Skip to main content
Molecular Cancer logoLink to Molecular Cancer
. 2010 Jan 24;9:13. doi: 10.1186/1476-4598-9-13

Gene expression profiling of cholangiocarcinoma-derived fibroblast reveals alterations related to tumor progression and indicates periostin as a poor prognostic marker

Kusumawadee Utispan 1,7, Peti Thuwajit 2,7, Yoshimitsu Abiko 3, Komgrid Charngkaew 4, Anucha Paupairoj 5,7, Siri Chau-in 6,7, Chanitra Thuwajit 2,7,
PMCID: PMC2841583  PMID: 20096135

Abstract

Background

Fibroblasts play important roles in several cancers. It was hypothesized that cholangiocarcinoma (CCA)-associated fibroblasts (Cfs) differ from non-tumorigenic liver fibroblasts (Lfs) in their gene expression profiles resulting in the capability to promote cancer. Periostin (PN) is a multi-functional protein and has emerged as a promising marker for tumor progression. The role of PN in CCA, however, has not yet been explored.

Results

In this study, the gene expression profile of Cfs in comparison to Lfs was performed using oligonucleotide microarrays. The common- and unique-expressed genes in Cfs and the promising roles in cancer promotion and progression were determined. PN was markedly over-expressed in Cfs confirmed by real time RT-PCR and western blot analysis. Immunohistochemistry examination of a number of patients with intrahepatic CCA showed the expression of PN solely in stromal fibroblasts, but was expressed neither in cancer cells nor immune cells. Low to no expression of PN was observed in tissues of benign liver disease and hepatocellular carcinoma. CCA patients with high levels of PN had significantly shorter survival time than those with low levels (P = 0.026). Multivariate analysis revealed high levels of PN (P = 0.045) and presence of lymph node metastasis (P = 0.002) as independent poor prognostic factors. The in vitro study revealed that recombinant PN induced CCA cell proliferation and invasion. Interestingly, interference RNA against integrin α5 significantly reduced the cellular response to PN-stimulated proliferation and invasion.

Conclusion

The gene expression profile of fibroblasts in CCA is apparently explored for the first time and has determined the genes involving in induction of this cancer progression. High PN can be used to distinguish CCA from other related liver diseases and is proposed as a prognostic factor of poor survival. Regulation of fibroblast-derived PN in CCA proliferation and invasion may be considered as an alternative therapeutic approach.

Background

Cholangiocarcinoma (CCA) originates from biliary epithelial cells and is a unique cancer in northeastern Thailand where the prevalence of a liver fluke, Opisthorchis viverrini infection is higher than elsewhere in the country. A recent study showed a strong positive correlation of CCA incidence and the prevalence of O. viverrini infection [1]. In other countries, CCA has been shown to correlate with Clonorchis sinesis [2,3], and chronic biliary diseases [4]. Even though CCA is caused from the different etiologies, it is well recognized to contain an abundant fibrous stroma that is mainly composed of α-smooth muscle actin (SMA) positive fibroblasts [5,6]. In addition, the degree of α-SMA expression has been shown to correlate with the survival of patients, in part, via the ability of these cancer-associated fibroblasts to induce proliferation of bile duct epithelial and cancer cells [6].

The ability of stromal fibroblasts to generate a favorable microenvironment for cancer cells leading to cancer development, invasion and metastasis has been summarized [7,8]. Mitotic substances have been produced from stromal fibroblasts to promote tumor growth in many cancers [9,10]. In addition, some matrix metalloproteinases which are often mentioned as proteolytic substances of the extracellular matrix (ECM) and have been reported to show increased production from cancer stromal fibroblasts. These proteolytic substances appear to help to promote cancer cell invasion and metastasis [11]. Specifically, in CCA, stromal-derived factor 1 (SDF-1) has been secreted from stromal fibroblasts into the microenvironment in which it was located at the edge of cancer masses and was proposed to play important role in induction of CCA cell invasion and metastasis [12].

To understand the roles of fibroblasts in carcinogenesis, cancer promotion and progression, gene profiling of cancer fibroblasts have been studied in many cancers [13-15]. Stromal cancer fibroblasts from breast cancer with invasion were compared with the expression profiles of fibroblasts in benign breast disorders. HYL (Csk-homologous kinase CHK) involving in regulation of Src kinase, GM CSF-1 (granulocyte monocyte colony stimulating factor-1) and osteopontin were up-regulated which may result in induction of tumor growth and metastasis [13]. Among genes encoded for secreted proteins over-expressed in fibroblasts of human basal cell carcinoma [14], genes including CTSK (cathepsin K), SFRP2 (secreted frizzled-related protein 2), PDGFRL (platelet-derived growth factor receptor-like protein), and DCN (decorin) were shown to be up-regulated in non-epithelial cells of breast cancer [16]. In contrast, these genes could not be detected in fibroblasts isolated from cancers of pancreas [17], and liver metastases of colon cancer [18]. Taken together, it is possible to say that differential gene expression profile of cancer fibroblasts is partly similar but actually unique for each cancer type. This supports the importance of specific recognition of the concerted performance between fibroblasts and epithelial cells in carcinogenesis and progression in different organs of origin. So it is of great value to investigate the specific gene expression profile of the CCA-derived fibroblasts to help us better understand the molecular mechanisms that fibroblasts use to promote cancer.

Periostin (PN) is a secreted protein which was first identified in bone and implicated in regulating adhesion and differentiation of osteoblasts. The cancer biology role of PN has been investigated in a wide range of cancers including cell proliferation [19,20], migration [21], invasion/metastasis [22,23], and angiogenesis [23,24]. When not regarding the specific sources, either from cancer cells or fibroblasts, secreted PN has been reported to induce tumorigenic properties of epithelial cells via the activation of integrins (ITGs) receptors [21].

Even though substantial evidence has shown that cancer-associated fibroblasts are involved in tumor promotion and with the evidence that fibroblasts in CCA induce more aggressive tumorigenic properties of cancer cells [6], the role of CCA-derived fibroblasts in this cancer is yet to be determined. In the present study, fibroblasts isolated from CCA tissues or CCA-associated fibroblasts (Cfs) which were already characterized by the present group [6], were explored. The genome wide expressions of these Cfs were determined and compared to non-tumorigenic liver fibroblasts (Lfs). The altered expression of genes focusing on the impact of soluble products from Cfs on the promotion and progression of CCA was investigated. Interestingly, PN, which has never been reported in CCA was found at a high level whereas no-to-low PN was detected in non-tumor liver tissues and cancer of hepatocytes. The overexpression of PN in CCA tissues was detected solely in fibroblasts and associated with poor prognosis and short survival of the patients. The effect of PN to induce cell proliferation and invasion has been examined.

Results

Gene expression analysis of Cf and validation by real time RT-PCR

To reduce the genetic background of different patients, the gene expression profile of Cfs was compared to those of two Lfs namely Lf1 and Lf2. Lf1 was isolated from non-tumorigenic liver tissues of hepatectomized liver from the CCA patient who Cfs were originated from. The Lf2 was isolated from the other CCA patient. Genes with differential expressed levels in Cf compared to Lf1 were 3,560 for 2-fold or more up-regulation and 2,339 for 0.5-fold or less down regulation (Fig 1A and 1B). The comparison of the Cf to Lf2 was 4,579 and 3,348 for up- and down-regulation. The common differential genes which are genes altered in their expressions in Cfs when compared to both Lf1 and Lf2 (Cf/Lfs), were 1,466 for up-regulation and 495 for down-regulation. Arylacetamide deacetylase (DAC), procollagen C endopeptidase enhancer 2 (PCPE2), serpin peptidase inhibitor (PAI) and S100 calcium binding protein A4 (S100A4) were predominantly over-expressed at high levels in Cfs whereas bone morphogenic protein 2 (BMP2), matrix-remodeling associated 5 (DKFZp564I1922), bradykinin receptor B1 (BRADYB1), response gene to complement 32 (RGC32) and interleukin 24 (IL-24) were down-regulated with a high array intensity (Table 1).

Figure 1.

Figure 1

Genome wide expression analysis of Cf and Lfs and gene validation by real time PCR. A Vane diagram showed common up-regulated genes (A) and common down-regulated genes (B) in Cf (Cf/Lfs). In this study, eleven genes encoded secreted proteins involved in induction of epithelial cell tumorigenesis including proliferation, invasion, metastasis and angiogenesis were selected from 4 main different groups of biological functions (A). The numbers in the parentheses represent folds of gene expression level of Cf over those in Lfs. The results show the comparison of gene expression levels measured by real time PCR and oligonucleotide microarray (C). Folds of expression represent fold changes of gene expression level in Cfs as compared to that in Lfs.

Table 1.

List of top 20 common up-regulated genes and top 20 common down-regulated genes.

Gene Abbreviation Intensity Mismatch Ratio
Common up-regulated genes of Cf binding Cf/Lfs
arylacetamide deacetylase (esterase) DAC 115.92 P 956.45
sparc/osteonectin (testican 3) SPOCK3 16.70 P 669.24
neuropeptide Y receptor Y1 NPYR 20.86 P 416.71
collagen, type XIV, alpha 1 (undulin) COL14A1 47.74 P 245.03
growth associated protein 43 B-50 23.52 P 232.10
procollagen C-endopeptidase enhancer 2 PCPE2 117.81 P 224.83
sorbin and SH3 domain containing 2 SORB2 10.65 P 192.25
myozenin 2 MYOZ2 6.53 P 139.50
serpin peptidase inhibitor, clade B (ovalbumin), member 2 transcript variant 2 PAI2 260.13 P 133.32
doublecortin-like kinase 1 DCLK 19.11 P 112.57
formyl peptide receptor-like 2 FPRL2 3.24 P 111.02
contactin associated protein-like 3 CASPR3 5.09 P 106.75
integrin, beta-like 1 (with EGF-like repeat domains) ITGBL1 13.35 P 82.92
collagen, type IV, alpha 6 COL4A6 76.71 P 77.06
myc target 1 MYCT1 28.15 P 73.88
S100 calcium binding protein A4 S100A4 103.88 P 72.30
phosphodiesterase 1A, calmodulin-dependent HSPDEA1 12.50 P 71.51
neurofilament, light polypeptide 68 kDa NEFL 5.71 P 69.33
ADAMTS-like 1 ADAMTSR1 3.24 P 68.55
early B-cell factor 1 EBF 4.57 P 60.80

ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 SIAT7E 0.02 P 3943.41
fibrillin 2 (congenital contractural arachnodactyly) FBN2 0.05 P 1035.17
fibroblast growth factor receptor 2 FGFR2 0.04 P 684.03
pregnancy specific beta-1-glycoprotein 5 PSG 0.07 P 349.77
Sal-like 1 (Drosophila) SALL1 0.03 P 312.29
membrane metallo-endopeptidase MME 0.05 P 274.25
odz, odd Oz/ten-m homolog 2 (Drosophila) TEN-M2 0.93 P 134.10
R-spondin 3 homolog (Xenopus laevis) RSPO3 0.4 P 70.16
bone morphogenetic protein 2 BMP2A 1.19 P 68.96
neuroligin 4, Y-linked NLGN4Y 0.09 P 68.62
matrix-remodelling associated 5 DKFZp564I1922 1.31 P 57.89
collagen, type IV, alpha 4 COL4A4 0.67 P 49.71
bradykinin receptor B1 BRADYB1 1.61 P 48.96
microfibrillar-associated protein 4 MFAP4 0.3 P 32.40
matrix metallopeptidase 3 (stromelysin 1, progelatinase) MMP-3 0.85 P 30.01
chromosome 13 open reading frame 15 RGC32 1.69 P 28.40
fibroblast growth factor 13 FGF13 0.38 P 28.15
ephrin receptor A5 EPHA5 0.40 P 25.68
interleukin 24 IL-24 1.68 P 25.27

Only those having transcripts, not EST or clones in cDNA library are listed.

P = presence to detectable intensity

Most of common differentially expressed genes in Cfs play roles in controlling cellular metabolism (Table 2 and Table 3). The up-regulated genes encoded for secreted proteins were mostly classified in groups of extracellular region, proteolysis, and ECM organization/biosynthesis which took up to 11% of total genes (Table 2). Among these genes in addition to the secreted protein encoding genes that act in cell proliferation and motility, 11 genes having several tumorigenic functions were selected for further exploration including a disintegrin and matrix metalloproteinase 12 (ADAM12), amphiregulin (AREG), angiopoietin (AGN2), epiregulin (ER), jagged1 (JAGL1), laminin alpha 5 (LAMA5), nephroblastoma over expressed (NOV), platelet-derived growth factor-α (PDGF-A), periostin (PN), reelin (RL), and secretogranin 2 (SCG2) (Fig 1A).

Table 2.

Gene ontology of common up-regulated genes. Only genes in the top-five ranking of each group are shown.

Gene ontology (%) Accession no. Description Ratio
Cellular metabolism (23.7%) NM_000909 neuropeptide Y receptor Y1 416.71
NM_004734 doublecortin-like kinase 1 112.57
NM_002961 S100 calcium binding protein A4 72.30
AF208502 early B-cell factor 1 60.80
AW004016 ST6 beta-galactosamide alpha-2,6 sialyltransferase 2 59.04

Protein binding (20.8%) BF449063 collagen, type XIV, alpha 1 (undulin) 245.03
NM_002045 growth associated protein 43 232.10
AI659533 sorbin and SH3 domain containing 2 192.25
BF939176 myozenin 2 139.5
AF333769 contactin associated protein-like 3 106.75

Signal transduction (10.9%) AW026543 formyl peptide receptor-like 2 111.02
NM_004791 integrin, beta-like 1 82.92
NM_005019 phosphodiesterase 1A 71.51
AF159570 regulator of G-protein signalling 5 49.64
W67461 angiopoietin-like 1 49.16

Extracellular region (7.8%) NM_001086 arylacetamide deacetylase (esterase) 956.45
AI808090 Sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 669.24
NM_013363 procollagen C-endopeptidase enhancer 2 224.83
AI889941 collagen, type IV, alpha 6 77.06
NM_052866 a disintegrin and metalloproteinase with thrombospondin motif-like 1 68.55

Transcription factor (7.5%) AF332197 sine oculis homeobox homolog 2 44.20
AI681917 iroquois homeobox protein 3 35.34
NM_020639 receptor-interacting serine-threonine kinase 4 29.41
AK023792 PBX/knotted 1 homeobox 2 29.40
AF208967 paternally expressed 3 26.74

Protein modification (5.5%) AW975934 Titin 32.01
NM_020639 receptor-interacting serine-threonine kinase 4 29.41
NM_000222 v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 25.21
BF446673 hemicentin 1 18.96
NM_002848 protein tyrosine phosphatase, receptor type, O 14.58

Receptor (4.8%) BF941499 G protein-coupled receptor 116 35.62
L35594 ectonucleotide pyrophosphatase/phosphodiesterase 2 32.11
NM_002820 parathyroid hormone-like hormone 30.44
U61276 jagged 1 (Alagille syndrome) 19.60
AK022548 integrin, alpha 7 15.62

Cell differentiation (4.3%) AA343027 Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D 67.06
NM_000216 Kallmann syndrome 1 sequence 27.91
AL560266 Fc receptor-like A 19.61
AA127691 neuropilin 2 19.35
NM_002506 nerve growth factor, beta polypeptide 19.11

Cell adhesion (3.5%) NM_006727 cadherin 10, type 2 (T2-cadherin) 55.43
NM_000072 CD36 molecule (thrombospondin receptor) 40.71
AL573851 endothelial cell adhesion molecule 22.52
N69091 protocadherin 17 22.32
AA489646 protocadherin beta 13 19.36

Cell cycle (2.4%) NM_003914 cyclin A1 34.8
NM_015714 G0/G1switch 2 26.62
NM_001759 cyclin D2 16.45
NM_001992 coagulation factor II (thrombin) receptor 13.90
AK024082 Tousled-like kinase 2 11.09

Cell motility (2.2%) NM_005045 reelin 17.30
NM_003062 slit homolog 3 (Drosophila) 5.12
M21121 chemokine (C-C motif) ligand 5 5.06
NM_014795 zinc finger E-box binding homeobox 2 4.85
D45864 protein kinase, cGMP-dependent, type I 4.74

Proteolysis (2.0%) NM_001870 carboxypeptidase A3 (mast cell) 20.01
NM_024539 ring finger protein 128 12.68
AL574912 protease, serine, 35 11.59
NM_001873 carboxypeptidase E 9.45
NM_000892 kallikrein B, plasma (Fletcher factor) 1 6.40

Cell proliferation (2.0%) U77914 jagged 1 (Alagille syndrome) 16.76
NM_004624 vasoactive intestinal peptide receptor 1 13.07
BF514079 Kruppel-like factor 4 (gut) 12.89
NM_001432 epiregulin 11.98
BC003355 laminin, alpha 5 10.36

Apoptosis (1.6%) NM_002575 serpin peptidase inhibitor 133.32
NM_000557 growth differentiation factor 5 14.79
NM_003728 unc-5 homolog C (C. elegans) 9.60
BF432648 tumor necrosis factor receptor superfamily 8.73
NM_003551 non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) 6.80

ECM organization and biosynthesis (0.9%) BC001186 protocadherin beta 5 15.90
M25813 tenascin XB 12.46
NM_002380 matrilin 2 4.89
AY140646 periostin, osteoblast specific factor 2 4.89
NM_004612 transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53 kDa 4.56

Table 3.

Gene ontology of common down-regulated genes.

Gene ontology (%) Accession no. Description Ratio
Cellular metabolism (31.6%) NM_030965 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 3943.41
NM_022969 fibroblast growth factor receptor 2 684.03
AU152837 Sal-like 1 (Drosophila) 312.29
NM_007287 membrane metallo-endopeptidase 73.38
BF589322 R-spondin 3 homolog (Xenopus laevis) 70.16

Signal transduction (17.8%) NM_001200 bone morphogenetic protein 2 68.96
NM_000710 bradykinin receptor B1 48.96
R72286 microfibrillar-associated protein 4 32.40
NM_004114 fibroblast growth factor 13 28.15
BE218107 EPH receptor A5 25.68

Transcription factor (11.5%) AJ277914 LIM homeobox 9 25.01
NM_001452 forkhead box F2 18.08
AA705845 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) 17.16
BG261252 ecotropic viral integration site 1 11.58
NM_020327 activin A receptor, type IB 9.32

Protein modification (7.9%) AF245505 matrix-remodelling associated 5 57.89
AA725644 ubiquitin specific peptidase 42 18.73
NM_001982 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 11.34
AV727260 protein tyrosine phosphatase, receptor type, D 10.93
NM_002570 proprotein convertase subtilisin/kexin type 6 9.83

Cell differentiation (6.2%) NM_000641 interleukin 11 17.51
BC006454 growth arrest-specific 7 15.20
M69148 midkine (neurite growth-promoting factor 2) 14.03

NM_003991 endothelin receptor type B 10.85
AI758962 EPH receptor A4 7.15

Cell adhesion (5.9%) NM_001999 fibrillin 2 1035.17
NM_014893 neuroligin 4, Y-linked 68.62
AI694562 collagen, type IV, alpha 3 22.21
NM_005864 embryonal Fyn-associated substrate 8.44
AU146651 collagen, type XII, alpha 1 4.89

Cell cycle (5.9%) NM_014059 chromosome 13 open reading frame 15 28.40
M19701 retinoblastoma 1 (including osteosarcoma) 4.93
NM_002009 fibroblast growth factor 7 4.44
NM_014703 Vpr (HIV-1) binding protein 3.92
AI983033 DEAD/H box polypeptide 12 3.91

Cell motility (4.7%) NM_002784 pregnancy specific beta-1-glycoprotein 9 69.22
X99268 twist homolog 1 5.45
NM_015180 spectrin repeat containing, nuclear envelope 2 3.81
AI990816 laminin, alpha 1 3.59
N90777 neuropilin 2 3.57

Cell proliferation (4.5%) NM_016931 NADPH oxidase 4 5.79
AF064826 glypican 4 4.31
NM_004525 low density lipoprotein-related protein 2 3.85
NM_001963 epidermal growth factor (beta-urogastrone) 3.70
AF064103 CDC14 cell division cycle 14 homolog A 3.67

Apoptosis (4.0%) NM_006850 interleukin 24 25.27
NM_002135 nuclear receptor subfamily 4, group A, member 1 5.48
NM_003823 tumor necrosis factor receptor superfamily 4.59
AJ301610 glutamate receptor, ionotropic, kainate 2 3.92
NM_005809 peroxiredoxin 2 3.90

Only genes in the top-five ranking of each group are shown.

The up-regulated levels of these genes in Cfs were verified by relative quantification using real time RT-PCR. In concordance with microarray data, real time RT-PCR results revealed that ADAM12, AREG, ER, JAGL1, PDGF-A, PN and SCG2 had significant up-regulations in Cfs compared to Lfs, but that of NOV was not statistically significantly increased (Fig 1C). ANG2, LAMA5, and RL, however, showed the opposite direction to the microarray results.

Detection of PN expression in Cf and CCA tissues

Using different biological preparation lots of Cfs from those used in microarray analysis, both real time RT-PCR and western blot analysis confirmed that Cfs had higher expressions of PN than Lfs with statistical significance (Fig 2A and 2B). The expression of PN in KKU-100, KKU-M055, KKU-M156 and KKU-M213 CCA cell lines was detected at a very low level compared to the high expression in Cfs (Fig 2C).

Figure 2.

Figure 2

PN expressions in Cfs, CCA cell lines and CCA tissues. PN expression in Cfs measured by real time RT-PCR (A) and western blot analysis (B) using different biological preparations of Cfs and Lfs from those used in microarray. The expression of PN in CCA cell lines and fibroblasts extracted from CCA tissues is graphically depicted (C). Results are expressed as mean ± SD of three independent experiments. Means of PN mRNA expression levels were measured in 20 CCA cases and compared to 5 cases of benign liver diseases using both β-actin and gapdh as internal controls (D). The positive correlation of mRNA and protein levels of PN in CCA tissues is shown with statistical significance by Spearman correlation analysis (E).

To check whether the increased expression of PN mRNA can be found in CCA tissues, real time PCR was performed using total RNA extracted from pieces of CCA mass. Using β-actin and gapdh as the internal controls, the results showed the median of PN mRNA expression was higher in CCA tissues (4.347 and 2.449 using β-actin and gapdh respectively) than in benign liver tissues (1.064 and 1.625, respectively) (Fig 2D). This increased up-regulation was not statistically significant. In addition, to achieve the aim to use a rapid method such as real time PCR in place of immunohistochemical detection of PN in CCA tissues, the PN mRNA level was related to the intensity of PN immunoreactivity detected by immunohistochemistry. The results indicated the positive correlation of PN mRNA level and the encoding protein found in CCA tissues with statistical significance (P = 0.045) (Fig 2E).

Expression of PN in CCA tissues and clinicopathological relevance

Immunohistochemistry revealed that the expression of PN was exclusively localized in fibroblasts but not cancer cells (Fig 3). Of all 52 cases, 43 cases or 83% were PN positive (Table 4). Among these positive cases, 58% of them showed high expression levels. High expression of PN was observed in well- (Fig 3A), moderately- (Fig 3B) and poorly-differentiated malignant tissues (Fig 3C). For PN-negative CCA tissues, only 17% (9/52) were in this group in which no PN was detected in either fibroblasts or cancer cells (Fig 3D). In contrast, benign liver tissues showed no (2/8) to slight (6/8) PN expression. Similar to benign liver tissues, hepatocellular carcinoma revealed low PN expression in their stromal cells (Fig 3E and 3F). Moreover, double immunofluorescence staining revealed co-localization of α-SMA and PN in the fibroblasts within cancerous area (Fig 3G).

Figure 3.

Figure 3

Immunohistochemical staining of PN in CCA tissues. The expression of PN was localized in fibroblasts but not cancer cells. High expression of PN was observed in well- (A), moderately- (B) and poorly-differentiated tissues (C), whereas PN negative staining CCA tissue was demonstrated (D). Benign liver tissue (E) and hepatocellular carcinoma (F) showed no to slight expression. Magnification, 100×. Double immunofluorescence staining showed co-expression of PN and α-SMA in CCA stromal fibroblasts (G). Magnification, 200×.

Table 4.

PN expression in CCA tissues compared to benign liver tissues and hepatocellular carcinoma.

Tissues Total cases
(n)
PN expression in fibroblasts

Negative Positive
Low High
CCA 52 9 (17%) 13 (25%) 30 (58%)
Benign liver tissue 8 2 (25%) 6 (75%) 0 (0%)
Hepatocellular carcinoma 4 1 (25%) 3 (75%) 0 (0%)

Cumulative survival of CCA patients with low or high PN expression in cancer stromal fibroblasts was analyzed using the Kaplan-Meier method. The patients with survival time under 14 d were identified as peri-operative deaths (n = 1) and excluded from the analysis. Median survival time was 395 ± 157 d for patients with low and 179 ± 35 d for patients with high PN expression. We found that the patients with high PN positive fibroblasts had statistically significantly shorter survival times than those with low PN positive fibroblasts (P = 0.026) (Fig 4). The prognostic value of PN expression and other clinicopathological factors among CCA patients was analyzed using multivariate Cox Proportional Hazard Regression model. The results revealed that high PN expression (HR = 2.02, P = 0.045), and the presence of lymph node metastasis (HR = 3.13, P = 0.002) were the independent risk factors for the overall survival of CCA patients after hepatectomy (Table 5). However, lymph node metastasis and other clinical data showed no association with PN expression (Table 6).

Figure 4.

Figure 4

Multivariate analysis using Kaplan-Meier method. Cumulative survival analysis showed significantly shorter survival time of the patients with high PN expression in fibroblasts when compared to those who had low PN expression in fibroblasts (P = 0.026).

Table 5.

Multivariate analysis by Cox proportional hazard regression model for the evaluation of prognostic factors.

Variable
(No. of patients)
No. of dead
patients
Hazard ratio 95% confidence interval P
(5-yr survival cut-off) (HR) (CI)
Age in years
≤ 57 (25) 21 1
>57 (26) 22 1.25 0.62-2.48 0.533
PN expression
Low (22) 17 1
High (29) 26 2.02 1.02-4.02 0.045*
Lymph node metastasis
Absence (36) 28 1
Presence (15) 15 3.13 1.54-6.35 0.002*
Histological type
Well-differentiated (20) 16 1
Moderately-differentiated (8) 8 2.77 1.10-6.98 0.031*
Poorly-differentiated (8) 7 1.64 0.63-4.29 0.310
Papillary (15) 12 0.60 0.25-1.44 0.254
Tumor size (cm)
≤ 5 (28) 23 1
>5 (23) 20 1.49 0.76-2.94 0.251

* P value of equal or less than 0.05 means statistical significance

Table 6.

Correlation between PN expression level and clinicopathological parameters.

Variable n PN expression (%) Univariate analysis Multivariate analysis

Low High P HR P
Age in years 0.575
≤ 57 26 10 (38.5) 16 (61.5) 1
>57 26 12 (46.2) 14 (53.8) 0.899 0.870
Sex 0.375
Female 20 10 (50.0) 10 (50.0) 1
Male 32 12 (37.5) 20 (62.5) 1.638 0.452
Histological type 0.083
Well-differentiated 21 8 (38.1) 13 (61.9) 1
Moderately-differentiated 8 1 (12.5) 7 (87.5) 3.720 0.271
Poorly-differentiated 8 6 (75.0) 2 (25.0) 0.184 0.86
Papillary 15 7 (46.7) 8 (53.3) 0.611 0.505
Tumor size (cm) 0.123
≤ 5 29 15 (51.7) 14 (48.3) 1
>5 23 7 (30.4) 16 (69.6) 2.493 0.161
Lymph node metastasis 0.830
Absence 37 16 (43.2) 21 (56.8) 1
Presence 15 6 (40.0) 9 (60.0) 1.459 0.590

PN promotes proliferation and invasion of CCA cells

PN could induce proliferation of KKU-M156, KKU-M213 and KKU-M055 CCA cell lines (Fig 5A-C), but not KKU-100 (Fig 5D). In addition, KKU-M156, KKU-M213 and KKU-M055 responded to the proliferative effect of optimal PN concentration in a time dependent manner with statistical significance at the 24 h-treatment for all cell types (Fig 5E). To reinforce the proliferation effect of PN on CCA cell lines, colony formation assay with and without soft agar were performed and the result indicated the increased numbers of colonies in the condition of PN treatment in comparison to the negative control without PN stimulation (Fig 5F). In addition, flow cytometric analysis indicated an increased number of KKU-M213 and KKU-M156 cells distributed in S+G2/M when exposed to PN (Fig 6A and 6B).

Figure 5.

Figure 5

PN promotes cell proliferation of CCA cell lines. KKU-M156, KKU-M213 and KKU-M055 showed significantly induced proliferation with different concentrations of PN (A-C) whereas KKU-100 was unresponsive to PN (D). With an optimal dose of PN for each cell line, KKU-M213, KKU-M156, and KKU-M055 increased cell proliferation in a time-dependent manner (E). Triplicate experiments were performed for each assay. Results are expressed as mean ± SD and an asterix represents a P value less than 0.05 when compared to the negative controls without PN treatment. Black and dashed lines represent cells with and without PN treatment, respectively. Colony formation assay with and without agar was performed (F). Colony of more than 30 cells was counted under inverted microscope. Numbers of colonies/well in 6-well plate of both KKU-M213 and KKU-M156 CCA cell lines were higher in condition of PN treatment than those without PN. Results are expressed as mean ± SD of duplicate experiments. Pictures of crystal violet-stained cells are of KKU-M213 CCA cells in comparison between with and without PN.

Figure 6.

Figure 6

Cell cycle distribution and invasion analysis of cancer cells with and without stimulation by PN. Cell cycle analysis of KKU-M213 and KKU-M156 induced by PN (A). PN could drive cells from G1 into S and G2/M phases of the cell cycle when compared to control cells without PN treatment (B). Invasion induction by PN on KKU-M213 and KKU-M156 CCA cell lines is shown (C). Numbers of invaded cells when no PN was used served as control and were adjusted to be 100% (white bar). The increase of invaded cells induced by PN is observed and shown by a black bar. Each bar graph represents mean ± SD of three independent experiments. An asterix represents a P value of less than 0.05.

To address the invasion effect of PN on CCA cells, the invasion assay of cell lines with high ITGα5 expression was performed in a Boyden chamber. The results showed that exogenous PN could markedly induce invasion of KKU-M156 and KKU-M213 CCA cell lines up to around 210% and 230% of cells without PN treatment (Fig 6C).

Knockdown of ITGα5 attenuates PN-induced proliferation and invasion

Treatment of CCA cells with siITGα5 and lipofectamine (mock) for 6 h did not affect cell viability (Fig 7A). The reduction of ITGα5 expression was observed to be 88% of that expressed in both KKU-M213 and KKU-M156 CCA cells without transient knockdown of this gene (Fig 7B). The knockdown effect could be detected up to 72 h after siITGα5 treatment (data not shown). Thus, the subsequent investigations of cell proliferation and invasion were done within 72 h after transient knockdown with siITGα5.

Figure 7.

Figure 7

Effect of siITGα5 on PN-induced proliferation and invasion of CCA cells. Lipofectamine-treated cells (mock) had nearly the same viability as siITGα5-treated cells (A). KKU-M213 and KKU-M156 showed dramatically decreased expression of ITGα5 detected by real time RT-PCR after exposure to siITGα5 (B). Percentage of proliferation and invasion compared to control mock cells is shown. The siITGα5-treated cells (negative ITGα5) could not respond to PN in induction of proliferation as much as that detected in cells without exposure to siITGα5 (positive ITGα5) (C). A similar effect was observed in PN-induced invasion of CCA cell lines (D). Results represent mean ± SD of three independent experiments and an asterix represents significantly increased cell proliferation and invasion by PN compared to mock cells without PN treatment.

The reduction of ITGα5 expressions in both KKU-M213 and KKU-M156 CCA cells resulted in a significant decreased response of cells to PN-induced cell proliferation and invasion (Fig 7C and 7D). A 104% of KKU-M213 cell proliferation induction was detected in siITGα5-treated cells exposed to PN, whereas cell proliferation could increase up to 130% in cells with intrinsic ITGα5 expression (Fig 7C). In the same manner, KKU-M156 showed 118% and 98% of cell proliferation induction observed in cells untreated and treated with siITGα5. Both ITGα5-knockdown CCA cell lines did not respond to PN-activated cell invasion whereas PN dramatically induced invasion of both cell lines having normal intrinsic ITGα5 expression (168% for KKU-M156 and 172% for KKU-M213) (Fig 7D). Finally, cells with high ITGα5 expressions were more susceptible to PN stimulation to proliferate and invade than cells without or minimal ITGα5 expression.

Discussion

Cancer-associated fibroblasts have been recognized for their impact in the genesis, promotion and progression of many carcinomas and highlighted in several reviews [8,25]. CCA is notoriously associated with dense desmoplastic stroma with activated fibroblasts [5,6]. Relatively little, however, is known about the contribution of the stromal fibroblasts to CCA. The authors in the present group have recently shown that CCA stromal fibroblasts, with and without direct interaction with cancer cells could induce cancer cell proliferation [6]. Herein, this study focused on the gene expression profile of CCA-derived fibroblasts in order to investigate the molecular mechanism of how fibroblasts induce a favorable microenvironment to promote cancer. Even though the current study is limited to a single cancer fibroblast line isolated from a single CCA patient, the validity of array results was strengthened by comparing gene expression levels in cancer fibroblasts to the two lines of normal fibroblasts; one isolated from the same CCA patient and the other from a second patient. Only genes in cancer fibroblasts altered from both normal fibroblast lines were investigated as the common up- or down-regulated genes. This is to provide evidence that the fibroblasts used in our study are valid representatives of fibroblasts found in CCA.

By comparing gene profiles in fibroblasts from CCA with those of other tumor types, it is suggested that CCA fibroblasts display not only common genotypes for activated cells but also unique characteristics. Genes involved in metabolism of cells needed to be up-regulated in order to support the active function of CCA stromal fibroblasts to produce many supporting proteins in the cancer environment. Neuropeptide Y receptor Y1 has been indicated to receive the activation signal to induce neuroproliferation [26] and doublecortin-like kinase 1, a microtubule-associated active protein kinase expressed in growth cones of postmitotic neurons [27] may help facilitate fibroblast proliferation. In similar to human basal cell carcinoma fibroblasts [14], SPARC or osteonectin, was also over-expressed in CCA-derived fibroblasts. SPARC-null mice were recently demonstrated to resist UV-induced squamous cell carcinoma, suggesting a tumor-promoting role of SPARC [28]. In contrast to the cancer-associated fibroblasts in metastatic colon cancer to the liver which showed down-regulation of SDF-1 [18], CCA-derived fibroblasts had up-regulated SDF-1 (data not shown).

The highly up-regulated genes in CCA-derived fibroblasts showed several interesting functions involved in cancer progression. Serpin peptidase inhibitor, clade B member 2 (SERPINE2) or plasminogen activator inhibitor type 2 (PAI2) is involved in cancer invasion and metastasis by controlling serine protease urokinase plasminogen activator. In a recent review, several studies led to the suggestion that the significance of PAI2 expression on prognosis of cancers is organ context-dependent [29]. In breast cancer, PAI2 was expressed in both stromal and tumor cells and associated with prolonged disease-free survival [30]. In contrast, high levels of PAI2 in endometrial cancer were reported to correlate with the invasion potential of the cancer [31]. S100 calcium binding protein A4 (S100A4) has been revealed as the metastasis-inducing protein [32]. Genes such as procollagen C-endopeptidase enhancer 2 (PCPE2) were also detected which may involve in collagen synthesis [33]. These results support the function of fibroblasts in CCA to promote a desmoplastic reaction. For down-regulated genes, bone morphogenetic protein 2 (BMP2A), a multi-functional growth factor belonging to the transforming growth factor-β superfamily was decreased in CCA fibroblasts as reported in breast cancer-derived fibroblasts [13]. BMP2A-encoding protein has been elucidated to induce hypophosphorylation of retinoblastoma protein causing cell cycle arrest [34]. Hence, decreased BMP2A in the CCA microenvironment may promote cancer cells to enter the cell cycle. Moreover, a decreased level of interleukin 24 (IL-24), an apoptotic inducible cytokine [35], in cancer tissues, attenuates cancer cells from undergoing apoptosis. The response gene to complement 32 (RGC32), a novel p53-inducible gene, and bradykinin receptor B1 (BRADYB1) decreased expression in CCA-derived fibroblasts. Being intracellular protein and membrane receptor, respectively, RGC32 and BRADYB1 have elucidated the function of inhibition of fibroblast cell proliferation [36,37]. It seems possible to conclude that down-regulated genes in fibroblasts encode proteins, if acting in the intracellular region, can inhibit the proliferation of fibroblasts themselves, but if they exist in the extracellular region, they may involve inhibition of cancer cell proliferation. This evidence strengthens the roles of fibroblast-derived proteins released into a tumor environment to induce a high proliferative capability of cancer cells.

Fibroblasts have been proposed the bipolar effects in cancers [38]. In our microarray results, ADAMTS-like 1 (ADAMTSR1) was over-expressed in CCA-derived fibroblasts. The ADAMTS-like proteins have been discussed as the enhancers of ADAMTS proteases [39]. Since some ADAMTS have been proven to be anti-angiogenic factors [40] partly via the trapping of vascular endothelial growth factor by thrombospondin motifs of ADAMTS [41]. So up-regulation of ADAMTSR1 in fibroblasts may inhibit angiogenesis. Moreover, stromelysin-1 or MMP-3 which can degrade ECM and induce cancer invasion and metastasis, showed the decreased expression in fibroblasts. Taken together, the increased expression of ADAMTSR1 and the decreased expression of MMP-3 may highlight fibroblasts in term of suppressing CCA progression.

Theoretically, proteins secreted from fibroblasts having interplay with cancer cells could be detected in the extracellular region and be involved in ECM organization and biosynthesis. Within these 2 groups of genes, we focused our interest on genes encoded secreted proteins and their products have been previously reported of their tumorigenic effects. ADAM12, AREG, AGN2, ER, JAGL1, LAMA5, NOV, PDGF-A, PN, RL, and SCG2 were selected to explore. AREG, ER, JAGL1, and LAMA5 are predominantly reported for proliferation induction in cancer cells [42-45]. PDGF-A, NOV, AGN2, and SCG2 are involved in angiogenesis [46-49], whereas ADAM12 and RL play an important role in cell motility, invasion and metastasis [50,51]. For PN, many carcinogenic functions including cell proliferation, invasion, metastasis and angiogenesis have been demonstrated [20-24]. This study employed real time PCR to verify the up-regulation of these genes, and found that only ADAM12, AREG, ER, JAGL1, PDGF-A, PN and SCG2 were significantly increased in their expression levels in CCA-derived fibroblasts and may promote CCA progression through activation of cancer growth, invasion and angiogenesis.

Herein PN was chosen to deeply explore since its well accepted multifunction in cancer as mentioned above. Moreover, the result from our group about the expressions of ADAM12, AREG, ER, JAGL1, PDGF-A, PN and SCG2 in whole CCA tissues (n = 20) showed that only AREG, PDGF-A and PN had higher level in cancer than those in benign liver tissues with statistical significance (data not shown). AREG and PDGF-A could be detected in not only fibroblasts but also in cancer and endothelial cells, however PN expressed exclusively in CCA fibroblasts. In order to demonstrate role of fibroblast-derived proteins in CCA, we determined that PN should be the first target to explore.

The strong evidence using different biological preparations of CCA-derived fibroblasts and CCA tissues confirmed the increased levels of PN at both mRNA and protein. Most of CCA tissues of all differentiated types had high levels of PN and expressed exclusively in α-SMA positive fibroblasts. In the same direction, the findings showed no expression of PN in CCA cell lines when compared to the high level expressed in the fibroblasts. This may strengthen the results of the absence of PN in cancer cells in CCA tissues. From these results taken together, it can be concluded that PN detected in CCA tissues is only of fibroblast origin as reported in some cancers [52-54]. In cancers of head and neck, ovary, and colon, PN was found in cancer cells and has been proposed to induce tumorigenic properties of cancer cells via an autocrine mechanism [21,22]. Hence results from the present study allow the speculation to propose a phenomenon that fibroblast-derived PN in CCA may affect cancer cells by a paracrine mode and has a promising role in cancer promotion. These results revealed that a high PN level in fibroblasts was an independent risk factor in CCA patients and those having high PN had significantly low cumulative survival time after surgery. PN might therefore be used as a poor prognostic marker in patients suffering from CCA. Detections of PN at both mRNA and encoding protein in CCA tissues are in the same direction to distinguish CCA from non-cancer syndromes of bile ducts. In addition, most benign liver tissues and hepatocellular carcinoma showed no to only a minimal expression of PN when compared to the high level detected in CCA tissues. Hence, serum PN may help to distinguish CCA from benign conditions and closely-related liver cancer and may use as the prognostic or predictive marker as previously reported [52,55].

To show the tumorigenic impacts of PN on CCA cells, recombinant PN was employed as extracellular PN to mimic the paracrine effect of PN produced from cancer stromal fibroblasts to induce CCA cell proliferation and invasion. Though receptors ITGαvβ3 and ITGαvβ5 have been shown to be the receptors for PN in several cancer cells [21], PN promoted invasiveness of pancreatic cancer cells via the β4 integrin [56]. This suggests the cell type dependent on a specific ITG responded to PN. The study herein reveals that PN-induced cell proliferation and invasion could be inhibited by RNAi against ITGα5. Hence, ITGα5 is a potentially promising receptor for PN in CCA cells. As the well known receptor for fibronectin, the apparent reason for ITGα5 production in CCA cells is to support the abundance of fibronectin found in CCA [57]. In addition, ITGα5 can only be from dimerization with the β1 subunit and activation of ITGα5β1 has been revealed to support cell survival [58] and induce invasion and angiogenesis [59,60]. Though further studies need to be performed before such a conclusion is valid in CCA, this work highlights the PN-induced-ITGα5 pathway as one of the activated pathways to induce an aggressive CCA.

TGF-β has been proposed to induce the expression of PN [61]. O. viverrini excretory/secretory product has also recently been shown to be the stimulator of fibroblast proliferation via the TGF-β-mediated signal transduction pathway [62] and this pathway seems likely to be the cause of PN expression in CCA-derived fibroblasts. The authors' laboratory has checked the effect of parasitic product-treated fibroblasts and found that these fibroblasts increased PN expression compared to the normal liver fibroblasts without exposure (unpublished data). It is interesting to propose that in CCA cells; the expression of fibroblast-derived PN could be induced by TGF-β produced from infected parasites since the early stage of carcinogenesis and may be in concert with TGF-β produced from CCA cells in a late stage of cancer [12]. Though in vivo experiments are needed to confirm, fibroblast-derived PN may influence O. viverrini-associated CCA at the early stage of cancer as well as to promote cancer progression in the later time. With this information, targeting the stroma in CCA may not only be effective in treatment of primary, invasive and metastatic tumors, but may also play role in prevention of tumor development.

Conclusions

To the authors' knowledge, this study is the first to describe the gene expression profile of CCA-derived fibroblasts. Molecular understanding of fibroblasts in CCA by the functions of certain up- and down-regulated genes has been revealed and has suggested certain groups of genes in controlling cancer cell proliferation, invasion, metastasis and angiogenesis (Fig 8). These findings provide evidence that fibroblasts are important sources of tumorigenic substances, particularly PN, when produced into the microenvironment of CCA. High levels of PN are found in most CCA patients and can be used as a poor prognostic marker. In addition, the level of PN can be used to distinguish CCA from other benign liver conditions and hepatocellular carcinoma. The interaction of fibroblast-derived PN and CCA cells helps to promote cell proliferation and invasion probably via ITGα5. Though further investigations are needed, this study suggests promising evidence of the value of using serum PN as a prognostic marker of poor survival in CCA patients. Moreover, targeting fibroblasts or fibroblast-derived-PN-stimulated pathways in cancer cells to attenuate the tumorigenic induction of PN is a further challenge to inhibit CCA progression in the patients.

Figure 8.

Figure 8

Proposed impacts of CCA-associated fibroblasts revealed in this study. A schematic representation of the main alterations in CCA-associated fibroblasts revealed in this study. The biological functions of protein products from the up-regulated genes in fibroblasts are represented. Tumorigenic effects of PN on CCA cancer cells are also proposed.

Methods

Cells and culture condition

Cfs and Lfs were established and characterized in this lab as previously reported [6]. CCA cell lines including KKU-M213; KKU-M156; KKU-M055; and KKU-100 were received as a kind gift from Associate Professor Dr. Banchob Sripa (Khon Kaen University). Cfs and Lfs were grown in the complete media which is 10% FBS containing DMEM with 20% epidermal growth factor (CytoLab Ltd., Rehovot, Israel). CCA cells were cultured in 10% FBS containing Ham-F12 (Invitrogen, Carlsbad, CA) supplemented with antibiotics and an anti-fungal agent at 37°C and in 5% CO2 incubator.

Gene expression profiling study and data analysis

Total RNA was extracted using RNeasy Micro Kit (Qiagen, Valencia, CA) using the manufacturer's instructions. The quality of the RNA was assessed by an Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany). Affymetrix GeneChip Human Genome U133 plus 2.0 Array containing 38,500 human genes (Affymetrix, Santa Clara, CA) was used following Affymetrix's instruction. The array data were scanned by a GeneChip Scanner 3000 (Affymetrix) and analysed by Affymetrix microarray suite, version 5.0. Raw data from the GeneChips were used to analyze expression levels and expressed as fold changes and gene ontology was categorized by Gene Spring G.X.7.3 software (Agilent Technologies). Average fold change of gene expression was determined by intensity comparison between Cf and Lf1 and Lf2.

Semi-quantitative real time PCR

Complementary DNA was synthesized from 1 μg of total RNA using the first strand cDNA synthesis kit (AMV) (Roche Molecular Biochemicals, Mannheim, Germany) according to the instructions. Relative expression levels in genes of Cfs and Lfs were determined by SYBR Green-based real time PCR using ABI 7500 (Applied Biosystem, Foster City, CA) and calculated by the 2-ΔΔCT equation. In this case, ΔCT = CT (Cf)-CT (Lf). β-actin served as an internal control to adjust the amount of starting cDNA. The sequences of genes tested in this study were retrieved from PubMed http://www.ncbi.nlm.nih.gov and the primers were designed by Primer 3 (Table 7).

Table 7.

Primer sequences for real time PCR.

Gene Forward Primer Reverse Primer Size Accession no.
5'-3' 5'-3' (bp)
ADAM12 tttgggggtcaacagttttc agagctgggttcccttttgt 191 NM_003474
AREG tggggaaaagtccatgaaaa tttcgttcctcagcttctcc 174 NM_001657
AGN2 ccacctgaggaactgtctcg ggtcttgctttggtccgtta 191 NM_001147
ER catatgggagaagggggagt aagtgcaattacagagtgcaaaa 166 NM_001432
JAGL1 gcctgccttaagtgaggaaa gccaagaacaacacatcaaaga 169 U77914
LAMA5 gtgatgaaaagcgggaatgt acctccacagagcgagtcat 221 BC003355
NOV tgcaattccaagaaaatatcactg cttggatttggagcttggaa 167 NM_002514
PDGF-A acacgagcagtgtcaagtgc tctggttggctgctttaggt 250 X03795
PN cactctttgctcccaccaat tcaaagactgctcctcccata 157 AY140646
RL tgctgaatttggggctactt gggagatagggtcttcatcca 198 NM_005045
SCG2 cccgaagaatgatgataccc aaatgttgggatttgcttgg 195 NM_003469
ITGα5 agttgcatttccgagtctgg ccaaacaggatggctaggat 223 NM_002205
β-actin cacactgtgcccatctacga ctccttaatgtcacgcacga 162 X00351
gapdh ctcctcctgttcgacagtca gttaaaagcagccctggtga 140 NM_002046

Note: ADAM12, a disintegrin and matrix metalloproteinase 12; AREG, amphiregulin; AGN2, angiopoietin 2; ER, epiregulin; JAGL1, jagged soluble form; LAMA5, laminin alpha 5; NOV, nephroblastoma over expressed; PDGF-A, platelet-derived growth factor alpha; PN, periostin; RL, reelin; SCG2, secretogranin 2; ITGα5, integrin alpha 5; β-actin, beta-actin; gapdh, glyceraldehyde 3-phosphate dehydrogenase

Human CCA tissues and immunohistochemistry

Fifty-two cases of CCA tissues were obtained from patients who had undergone hepatectomy using the protocol approved by the Human Research Ethics Committee, Khon Kaen University (HE490143). The age, sex, tumor size, histological type and staging data were derived from the medical charts and pathological records. Benign liver tissues were characterized as chronic inflammation by other causes rather than CCA.

Paraffin-embedded tissues were used and antigens were retrieved in 10 mM citrate buffer pH 6.0 at 95°C for 40 min and endogenous peroxidase was blocked in 3% H2O2 for 5 min. After blocking non-specific binding with 2% bovine serum albumin for 20 min, 1:10,000 rabbit anti-human PN (Biovendor, Heidelberg, Germany) was applied to the sections at room temperature overnight, followed by anti-rabbit Envision+ System-HRP labeled polymer (Dako, Carpinteria, CA) for 30 min at room temperature. The immunoreactive signal was developed by diaminobenzidine (DAB; Sigma, St Louis, MO) and counterstained with hematoxylin. The signal was checked under light microscope.

PN expression of intratumoral fibroblasts on the histologic sections was semi-quantitatively scored on the basis of PN-positive fibroblasts percentage and the immunostaining intensity. The number of positive fibroblast cells were classified as < 10% (negative); 10-25% (+1); 26-50% (+2); and >50% (+3). The intensity of PN expression in fibroblasts was scored no staining, 0; weak staining, 1; intermediate or focal weak and focal intense staining, 2; intense staining, 3. The interpretation of PN expression was performed by summarization the scores of the percent positive cell (0-3) and the scores of staining intensity (1-3) to reach the total final score of 0-6. The results were then categorized as follows; low expression, score ≤ 4; and high expression, score > 4. All samples were anonymized and independently scored by one pathologist (KC) and 2 investigators (PT and CT). In case of disagreement, the slides were reexamined and a consensus was reached by at least 2 observers.

Double immunofluorescence staining of α-SMA and PN

In order to localize the expression of PN and α-SMA in CCA tissues, double immunofluorescence staining was performed. The 1:200 mouse anti-human α-SMA antibody (Sigma) and 1:500 rabbit anti-human PN antibody (Biovendor) were used as primary antibodies. Anti-mouse IgG-Alexa 488 and anti-rabbit IgG-Cy3 (Invitrogen) were used as the second antibodies. Nucleus was stained with Hoechst (Invitrogen). The signal was observed under the LSM 510 Meta laser scanning confocal microscope (Carl Zeiss, Jena, Germany) at the Division of Medical Molecular Biology, Office for Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University.

Protein extraction and western blot analysis

Twenty μgs of total protein from the cell lysate were separated in 10% SDS-PAGE and transferred onto a PVDF membrane (Millipore, Billerica, MA). For PN detection, 1:500 rabbit anti-human PN (Biovendor) and 1:1,000 goat anti-rabbit conjugated HRP (Abcam, Cambridge, MA) were used. The signal was visualized by ECL (Pierce, Rockford, IL). The expression of β-actin was used as an internal control to determine an equal amount of loading proteins.

Cell proliferation assay

CCA cells with or without treatment with siITGα5 cells were arrested in HAM-F12 without serum supplement for 12 h. Different concentrations of recombinant PN (Biovendor) prepared in 1% FBS containing HAM-F12 were incubated with cells for 6, 12 and 24 h. The viable cells in each condition were determined using an MTS assay (Promega, Madison, WI) according to the manufacturer's instruction.

Cell cycle analysis by flow cytometry

Cell cycle distribution analysis used cells stained with propidium iodide (Invitrogen) as previously described [63]. The distribution of cells in each stage of the cell cycle was quantitated in a flow cytometer and CellQuest software (Becton Dickinson, Franklin Lakes, NJ). Numbers of CCA cell lines in S+G2/M phases of the cell cycle were measured and compared between conditions with and without recombinant PN treatment. These experiments were repeated two times using replicate culture dishes in the same experiment.

Colony formation assay

CCA cell lines were cultured in 6-well plate. After 24-h culture, recombinant PN diluted in 1% FBS containing medium was added and the plate was incubated in CO2 incubator. Soft agar colony formation assay was also performed using 0.5% and 0.35% MetaPhor® agarose (Cambrex Bio Science, Rockland, ME) as lower and upper layers, respectively. After 12 d, cells were fixed with 5% v/v glutaraldehyde and stained with 0.5% w/v crystal violet in 40% v/v methanol. Cell growth was estimated by counting numbers of colonies with more than 30 cells under inverted microscope and compared between those of treat and untreated with PN. The experiment was performed in duplicate.

Invasion assay

KKU-M213 and KKU-M156 CCA cells were seeded in PN (100 ng/ml) containing medium into the Matrigel invasion chamber (BD Biosciences, San Jose, CA) and incubated for 24 h. Invaded cells were fixed with 5% v/v glutaraldehyde and stained with 0.5% w/v crystal violet in 40% v/v methanol for 30 min each. The number of invaded cells was counted under a microscope by two independent investigators using 100× magnification fields. The assays were done in replicate and three independent experiments were performed.

Small interfering RNA against receptor integrin α5

Two hundred thousand CCA cells were seeded into a 6-well plate for 24 h before transfection of siITGα5 (Santa Cruz Biotechnology, Santa Cruz, CA) by Lipofectamine 2000 (Invitrogen). Three siRNA strands (5'-gucagaauuucgagacaaa-3', 5'-caccaacaagagagccaaa-3', and 5'-ccacugaccagaacuagaa-3') were used to target ITGα5 mRNA. The efficiency of knock down was tested by real time PCR using β-actin as an internal control.

Statistical analysis

Statistical analyses were performed using SPSS version 16.0 (SPSS Inc., Chicago, IL). The correlation of PN expression and pathological parameters of CCA patients was analyzed by the χ2-test and binary logistic multivariate analysis. Patient survival was calculated from the time of surgical resection to death and the survival curves were constructed according to Kaplan-Meier, with a Log-Rank test. A multivariate analysis was performed by the Cox proportional hazard regression model. The significance of the different data was determined by the Student's t-test. A P value of equal to or less than 0.05 was defined as statistically significant.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

KU performed most of the experiments and helped to draft the manuscript. YA contributed to the microarray experiment. PT performed real time PCR of some genes and helped KC and AP in immunohistochemical scoring. SC contributed to the patient clinicopathological data and samples collection. CT contributed to the design of the entire study, data analysis and preparation of the manuscript.

All authors have read and approved the final manuscript.

Contributor Information

Kusumawadee Utispan, Email: k_utispan@yahoo.com.

Peti Thuwajit, Email: petthu@msn.com.

Yoshimitsu Abiko, Email: abiko.yoshimitsu@nihon-u.ac.jp.

Komgrid Charngkaew, Email: sikck@mahidol.ac.th.

Anucha Paupairoj, Email: anupua@kku.ac.th.

Siri Chau-in, Email: s_chauin@hotmail.com.

Chanitra Thuwajit, Email: cthuwajit@yahoo.com.

Acknowledgements

We would like to thank the Commission on Higher Education, Thailand for supporting by grant fund under the program Strategic Scholarships for Frontier Research Network for the Ph.D. Program Thai Doctoral degree for this research. This project was co-supported by a Mid-Career Grant (RMU5080069), Thailand Research Fund (TRF) and the Research Strengthening Grant 2007 from National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and Technology Development Agency (NSTDA). The English editing of this manuscript was kindly performed by Professor James A. Will, University of Wisconsin, Madison, WI, USA.

References

  1. Sriamporn S, Pisani P, Pipitgool V, Suwanrungruang K, Kamsa-ard S, Parkin DM. Prevalence of Opisthorchis viverrini infection and incidence of cholangiocarcinoma in Khon Kaen, Northeast Thailand. Trop Med Int Health. 2004;9:588–594. doi: 10.1111/j.1365-3156.2004.01234.x. [DOI] [PubMed] [Google Scholar]
  2. Lim MK, Ju YH, Franceschi S, Oh JK, Kong HJ, Hwang SS, Park SK, Cho SI, Sohn WM, Kim DI, Yoo KY, Hong ST, Shin HR. Clonorchis sinensis infection and increasing risk of cholangiocarcinoma in the Republic of Korea. Am J Trop Med Hyg. 2006;75:93–96. [PubMed] [Google Scholar]
  3. Choi D, Lim JH, Lee KT, Lee JK, Choi SH, Heo JS, Jang KT, Lee NY, Kim S, Hong ST. Cholangiocarcinoma and Clonorchis sinensis infection: a case-control study in Korea. J Hepatol. 2006;44:1066–1073. doi: 10.1016/j.jhep.2005.11.040. [DOI] [PubMed] [Google Scholar]
  4. Lazaridis KN, Gores GJ. Primary sclerosing cholangitis and cholangiocarcinoma. Semin Liver Dis. 2006;26:42–51. doi: 10.1055/s-2006-933562. [DOI] [PubMed] [Google Scholar]
  5. Okamura N, Yoshida M, Shibuya A, Sugiura H, Okayasu I, Ohbu M. Cellular and stromal characteristics in the scirrhous hepatocellular carcinoma: comparison with hepatocellular carcinomas and intrahepatic cholangiocarcinomas. Pathol Int. 2005;55:724–731. doi: 10.1111/j.1440-1827.2005.01891.x. [DOI] [PubMed] [Google Scholar]
  6. Chuaysri C, Thuwajit P, Paupairoj A, Chau-In S, Suthiphongchai T, Thuwajit C. Alpha-smooth muscle actin-positive fibroblasts promote biliary cell proliferation and correlate with poor survival in cholangiocarcinoma. Oncol Rep. 2009;21:957–969. doi: 10.3892/or_00000309. [DOI] [PubMed] [Google Scholar]
  7. Hwang RF, Moore T, Arumugam T, Ramachandran V, Amos KD, Rivera A, Ji B, Evans DB, Logsdon CD. Cancer-associated stromal fibroblasts promote pancreatic tumor progression. Cancer Res. 2008;68:918–926. doi: 10.1158/0008-5472.CAN-07-5714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Micke P, Ostman A. Exploring the tumour environment: cancer-associated fibroblasts as targets in cancer therapy. Expert Opin Ther Targets. 2005;9:1217–1233. doi: 10.1517/14728222.9.6.1217. [DOI] [PubMed] [Google Scholar]
  9. Augsten M, Hagglof C, Olsson E, Stolz C, Tsagozis P, Levchenko T, Frederick MJ, Borg A, Micke P, Egevad L, Ostman A. CXCL14 is an autocrine growth factor for fibroblasts and acts as a multi-modal stimulator of prostate tumor growth. Proc Natl Acad Sci USA. 2009;106:3414–3419. doi: 10.1073/pnas.0813144106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Tuxhorn JA, Ayala GE, Rowley DR. Reactive stroma in prostate cancer progression. J Urol. 2001;166:2472–2483. doi: 10.1016/S0022-5347(05)65620-0. [DOI] [PubMed] [Google Scholar]
  11. Rosenthal EL, McCrory A, Talbert M, Carroll W, Magnuson JS, Peters GE. Expression of proteolytic enzymes in head and neck cancer-associated fibroblasts. Arch Otolaryngol Head Neck Surg. 2004;130:943–947. doi: 10.1001/archotol.130.8.943. [DOI] [PubMed] [Google Scholar]
  12. Ohira S, Itatsu K, Sasaki M, Harada K, Sato Y, Zen Y, Ishikawa A, Oda K, Nagasaka T, Nimura Y, Nakanuma Y. Local balance of transforming growth factor-beta1 secreted from cholangiocarcinoma cells and stromal-derived factor-1 secreted from stromal fibroblasts is a factor involved in invasion of cholangiocarcinoma. Pathol Int. 2006;56:381–389. doi: 10.1111/j.1440-1827.2006.01982.x. [DOI] [PubMed] [Google Scholar]
  13. Singer CF, Gschwantler-Kaulich D, Fink-Retter A, Haas C, Hudelist G, Czerwenka K, Kubista E. Differential gene expression profile in breast cancer-derived stromal fibroblasts. Breast Cancer Res Treat. 2008;110:273–281. doi: 10.1007/s10549-007-9725-2. [DOI] [PubMed] [Google Scholar]
  14. Micke P, Kappert K, Ohshima M, Sundquist C, Scheidl S, Lindahl P, Heldin CH, Botling J, Ponten F, Ostman A. In situ identification of genes regulated specifically in fibroblasts of human basal cell carcinoma. J Invest Dermatol. 2007;127:1516–1523. doi: 10.1038/sj.jid.5700714. [DOI] [PubMed] [Google Scholar]
  15. Fromigue O, Louis K, Dayem M, Milanini J, Pages G, Tartare-Deckert S, Ponzio G, Hofman P, Barbry P, Auberger P, Mari B. Gene expression profiling of normal human pulmonary fibroblasts following coculture with non-small-cell lung cancer cells reveals alterations related to matrix degradation, angiogenesis, cell growth and survival. Oncogene. 2003;22:8487–8497. doi: 10.1038/sj.onc.1206918. [DOI] [PubMed] [Google Scholar]
  16. Allinen M, Beroukhim R, Cai L, Brennan C, Lahti-Domenici J, Huang H, Porter D, Hu M, Chin L, Richardson A, Schnitt S, Sellers WR, Polyak K. Molecular characterization of the tumor microenvironment in breast cancer. Cancer Cell. 2004;6:17–32. doi: 10.1016/j.ccr.2004.06.010. [DOI] [PubMed] [Google Scholar]
  17. Fukushima N, Sato N, Prasad N, Leach SD, Hruban RH, Goggins M. Characterization of gene expression in mucinous cystic neoplasms of the pancreas using oligonucleotide microarrays. Oncogene. 2004;23:9042–9051. doi: 10.1038/sj.onc.1208117. [DOI] [PubMed] [Google Scholar]
  18. Nakagawa H, Liyanarachchi S, Davuluri RV, Auer H, Martin EW Jr, de la Chapelle A, Frankel WL. Role of cancer-associated stromal fibroblasts in metastatic colon cancer to the liver and their expression profiles. Oncogene. 2004;23:7366–7377. doi: 10.1038/sj.onc.1208013. [DOI] [PubMed] [Google Scholar]
  19. Erkan M, Kleeff J, Gorbachevski A, Reiser C, Mitkus T, Esposito I, Giese T, Buchler MW, Giese NA, Friess H. Periostin creates a tumor-supportive microenvironment in the pancreas by sustaining fibrogenic stellate cell activity. Gastroenterology. 2007;132:1447–1464. doi: 10.1053/j.gastro.2007.01.031. [DOI] [PubMed] [Google Scholar]
  20. Tai IT, Dai M, Chen LB. Periostin induction in tumor cell line explants and inhibition of in vitro cell growth by anti-periostin antibodies. Carcinogenesis. 2005;26:908–915. doi: 10.1093/carcin/bgi034. [DOI] [PubMed] [Google Scholar]
  21. Gillan L, Matei D, Fishman DA, Gerbin CS, Karlan BY, Chang DD. Periostin secreted by epithelial ovarian carcinoma is a ligand for alpha(V)beta(3) and alpha(V)beta(5) integrins and promotes cell motility. Cancer Res. 2002;62:5358–5364. [PubMed] [Google Scholar]
  22. Kudo Y, Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M, Takata T. Periostin promotes invasion and anchorage-independent growth in the metastatic process of head and neck cancer. Cancer Res. 2006;66:6928–6935. doi: 10.1158/0008-5472.CAN-05-4540. [DOI] [PubMed] [Google Scholar]
  23. Siriwardena BS, Kudo Y, Ogawa I, Kitagawa M, Kitajima S, Hatano H, Tilakaratne WM, Miyauchi M, Takata T. Periostin is frequently overexpressed and enhances invasion and angiogenesis in oral cancer. Br J Cancer. 2006;95:1396–1403. doi: 10.1038/sj.bjc.6603431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shao R, Bao S, Bai X, Blanchette C, Anderson RM, Dang T, Gishizky ML, Marks JR, Wang XF. Acquired expression of periostin by human breast cancers promotes tumor angiogenesis through up-regulation of vascular endothelial growth factor receptor 2 expression. Mol Cell Biol. 2004;24:3992–4003. doi: 10.1128/MCB.24.9.3992-4003.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. De Wever O, Demetter P, Mareel M, Bracke M. Stromal myofibroblasts are drivers of invasive cancer growth. Int J Cancer. 2008;123:2229–2238. doi: 10.1002/ijc.23925. [DOI] [PubMed] [Google Scholar]
  26. Howell OW, Scharfman HE, Herzog H, Sundstrom LE, Beck-Sickinger A, Gray WP. Neuropeptide Y is neuroproliferative for post-natal hippocampal precursor cells. J Neurochem. 2003;86:646–659. doi: 10.1046/j.1471-4159.2003.01895.x. [DOI] [PubMed] [Google Scholar]
  27. Burgess HA, Reiner O. Doublecortin-like kinase is associated with microtubules in neuronal growth cones. Mol Cell Neurosci. 2000;16:529–541. doi: 10.1006/mcne.2000.0891. [DOI] [PubMed] [Google Scholar]
  28. Aycock RL, Bradshaw AC, Sage EH, Starcher B. Development of UV-induced squamous cell carcinomas is suppressed in the absence of SPARC. J Invest Dermatol. 2004;123:592–599. doi: 10.1111/j.0022-202X.2004.23316.x. [DOI] [PubMed] [Google Scholar]
  29. Croucher DR, Saunders DN, Lobov S, Ranson M. Revisiting the biological roles of PAI2 (SERPINB2) in cancer. Nat Rev Cancer. 2008;8:535–545. doi: 10.1038/nrc2400. [DOI] [PubMed] [Google Scholar]
  30. Duggan C, Kennedy S, Kramer MD, Barnes C, Elvin P, McDermott E, O'Higgins N, Duffy MJ. Plasminogen activator inhibitor type 2 in breast cancer. Br J Cancer. 1997;76:622–627. doi: 10.1038/bjc.1997.435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Osmak M, Babic D, Abramic M, Milicic D, Vrhovec I, Skrk J. Plasminogen activator inhibitor type 2: potential prognostic factor for endometrial carcinomas. Neoplasma. 2001;48:462–467. [PubMed] [Google Scholar]
  32. Schmidt-Hansen B, Klingelhofer J, Grum-Schwensen B, Christensen A, Andresen S, Kruse C, Hansen T, Ambartsumian N, Lukanidin E, Grigorian M. Functional significance of metastasis-inducing S100A4(Mts1) in tumor-stroma interplay. J Biol Chem. 2004;279:24498–24504. doi: 10.1074/jbc.M400441200. [DOI] [PubMed] [Google Scholar]
  33. Steiglitz BM, Keene DR, Greenspan DS. PCOLCE2 encodes a functional procollagen C-proteinase enhancer (PCPE2) that is a collagen-binding protein differing in distribution of expression and post-translational modification from the previously described PCPE1. J Biol Chem. 2002;277:49820–49830. doi: 10.1074/jbc.M209891200. [DOI] [PubMed] [Google Scholar]
  34. Tomari K, Kumagai T, Shimizu T, Takeda K. Bone morphogenetic protein-2 induces hypophosphorylation of Rb protein and repression of E2F in androgen-treated LNCaP human prostate cancer cells. Int J Mol Med. 2005;15:253–258. [PubMed] [Google Scholar]
  35. Zheng M, Bocangel D, Ramesh R, Ekmekcioglu S, Poindexter N, Grimm EA, Chada S. Interleukin-24 overcomes temozolomide resistance and enhances cell death by down-regulation of O6-methylguanine-DNA methyltransferase in human melanoma cells. Mol Cancer Ther. 2008;7:3842–3851. doi: 10.1158/1535-7163.MCT-08-0516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zou J, Ren JH, Feng D, Wang H, Xu J. Compensatory function of bradykinin B1 receptor in the inhibitory effect of captopril on cardiomyocyte hypertrophy and cardiac fibroblast proliferation in neonatal rats. Chin Med J (Engl) 2008;121:1220–1225. [PubMed] [Google Scholar]
  37. Saigusa K, Imoto I, Tanikawa C, Aoyagi M, Ohno K, Nakamura Y, Inazawa J. RGC32, a novel p53-inducible gene, is located on centrosomes during mitosis and results in G2/M arrest. Oncogene. 2007;26:1110–1121. doi: 10.1038/sj.onc.1210148. [DOI] [PubMed] [Google Scholar]
  38. Mueller MM, Fusenig NE. Friends or foes - bipolar effects of the tumour stroma in cancer. Nat Rev Cancer. 2004;4:839–849. doi: 10.1038/nrc1477. [DOI] [PubMed] [Google Scholar]
  39. Hirohata S, Wang LW, Miyagi M, Yan L, Seldin MF, Keene DR, Crabb JW, Apte SS. Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in extracellular matrix. J Biol Chem. 2002;277:12182–12189. doi: 10.1074/jbc.M109665200. [DOI] [PubMed] [Google Scholar]
  40. Vazquez F, Hastings G, Ortega MA, Lane TF, Oikemus S, Lombardo M, Iruela-Arispe ML. METH-1, a human ortholog of ADAMTS-1, and METH-2 are members of a new family of proteins with angio-inhibitory activity. J Biol Chem. 1999;274:23349–23357. doi: 10.1074/jbc.274.33.23349. [DOI] [PubMed] [Google Scholar]
  41. Luque A, Carpizo DR, Iruela-Arispe ML. ADAMTS1/METH1 inhibits endothelial cell proliferation by direct binding and sequestration of VEGF165. J Biol Chem. 2003;278:23656–23665. doi: 10.1074/jbc.M212964200. [DOI] [PubMed] [Google Scholar]
  42. Castillo J, Erroba E, Perugorria MJ, Santamaria M, Lee DC, Prieto J, Avila MA, Berasain C. Amphiregulin contributes to the transformed phenotype of human hepatocellular carcinoma cells. Cancer Res. 2006;66:6129–6138. doi: 10.1158/0008-5472.CAN-06-0404. [DOI] [PubMed] [Google Scholar]
  43. Morita S, Shirakata Y, Shiraishi A, Kadota Y, Hashimoto K, Higashiyama S, Ohashi Y. Human corneal epithelial cell proliferation by epiregulin and its cross-induction by other EGF family members. Mol Vis. 2007;13:2119–2128. [PubMed] [Google Scholar]
  44. Purow BW, Haque RM, Noel MW, Su Q, Burdick MJ, Lee J, Sundaresan T, Pastorino S, Park JK, Mikolaenko I, Maric D, Eberhart CG, Fine HA. Expression of Notch-1 and its ligands, Delta-like-1 and Jagged-1, is critical for glioma cell survival and proliferation. Cancer Res. 2005;65:2353–2363. doi: 10.1158/0008-5472.CAN-04-1890. [DOI] [PubMed] [Google Scholar]
  45. Gonzales M, Haan K, Baker SE, Fitchmun M, Todorov I, Weitzman S, Jones JC. A cell signal pathway involving laminin-5, alpha3beta1 integrin, and mitogen-activated protein kinase can regulate epithelial cell proliferation. Mol Biol Cell. 1999;10:259–270. doi: 10.1091/mbc.10.2.259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Shikada Y, Yonemitsu Y, Koga T, Onimaru M, Nakano T, Okano S, Sata S, Nakagawa K, Yoshino I, Maehara Y, Sueishi K. Platelet-derived growth factor-AA is an essential and autocrine regulator of vascular endothelial growth factor expression in non-small cell lung carcinomas. Cancer Res. 2005;65:7241–7248. doi: 10.1158/0008-5472.CAN-04-4171. [DOI] [PubMed] [Google Scholar]
  47. Lin CG, Leu SJ, Chen N, Tebeau CM, Lin SX, Yeung CY, Lau LF. CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem. 2003;278:24200–24208. doi: 10.1074/jbc.M302028200. [DOI] [PubMed] [Google Scholar]
  48. Lobov IB, Brooks PC, Lang RA. Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. Proc Natl Acad Sci USA. 2002;99:11205–11210. doi: 10.1073/pnas.172161899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Kirchmair R, Gander R, Egger M, Hanley A, Silver M, Ritsch A, Murayama T, Kaneider N, Sturm W, Kearny M, Fischer-Colbrie R, Kircher B, Gaenzer H, Wiedermann CJ, Ropper AH, Losordo DW, Patsch JR, Schratzberger P. The neuropeptide secretoneurin acts as a direct angiogenic cytokine in vitro and in vivo. Circulation. 2004;109:777–783. doi: 10.1161/01.CIR.0000112574.07422.C1. [DOI] [PubMed] [Google Scholar]
  50. Le Pabic H, Bonnier D, Wewer UM, Coutand A, Musso O, Baffet G, Clement B, Theret N. ADAM12 in human liver cancers: TGF-beta-regulated expression in stellate cells is associated with matrix remodeling. Hepatology. 2003;37:1056–1066. doi: 10.1053/jhep.2003.50205. [DOI] [PubMed] [Google Scholar]
  51. Hashimoto-Torii K, Torii M, Sarkisian MR, Bartley CM, Shen J, Radtke F, Gridley T, Sestan N, Rakic P. Interaction between reelin and notch signaling regulates neuronal migration in the cerebral cortex. Neuron. 2008;60:273–284. doi: 10.1016/j.neuron.2008.09.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sasaki H, Dai M, Auclair D, Fukai I, Kiriyama M, Yamakawa Y, Fujii Y, Chen LB. Serum level of the periostin, a homologue of an insect cell adhesion molecule, as a prognostic marker in nonsmall cell lung carcinomas. Cancer. 2001;92:843–848. doi: 10.1002/1097-0142(20010815)92:4&#x0003c;843::AID-CNCR1391&#x0003e;3.0.CO;2-P. [DOI] [PubMed] [Google Scholar]
  53. Fukushima N, Kikuchi Y, Nishiyama T, Kudo A, Fukayama M. Periostin deposition in the stroma of invasive and intraductal neoplasms of the pancreas. Mod Pathol. 2008;21:1044–1053. doi: 10.1038/modpathol.2008.77. [DOI] [PubMed] [Google Scholar]
  54. Kikuchi Y, Kashima TG, Nishiyama T, Shimazu K, Morishita Y, Shimazaki M, Kii I, Horie H, Nagai H, Kudo A, Fukayama M. Periostin is expressed in pericryptal fibroblasts and cancer-associated fibroblasts in the colon. J Histochem Cytochem. 2008;56:753–764. doi: 10.1369/jhc.2008.951061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sasaki H, Yu CY, Dai M, Tam C, Loda M, Auclair D, Chen LB, Elias A. Elevated serum periostin levels in patients with bone metastases from breast but not lung cancer. Breast Cancer Res Treat. 2003;77:245–252. doi: 10.1023/A:1021899904332. [DOI] [PubMed] [Google Scholar]
  56. Baril P, Gangeswaran R, Mahon PC, Caulee K, Kocher HM, Harada T, Zhu M, Kalthoff H, Crnogorac-Jurcevic T, Lemoine NR. Periostin promotes invasiveness and resistance of pancreatic cancer cells to hypoxia-induced cell death: role of the beta4 integrin and the PI3k pathway. Oncogene. 2007;26:2082–2094. doi: 10.1038/sj.onc.1210009. [DOI] [PubMed] [Google Scholar]
  57. Chen CY, Lin XZ, Tsao HC, Shiesh SC. The value of biliary fibronectin for diagnosis of cholangiocarcinoma. Hepatogastroenterology. 2003;50:924–927. [PubMed] [Google Scholar]
  58. Zhang Z, Vuori K, Reed JC, Ruoslahti E. The alpha 5 beta 1 integrin supports survival of cells on fibronectin and up-regulates Bcl-2 expression. Proc Natl Acad Sci USA. 1995;92:6161–6165. doi: 10.1073/pnas.92.13.6161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zeng ZZ, Yao H, Staszewski ED, Rockwood KF, Markwart SM, Fay KS, Spalding AC, Livant DL. Alpha(5)beta(1) integrin ligand PHSRN induces invasion and alpha(5) mRNA in endothelial cells to stimulate angiogenesis. Transl Oncol. 2009;2:8–20. doi: 10.1593/tlo.08187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tuomi S, Mai A, Nevo J, Laine JO, Vilkki V, Ohman TJ, Gahmberg CG, Parker PJ, Ivaska J. PKCepsilon regulation of an alpha5 integrin-ZO-1 complex controls lamellae formation in migrating cancer cells. Sci Signal. 2009;2:ra32. doi: 10.1126/scisignal.2000135. [DOI] [PubMed] [Google Scholar]
  61. Horiuchi K, Amizuka N, Takeshita S, Takamatsu H, Katsuura M, Ozawa H, Toyama Y, Bonewald LF, Kudo A. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor beta. J Bone Miner Res. 1999;14:1239–1249. doi: 10.1359/jbmr.1999.14.7.1239. [DOI] [PubMed] [Google Scholar]
  62. Thuwajit C, Thuwajit P, Uchida K, Daorueang D, Kaewkes S, Wongkham S, Miwa M. Gene expression profiling defined pathways correlated with fibroblast cell proliferation induced by Opisthorchis viverrini excretory/secretory product. World J Gastroenterol. 2006;12:3585–3592. doi: 10.3748/wjg.v12.i22.3585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Thuwajit C, Thuwajit P, Kaewkes S, Sripa B, Uchida K, Miwa M, Wongkham S. Increased cell proliferation of mouse fibroblast NIH-3T3 in vitro induced by excretory/secretory product(s) from Opisthorchis viverrini. Parasitology. 2004;129:455–464. doi: 10.1017/S0031182004005815. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Cancer are provided here courtesy of BMC

RESOURCES