mediator of apoptosis in retina photoreceptors. Investigative ophthalmology & visual science. 2006;47:1658–1668. doi: 10.1167/iovs.05-1310. [DOI] [PubMed] [Google Scholar]
  16. Goswami R, Ahmed M, Kilkus J, Han T, Dawson SA, Dawson G. Differential regulation of ceramide in lipid-rich microdomains (rafts): antagonistic role of palmitoyl:protein thioesterase and neutral sphingomyelinase 2. Journal of Neuroscience Research. 2005;81:208–217. doi: 10.1002/jnr.20549. [DOI] [PubMed] [Google Scholar]
  17. Gulbins E, Kolesnick R. Raft ceramide in molecular medicine. Oncogene. 2003;22:7070–7077. doi: 10.1038/sj.onc.1207146. [DOI] [PubMed] [Google Scholar]
  18. Gulbins E, Li PL. Physiological and pathophysiological aspects of ceramide. American journal of physiology. Regulatory, integrative and comparative physiology. 2006;290:R11–R26. doi: 10.1152/ajpregu.00416.2005. [DOI] [PubMed] [Google Scholar]
  19. Hait NC, Oskeritzian CA, Paugh SW, Milstien S, Spiegel S. Sphingosine kinases, sphingosine 1-phosphate, apoptosis and diseases. Biochimica et biophysica acta. 2006;1758:2016–2026. doi: 10.1016/j.bbamem.2006.08.007. [DOI] [PubMed] [Google Scholar]
  20. Hannun YA, Luberto C. Ceramide in the eukaryotic stress response. Trends in cell biology. 2000;10:73–80. doi: 10.1016/s0962-8924(99)01694-3. [DOI] [PubMed] [Google Scholar]
  21. Hannun YA, Luberto C, Argraves KM. Enzymes of sphingolipid metabolism: from modular to integrative signaling. Biochemistry. 2001;40:4893–4903. doi: 10.1021/bi002836k. [DOI] [PubMed] [Google Scholar]
  22. Hinton DR, He S, Lopez PE. Apoptosis in surgically excised choroidal neovascular membranes in age-related macular degeneration. Archives of Ophthalmology. 1998;116:203–209. doi: 10.1001/archopht.116.2.203. [DOI] [PubMed] [Google Scholar]
  23. Hofmann K, Tomiuk S, Wolff G, Stoffel W. Cloning and characterization of the mammalian brain-specific, Mg2+-dependent neutral sphingomyelinase. Proceedings of the National Academy of Sciences of the United States of America. 2000;97:5895–5900. doi: 10.1073/pnas.97.11.5895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Igarashi N, Okada T, Hayashi S, Fujita T, Jahangeer S, Nakamura S. Sphingosine kinase 2 is a nuclear protein and inhibits DNA synthesis. Journal of Biological Chemistry. 2003;278:46832–46839. doi: 10.1074/jbc.M306577200. [DOI] [PubMed] [Google Scholar]
  25. Ito H, Murakami M, Furuhata A, Gao S, Yoshida K, Sobue S, Hagiwara K, Takagi A, Kojima T, Suzuki M, Banno Y, Tanaka K, Tamiya-Koizumi K, Kyogashima M, Nozawa Y, Murate T. Transcriptional regulation of neutral sphingomyelinase 2 gene expression of a human breast cancer cell line, MCF-7, induced by the anti-cancer drug, daunorubicin. Biochim Biophys Acta. 2009 Aug 20; doi: 10.1016/j.bbagrm.2009.08.006. (Epub ahead of print) [DOI] [PubMed] [Google Scholar]
  26. Kannan R, Jin M, Gamulescu MA, Hinton DR. Ceramide-induced apoptosis: role of catalase and hepatocyte growth factor. Free radical biology & medicine. 2004;37:166–175. doi: 10.1016/j.freeradbiomed.2004.04.011. [DOI] [PubMed] [Google Scholar]
  27. Krut O, Wiegmann K, Kashkar H, Yazdanpanah B, Kronke M. Novel tumor necrosis factor-responsive mammalian neutral sphingomyelinase-3 is a C-tail-anchored protein. Journal of Biological Chemistry. 2006;281:13784–13793. doi: 10.1074/jbc.M511306200. [DOI] [PubMed] [Google Scholar]
  28. Laventriadou SN, Chan C, Kowcak t., Ravid T, Tsaba A, ven der Vliet A, Rasolly R, Goldkorn T. Ceramide-mediated apoptosis in lung epithelial cells is regulated by glutathione. American Journal of Respiratory Cell and Molecular Biology. 2001;25:676–684. doi: 10.1165/ajrcmb.25.6.4321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liu H, Toman RE, Goparaju SK, Maceyka M, Nava VE, Sankala H, Payne SG, Bektas M, Ishii I, Chun J, Milstien S, Spiegel S. Sphingosine kinase type 2 is a putative BH3-only protein that induces apoptosis. Journal of Biological Chemistry. 2003;278:40330–40336. doi: 10.1074/jbc.M304455200. [DOI] [PubMed] [Google Scholar]
  30. Luberto C, Hassler DF, Signorell P, Okamoto Y, Sawai H, Boros E, Hazen-Martin DJ, Obeid LM, Hannun YA, Smith GK. Inhibition of tumor necrosis factor-induced cell death in MCF7 by a novel inhibitor of neutral sphingomyelinase. Journal of Biological Chemistry. 2002;277:41128–41139. doi: 10.1074/jbc.M206747200. [DOI] [PubMed] [Google Scholar]
  31. Mansat-deMas V, Bezombes C, Quillet-Mary A, Battaieb A, D’Orgeix AD, Laurent G, Jeffrezou JP. Implication of radical oxygen species in ceramide generation, c-Jun N-terminal kinase activation and apopotosis induced by daunorubicin. Molecular Pharmacololgy. 1999;56:867–864. doi: 10.1124/mol.56.5.867. [DOI] [PubMed] [Google Scholar]
  32. Marchesini N, Hannun YA. Acid and neutral sphingomyelinases: roles and mechanisms of regulation. Biochemistry and cell biology. 2004;82:27–44. doi: 10.1139/o03-091. [DOI] [PubMed] [Google Scholar]
  33. Marchesini N, Luberto C, Hannun YA. Biochemical properties of mammalian neutral sphingomyelinase2 and its role in sphingolipid metabolism. Journal of Biological Chemistry. 2003;278:13775–13783. doi: 10.1074/jbc.M212262200. [DOI] [PubMed] [Google Scholar]
  34. Obeid LM, Linardic CM, Karolak LA, Hannun YA. Programmed cell death induced by ceramide. Science. 1993;259:1769–1771. doi: 10.1126/science.8456305. [DOI] [PubMed] [Google Scholar]
  35. Ogretmen B, Hannun YA. Biologically active sphingolipids in cancer pathogenesis and treatment. Nature reviews. Cancer. 2004;4:604–616. doi: 10.1038/nrc1411. [DOI] [PubMed] [Google Scholar]
  36. Olivera A, Kohama T, Edsall L, Nava V, Cuvillier O, Poulton S, Spiegel S. Sphingosine kinase expression increases intracellular sphingosine-1-phosphate and promotes cell growth and survival. The Journal of cell biology. 1999;147:545–558. doi: 10.1083/jcb.147.3.545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Quillet-Mary A, Jaffrezou JP, Mansat V, Bordier C, Naval J, Laurent G. Implication of mitochondrial hydrogen peroxide generation in ceramide-induced apoptosis. Journal of Biological Chemistry. 1997;272(34):21388–21395. doi: 10.1074/jbc.272.34.21388. [DOI] [PubMed] [Google Scholar]
  38. Ruvolo PP. Intracellular signal transduction pathways activated by ceramide and its metabolites. Pharmaceutical Research. 2003;47:383–392. doi: 10.1016/s1043-6618(03)00050-1. [DOI] [PubMed] [Google Scholar]
  39. Sarks SH. Ageing and degeneration in the macular region: a clinico-pathological study. British Journal of Ophthalmology. 1976;60:324–341. doi: 10.1136/bjo.60.5.324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schuchman EH, Suchi M, Takahashi T, Sandhoff K, Desnick RJ. Human acid sphingomyelinase: isolation, nucleotide sequence and expression of the full-length and alternatively spliced cDNAs. Journal of Biological Chemistry. 1991;266:8531–8539. [PubMed] [Google Scholar]
  41. Sonoda S, Spee C, Barron E, Ryan SJ, Kannan R, Hinton DR. A protocol for the culture and differentiation of highly polarized human retinal pigment epithelial cells. Nature Protocols. 2009;4:662–673. doi: 10.1038/nprot.2009.33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sreekumar PG, Ding Y, Ryan SJ, Kannan R, Hinton DR. Regulation of thioredoxin by ceramide in retinal pigment epithelial cells. Experimental Eye Research. 2009;88:410–417. doi: 10.1016/j.exer.2008.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sreekumar PG, Zhou J, Sohn J, Spee C, Ryan SJ, Maurer BJ, Kannan R, Hinton DR. N-(4-hydroxyphenyl) retinamide augments laser-induced choroidal neovascularization in mice. Investigative Ophthalmology and Visual Science. 2008;49:1210–1220. doi: 10.1167/iovs.07-0667. [DOI] [PubMed] [Google Scholar]
  44. Stoffel W, Jenke B, Block B, Zumbansen M, Koebke J. Neutral sphingomyelinase 2 (smpd3) in the control of postnatal growth and development. Proceedings of the National Academy of Sciences of the United States of America. 2005;102:4554–4559. doi: 10.1073/pnas.0406380102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Taha TA, Mullen TD, Obeid LM. A house divided: ceramide, sphingosine, and sphingosine-1-phosphate in programmed cell death. Biochimica et biophysica acta. 2006;1758:2027–2036. doi: 10.1016/j.bbamem.2006.10.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tomiuk S, Hofmann K, Nix M, Zumbansen M, Stoffel W. Cloned mammalian neutral sphingomyelinase: functions in sphingolipid signaling? Proceedings of the National Academy of Sciences of the United States of America. 1998;95:3638–3643. doi: 10.1073/pnas.95.7.3638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tuson M, Marfany TM, Gonzalez-Duarte R. Mutation of CERKL, a novel human ceramide kinase gene, causes autosomal recessive retinitis pigmentosa (RP26) American Journal of Human Genetics. 2004;74:128–138. doi: 10.1086/381055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Van Brocklyn JR, Jackson CA, Pearl DK, Kotur MS, Snyder PJ, Prior TW. Sphingosine kinase-1 expression correlates with poor survival of patients with glioblastoma multiforme: roles of sphingosine kinase isoforms in growth of glioblastoma cell lines. Journal of neuropathology and experimental neurology. 2005;64:695–705. doi: 10.1097/01.jnen.0000175329.59092.2c. [DOI] [PubMed] [Google Scholar]
  49. Yamada Y, Tian J, Yang Y, Cutler RG, Wu T, Telljohann RS, Mattson MP, Handa JT. Oxidized low density lipoproteins induce a pathologic response by retinal pigmented epithelial cells. Journal of Neurochemistry. 2008;105:1187–1197. doi: 10.1111/j.1471-4159.2008.05211.x. [DOI] [PubMed] [Google Scholar]
  50. Xie B, Shen J, Dong A, Rashid A, Stoller G, Campochiaro PA. Blockade of sphingosine-1-phosphate reduces macrophage influx and retinal and choroidal neovascularization. Journal of Cellular Physiology. 218:192–198. doi: 10.1002/jcp.21588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Vogt SD, Curcio CA, Wang L, Li CM, McGwin G, Jr, Medeiros NE, Philp NJ, Kimble JA, Read RW. Altered retinal pigment epithelium morphology is associated with decreased expression of complement regulatory protein CD46 and ion transporter MCT3 in geographic atrophy of age-related maculopathy. Investigative Ophthalmology and Visual Science. 2009;50 ARVO E-Abstract 4180. [Google Scholar]
  52. Zheng W, Kollmeyer J, Symolon H, Momin A, Munter E, Wang E, Kelly S, Allegood JC, Liu Y, Peng Q, Ramaraju H, Sullards MC, Cabot M, Merrill AH., Jr. Ceramides and other bioactive sphingolipid backbones in health and disease: lipidomic analysis, metabolism and roles in membrane structure, dynamics, signaling and autophagy. Biochimica et biophysica acta. 2006;1758:1864–1884. doi: 10.1016/j.bbamem.2006.08.009. [DOI] [PubMed] [Google Scholar]
  53. Zumbansen M, Stoffel W. Neutral sphingomyelinase 1 deficiency in the mouse causes no lipid storage disease. Molecular and cellular biology. 2002;22:3633–3638. doi: 10.1128/MCB.22.11.3633-3638.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES