Mutations of the Metabolic Genes IDH1, IDH2, and SDHAF2 Are Not Major Determinants of the Pseudohypoxic Phenotype of Sporadic Pheochromocytomas and Paragangliomas

Abstract

Context: Pheochromocytomas and paragangliomas are genetically heterogeneous tumors of neural crest origin. Approximately half of these tumors activate a pseudohypoxic transcription response, which is due in a minority of the cases to germline mutations of the VHL gene or the genes encoding subunits of the metabolic enzyme succinate dehydrogenase (SDH), SDHB, SDHC, or SDHD. However, the genetic basis of the hypoxic-like profile of the remaining tumors is undetermined. Mutations in genes involved in the energy metabolism, isocitrate dehydrogenase 1 (IDH1) and -2 (IDH2) and SDHAF2, a component of SDH, can mimic a pseudohypoxic state.

Design: We examined the sequence spanning the mutation-susceptible codons 132 of IDH1 and 172 of IDH2, and the entire coding region of SDHAF2, in 104 pheochromocytomas and paragangliomas, including tumors with a pseudohypoxic expression profile.

Results: We did not find mutations in IDH1, IDH2, or SDHAF2 in any of the tumors in this cohort.

Conclusion: Conserved residues of IDH1 and IDH2 or the SDHAF2 gene are not frequently mutated in pheochromocytomas and paragangliomas. The molecular basis for activation of a hypoxic response in the majority of tumors without VHL or SDH mutations remains to be defined.

Mutations in the metabolic genes IDH1, IDH2, and SDHAF2 do not account for the pseudohypoxic profile of pheochromocytomas and paragangliomas without VHL and SDH mutations.

Pheochromocytomas and paragangliomas are tumors of neural crest origin due, in approximately one third of the cases, to germline mutations in one of six independent genes (1,2). However, the majority of the tumors have no recognizable molecular defect. We and others previously identified pronounced expression of genes related to the hypoxic and angiogenic response, also known as pseudohypoxia, in pheochromocytomas and paragangliomas (3,4,5). This discrete subgroup includes tumors with germline mutations in VHL, the susceptibility gene to von Hippel Lindau (VHL) syndrome, and in the genes encoding for three of the four subunits of succinate dehydrogenase (SDH), SDHB, SDHC, and SDHD, which predispose to familial paraganglioma syndromes type 1, 3, and 4, respectively (1,6,7,8).

The products encoded by these genes are functionally related to the signals involved in the response to hypoxia: VHL is a ubiquitin ligase responsible for proteasome-mediated degradation of the main transcription factor involved in the hypoxia response, the hypoxia-inducible factor (HIF) (9). SDH, a component of the tricarboxylic acid cycle and the complex II of the electron transport chain, controls HIF availability by regulating the activity of the enzymes responsible for limiting HIF half-life, prolyl hydroxylases (PHDs) (10). PHDs are oxygen-dependent enzymes that, by hydroxylating HIF, target it for degradation via the ubiquitin proteasome pathway (11,12). These enzymes also rely on the ratio of the metabolic intermediates α-ketoglutarate (αKG) and succinate for full activity (13). Loss-of-function mutations of SDH subunits, such as those that occur in pheochromocytomas and paragangliomas, lead to accumulation of succinate (10). This excess product inhibits activity of PHDs, which ultimately results in prolonged HIF half-life and generates a pseudohypoxic transcription profile. Our earlier expression profiling analysis indicated that approximately half of the pheochromocytomas and paragangliomas without a known genetic mutation up-regulates genes related to the hypoxic response, similar to VHL and SDH mutants. We refer to this group as cluster 1 tumors (3). This observation, combined with the findings of activated HIF1 as a result of cancer-inducing mutations in fumarate hydratase (14), another component of the energy metabolism, highlights the relevance of metabolic enzymes for the pseudohypoxic feature of tumors.

Mutations of the nicotinamide adenine dinucleotide phosphate⁺-dependent isocitrate dehydrogenase (IDH), encoded by the gene IDH1, were recently identified in various tumors of neural origin (15,16,17). A single conserved IDH1 codon (R132), located on the IDH active site, was found to be mutated in more than 70% of low-grade or secondary gliomas. The analogous residue on the mitochondrial-based IDH2, R172, was also mutated in a smaller number of gliomas, in a mutually exclusive manner with IDH1 mutants. IDH catalyzes the oxidative decarboxylation that converts isocitrate into αKG. The R132 mutation was found to dominantly inhibit wild-type IDH1 by forming a catalytically inactive heterodimer, resulting in decrease of cellular αKG (18). A decrease in αKG levels could potentially alter the succinate to αKG ratio required to maintain optimal activity of PHDs, thus leading to increased HIF availability, similar to that seen in SDH-mutant tumors. As expected, IDH1 mutations affecting codon 132 were shown in vitro to result in increased stability of the HIF1 pathway, which would lead to a pseudohypoxic profile (18). Recently a germline mutation in the SDHAF2 gene (or SDH5, for its yeast ortholog), encoding the enzyme responsible for flavination of the SDHA subunit, was reported to be the primary genetic defect in familial paraganglioma type 2 syndrome (19). Similar to SDHB, SDHC, and SDHD mutations, SDHAF2 mutation disrupts succinate dehydrogenase function and leads to increased intracellular succinate levels (19). Collectively, these data suggest that the metabolic genes IDH1, IDH2, and SDHAF2 are reasonable candidates to induce or enhance the pseudohypoxic phenotype of pheochromocytomas and paragangliomas, especially those without disruptions of the VHL and SDH genes.

Patients and Methods

A total of 104 tumor samples from patients with pheochromocytomas (n = 80) and paragangliomas (n = 24), were used in this study. These samples were obtained through an institutional review board-approved protocol. Tumor tissue was microdissected in one third of the cases or macrodissected in the remainder, and DNA was isolated by standard procedures. All samples were initially screened for somatic or germline mutations in RET (exons 5, 8, 10, 11, 13-16), VHL, SDHB, SDHC, and SDHD genes using previously reported methods (3,20). Germline DNA obtained from blood samples was available from all familial cases and confirmed the constitutive nature of the mutation (Table 1). Microarray-based expression data were available for 33 of these tumors, 17 of which had a transcription profile enriched for genes involved in the hypoxic response (3) (gene expression omnibus accession no. GDS2113 and GSE2841). Tumor location, malignancy, and genetic status as well as expression profiling features of the pheochromocytoma and paraganglioma samples studied are summarized in Table 1.

Table 1.

Clinical, genetic, and transcription features of the pheochromocytoma and paraganglioma cohort

Variables	Patients (n)
Adrenal location	80
Extraadrenal location	24
Head and neck	9
Thoracic and/or abdominal	15
Malignant tumors	8
Genetic status
Sporadic	81
Familial	23
Unknown genetic cause	8
SDHB mutation	3
SDHD mutation	3
SDHC mutation	1
VHL mutation	4
RET mutation	3
NF1 mutation	1
Expression profiling (3)	33
Pseudohypoxic features (cluster 1)	17
Nonpseudohypoxic features (cluster 2)	16
Total number of tumors	104

In this study, we sequenced the exon 4 of IDH1, encompassing codon 132, and the equivalent exon of IDH2, including codon 172, in somatic DNA of 104 and 36 pheochromocytomas and paragangliomas samples, respectively. In addition, 46 of these tumors, including 17 with expression profiling data (Table 1), were sequenced for the entire coding region and exon-intron boundaries of the SDHAF2 gene. The following primers were used for PCR followed by sequencing, as previously described (3,17): IDH1 forward, GAGCTCTATATGCCATCACTGC and IDH1 reverse, CAAGTTGGAAATTTCTGGGC; IDH2 forward, ATTCTGGTTGAAAGATGGCG and IDH2 reverse, ACAAGAGGATGGCTAGGCG; SDHAF2-1 forward, GGCGGCTAGGAGTTCCC, SDHAF2-1 reverse, CCACAGAGGAAGACAAAGGG, SDHAF2-2/3 forward, GCATTGAGTAAATGAAGCGA, SDHAF2-2/3 reverse, CTCAAATCAGCCTAAACTGTCC (spanning both exons 2 and 3); SDHAF2-4 forward, TCTCATACCTGAGCATTGACTG and SDHAF2-4 reverse, AAGCAAGGCTAACGTCCATC. Analysis of sequencing traces was performed with Mutation Surveyor software (Softgenetics, College Station, PA), as described (3).

Results and Discussion

We did not find mutations in codons 132 of IDH1, 172 of IDH2 genes, or the entire coding region of the SDHAF2 gene in this tumor cohort, regardless of the expression profile pattern and genetic status, although we could detect single nucleotide polymorphism previously reported in the database: rs11554137 within IDH1 exon 4 (G105G) and, within SDHAF2 intron 2 rs879647, at 0.04 and 0.2 heterozygosity rates, respectively. This suggests that pathogenic mutations in these genes do not account for the majority of pheochromocytomas and paragangliomas that display a pseudohypoxic profile, nor do they seem to contribute somatically to a small set of tumors with VHL, SDH, or other germline mutations that predispose to these tumors. These findings are in agreement with a recent report in a large series of pheochromocytomas and paragangliomas that found only one somatic IDH1 mutation among 365 tumors examined (21). Despite the findings of our present study, the current knowledge of the biology of chromaffin tumors supports the hypothesis that other genes regulating the interface between energy metabolism and hypoxia remain relevant candidates to explain these tumors’ unique profile. Our data also highlight another open question in this emerging field of cancer-associated mutations in metabolism genes: the spectrum of tumors linked to these mutations is variable. Very recent data provided a potential explanation to this puzzle by demonstrating that, in addition to reduced conversion of isocitrate to αKG, monoallelic IDH1 mutations lead to a change in the catalytic specificity of the enzyme, which results in a new-gained ability of the mutant to reduce αKG to 2 hydroxyglutarate (22). This exciting finding raises the possibility that the clinical phenotype that arises from mutations in distinct metabolic genes in fact reflects unique, qualitative changes in the intermediate metabolic profile of these tissues.