Muscle degeneration and leukocyte infiltration caused by mutation of zebrafish Fad24

Summary

Factor for adipocyte differentiation 24 (fad24) is a novel gene that has been implicated in adipocyte differentiation and DNA replication. In a screen for zebrafish mutants that have an abnormal tissue distribution of neutrophils we identified an insertional allele of fad24, fad24^hi1019. Homozygous fad24^hi1019 larvae exhibit muscle degeneration accompanied by leukocyte infiltration. Muscle degeneration was extensive and included tissue apoptosis and disorganized, poorly striated muscle fibers. Blocking apoptosis using pan-caspase inhibitors resulted in decreased neutrophil recruitment into the body of the larva, suggesting a causative link between apoptosis and leukocyte infiltration. These findings suggest that zebrafish is a powerful genetic model system to address the interplay between muscle degeneration and leukocyte infiltration, and indicate that tissue apoptosis may contribute to neutrophil recruitment in some inflammatory states.

Introduction

The zebrafish, Danio rerio, is an emerging model system for examining mechanisms of leukocyte recruitment and human disease. Zebrafish have an immune system that is highly homologous to that of humans, and are being used to study mechanisms of vertebrate hematopoiesis (Crowhurst et al., 2002; Onnebo et al., 2004; de Jong and Zon, 2005) and host-pathogen interactions (Davis et al., 2002; van der Sar et al., 2003; Miller and Neely, 2004). Recently, zebrafish models of acute inflammation have been described using transgenic zebrafish that allow for high-resolution observations of leukocyte recruitment as they respond to wounds or experimental infection (Mathias et al., 2006; Renshaw et al., 2006; Hall et al., 2007; Meijer et al., 2007). These reports demonstrate that acute inflammation in zebrafish involves the active recruitment of neutrophils into tissues followed by resolution by retrograde chemotaxis (Mathias et al., 2006) or apoptosis (Renshaw et al., 2006). In contrast, the first zebrafish model of chronic inflammation was recently described and was characterized by long-term retention of neutrophils in inflamed tissues in the absence of experimentally induced inflammatory stimuli or signs of inflammatory resolution (Mathias et al., 2007).

To identify genes involved in inflammation we screened a collection of zebrafish mutant lines for abnormal tissue distribution of neutrophils. This collection was generated by retrovirus insertional mutagenesis (Amsterdam et al., 1999) which allows rapid identification of mutated genes (Amsterdam et al., 2004). We have previously described a mutant line identified in this screen, hi2217, that showed leukocyte recruitment in areas of epidermal hyperproliferation in the fin due to an insertion in hepatocyte growth factor activator inhibitor 1 (hai1) (Mathias et al., 2007). Here we describe a second line identified in this screen, designated hi1019 that carries an insertion in factor for adipocyte differentiation 24 (fad24, also known as noc3l and ad24). Fad24^hi1019 homozygotes display a phenotype that has some characteristics of chronic inflammation, namely leukocyte infiltration into the trunk of developing larvae without signs of resolution.

Fad24 was originally identified in mammals during a screen looking for genes that are upregulated during the early stages of adipogenesis. Fad24 is an important regulator of adipocyte differentiation in cell culture and is expressed in a variety of human tissues. The protein contains a bZIP-like domain often found in transcription factors and a NOC domain found in proteins involved in rRNA processing and replication initiation (Tominaga et al., 2004). Further work exploring the function of Fad24 demonstrated that it is responsible for recruitment of HBO1, a histone acetyltransferase, to the origin of DNA replication and that together Fad24 and HBO1 are needed for the initiation of DNA replication that precedes adipocyte differentiation (Johmura et al., 2007). The role of fad24 has not been explored in vivo during development, and no reports linked fad24 to muscle degeneration or leukocyte recruitment to tissues.

Here we show that fad24 function is required for the correct formation of several tissues, including muscle, during embryonic and larval development. Abnormal infiltration of leukocytes is observed in the body of fad24^hi1019 larvae in areas of increased apoptosis and disorganized muscle fibers. We further show that neutrophil recruitment can be partially blocked by treating mutant larvae with pan-caspase inhibitors suggesting that apoptosis is at least partially responsible for the leukocyte recruitment. This study illustrates the utility of zebrafish as a model system to study factors that regulate neutrophil recruitment into tissues and to study the interplay between tissue damage and leukocyte recruitment.

Results

Expression of fad24 is disrupted by the hi1019 insertion

To identify genes involved in the regulation of inflammation, we performed a whole-mount in situ hybridization (WISH)-based screen on a collection of zebrafish insertional mutants (Amsterdam et al., 2004). Embryos at 2-3 days post fertilization (dpf) were stained for expression of the zebrafish neutrophil marker, myeloperoxidase (mpo). Of the 276 lines screened, 3 demonstrated an abnormal tissue distribution of neutrophils. One of these lines, hi2217, has been previously reported (Mathias et al., 2007), and here we discuss the characterization of a second line designated hi1019. By 3 dpf larvae homozygous for the hi1019 insertion exhibited several developmental defects, including reduced overall body size, defective jaws and retinae, misshapen yolk sac, abnormal melanocyte distribution, and abnormal somites (Fig. 1A,A′, Fig. 7B,B′). Further analysis revealed that fad24^hi1019 mutants fail to form musculature of the jaw (Fig. S1A,A′,B,B′), display misfolded hearts (Fig. S1C,C′) and have defects in gut formation (Fig. S1D,D′). These phenotypes first manifested at 3 dpf while at younger stages mutants were morphologically indistinguishable from their wild-type (WT) siblings (data not shown). Furthermore, at 3 dpf neutrophils that normally reside in the head or caudal hematopoietic tissue (CHT) of WT larvae (Fig. 1B) infiltrated into the body of fad24^hi1019 homozygotes (Fig. 1B′). In addition, the total number of neutrophils in the mutants was reduced by approximately 36% compared WT (Fig. 2F).

Figure 1. Fad24^hi1019 mutants exhibit a chronic inflammatory phenotype and reduced expression of fad24.

(A,A′) Oblique coherent contrast (OCC) images of WT and homozygous fad24^hi1019 larvae at 3 dpf. (B,B′) Zebrafish mpo in situ hybridizations of WT and fad24^hi1019 larvae at 3 dpf, box indicates the CHT and arrows indicate neutrophils in the body of fad24^hi1019 mutants. (C) Genomic map of the first two exons of zebrafish fad24 showing the location of the hi1019 insertion, each section = 500 bp. (D) RT-PCR analysis of WT (lanes 1,2) and fad24^hi1019 mutant (lanes 3,4) single larvae at 3 dpf, ef1α is used as a control. (E, F, F′) In situ hybridization of zebrafish fad24 in WT (E,F) and fad24^hi1019 mutants (F′) at 26 hpf (E) and 3 dpf (F,F′), b = brain, e = eye, s = somite and y = yolk. Lateral view, anterior to the left. Bars = 200 μm. Representative results from at least three experiments with greater than 10 larvae per condition per experiment.

Figure 7. Fad24^hi1019 mutants exhibit muscle degeneration.

A-F are WT and A′-F′ are fad24^hi1019 mutant larvae. (A,A′) Polarized light microscopy to reveal birefringence of muscle. (B,B′) OCC images of trunk muscle. (C,C′) Confocal projections of trunk muscle immunolabeled with the fast-muscle myosin specific antibody EB165. (Ca,C′a) Zoomed in images better showing muscle fiber striation and size. (D,D′) Immunolabeling with the slow-muscle myosin specific antibody F59. (E,E′) Hematoxylin and Eosin-stained lateral sections through trunk muscle tissue. (F,F′) In situ hybridization using probe cb1045 to reveal myoseptum separating the somites of developing larvae. Lateral view, anterior to the left at 3 dpf. Bars = 200 μm. Representative results from three experiments with greater than 10 larvae per condition per experiment.

Figure 2. Injection of fad24 MO into WT embryos phenocopies the fad24^hi1019 leukocyte infiltration phenotype.

Shown is the CHT and surrounding tissues of sudan black stained WT (A) and fad24^hi1019 (A′) larvae or control MO (B), zfad24 init. MO (C), or zfad24 ex17 MO (D) injected larvae. Lateral view, anterior to the left at 3 dpf. Bar = 200 μm. (E) Schematic of fad24 exon 16, 17 and 18 with the target site of the zfad24 ex17 MO labeled, arrows indicate locations of primers used for RT-PCR of total RNA isolated from single embryos at 24 hours post injection of either uninjected (lane 1), standard control (lane 2) or zfad24 ex17 (lane 3 and 4) MO. (F) Quantification of neutrophil location (either in the CHT or in the body) seen in WT and fad24^hi1019 larvae or control MO, zfad24 init. MO, or ex17 MO injected larvae analyzed by one-way ANOVA at a 95% confidence level using Dunnett's multiple comparison post test, * = p-value <.05. Results reported as average ± SEM.

The hi1019 insertion has previously been mapped to the first intron of the gene fad24 (Fig. 1C) (Amsterdam et al., 2004). RT-PCR on total RNA isolated from single fad24^hi1019 homozygotes or from WT larvae at 3 dpf using primers located in exon 1 and exon 2 of zebrafish fad24 showed a decrease in fad24 transcripts in mutants (Fig. 1D), demonstrating that the insertion significantly reduced fad24 transcription or transcript stability. Amplification from contaminating genomic DNA would result in products about 2000 base pairs larger than amplification from cDNA, thus providing a means to distinguish the two. To address the possibility that fad24^hi1019mutants express a truncated transcript that would not be detected using the primer set described above, a second primer set was designed to amplify the region from exon 7 to exon 12 of fad24. A similar decrease in fad24 transcripts was detected using this primer set (data not shown), suggesting that there is no truncated transcript present in fad24^hi1019mutants. In addition, a similar lack of transcript was detected in embryos from fad24^hi1019 clutches at multiple developmental stages as early as 24 hpf (data not shown).

In humans, fad24 is expressed in a variety of tissues, including muscle (Tominaga et al., 2004). We detected expression of fad24 in the eye, brain and posterior somites at 26 hours post fertilization (hpf) by WISH (Fig. 1E). At 3 dpf expression of fad24 was seen in the head, yolk and trunk of WT larvae, and fad24 expression was significantly reduced in fad24^hi1019 mutants (Fig. 1F,F′). The antisense fad24 RNA probe used for this analysis is nearly full-length and should have detected any alternatively spliced transcripts, if they were present, in fad24^hi1019 larvae. We conclude that the hi1019 retroviral insertion causes a complete or near-complete loss of function of fad24.

Fad24 loss of function is responsible for the developmental defects and for abnormal leukocyte infiltration observed in hi1019 line

To confirm that fad24 loss of function caused the hi1019 phenotype, morpholino oligonucleotides (MOs) targeting fad24 were injected into WT embryos. Two MOs were designed to target either the translational start site of fad24 (zfad24 init), in order to block translation, or the splice junction between exon 17 and intron 17 (zfad24 ex17). Targeting of this splice junction should result in a complete or partial elimination of exon 17 which codes for the majority of the bZIP domain of Fad24, a domain required for the proper localization of human Fad24 in cell culture (Tominaga et al., 2004). Injection of either MO phenocopied the hi1019 leukocyte redistribution phenotype as seen by Sudan Black staining to reveal neutrophil localization (Fig. 2 A-D). Quantification of neutrophil localization showed a clear increase in neutrophils recruited to the body of fad24 MO injected larvae compared to both WT and control MO injected larvae (Fig. 2F). Each MO injected individually phenocopied the major morphological abnormalities observed in the fad24^hi1019 mutants. In particular, jaws fail to form in both the translation-blocked and splice inhibited morphants, as they do in the mutants (Fig. 3A,C,E,G,I). Retinae are reduced to a similar extent in mutants and both morphants (Fig. 3A,C,E,G,I,K) and in the trunk, somite boundaries are poorly defined in the morphants as they are in the mutants (Fig. 3 B,D,F,H,J).

Figure 3. Injection of fad24 MOs into WT embryos phenocopies the fad24^hi1019 morphological phenotypes.

OCC images of the head and yolk (A,C,E,G,I) or body (B,D,F,H,J) of WT (A,B) and fad24^hi1019 (C,D) larvae or control MO (E,F), zfad24 init. MO (G,H), or zfad24 ex17 MO (I,J) injected larvae. (K) Comparison of yolk sac and eye length for WT and fad24^hi1019 larvae or control MO, zfad24 init. MO, or zfad24 ex17 MO injected larvae. Results reported as average ± SEM, analyzed by one-way ANOVA at a 95% confidence level using Dunnett's multiple comparison post test, * = p-value <.05. Representative results from three experiments.

To confirm that the splicing MO affected splicing at the intended junction, RT-PCR was performed on total RNA isolated from uninjected controls, control MO-injected and zfad24 ex17 MO injected embryos using primers located in exon 16 and exon 18 of fad24. This analysis revealed that zfad24 ex17 MO injected embryos had reduced expression of correctly spliced fad24 transcript compared to control embryos and showed expression of two misspliced transcripts (Fig. 2E). Together, our findings strongly suggest that loss of fad24 function causes the major defects observed in fad24^hi1019 homozygotes.

Zebrafish fad24 localizes to granules in the nucleus

Human Fad24 has been shown to localize to unidentified nuclear granules in transfected HeLa cells (Johmura et al., 2007). To determine the cellular localization of zebrafish Fad24 (zFad24) a fusion construct was made tagging EGFP to the N-terminus of zFad24. Transfection of this construct into HEK cells showed that full-length zFad24 also localized to the nucleus and was often found in distinct nuclear granules (Fig. 4B). To determine the subcellular localization of EGFP-zFad24 in zebrafish the fusion construct including the CMV promoter was subcloned into a Tol2 vector to allow for early genome integration and high levels of transient expression when coinjected with transposase mRNA at the one-cell stage (Kawakami et al., 2004). Transient expression of EGFP-zFad24 could be seen throughout the larva, most clearly in muscle fibers. Whereas EGFP was distributed throughout the muscle fiber cytoplasm (Fig. 4C), EGFP-zFad24 showed a punctate distribution, consistent with nuclear localization (Fig. 4D). Although ectopic zFad24 was produced, it did not rescue the mutant phenotype at 3 dpf. The lack of phenotypic rescue may be due to mosaicism inherent in the transient overexpression assay, or to a requirement that Fad24 be expressed at the proper levels in order to function correctly. Similarly we observed no phenotypic rescue when embryos were injected with in vitro transcribed zebrafish fad24 mRNA. These results indicate that full-length zFad24 has a similar subcellular localization to human Fad24.

Figure 4. Zebrafish fad24 localizes to nuclear granules.

HEK cells transfected with EGFP (A) or N-terminal EGFP tagged zebrafish Fad24 (B). DAPI staining is used to reveal the nucleus, Bar = 50 μm. Transient expression of EGFP (C) or N-terminal EGFP tagged zebrafish Fad24 (D) in muscle cells of 3 dpf WT larvae. Representative results from three experiments.

Zebrafish fad24 regulates lipid metabolism in vivo

Previous studies have reported that human Fad24 is a positive regulator of adipocyte differentiation in cell culture systems (Tominaga et al., 2004). To determine if zebrafish Fad24 has a similar function in vivo, larvae were stained for neutral fat using oil red O. Staining of WT larvae at 3 dpf revealed concentrated lipids in portions of the head, eye, and heart (Fig. 5A arrows), consistent with previous reports (Schlombs et al., 2003). In addition, lipids could be seen associated with the vasculature (Schlegel and Stainier, 2006) (Fig. 5A arrowheads). In fad24^hi1019 mutants, reduced lipid concentrations were observed in all of these areas (Fig. 5A′) yet the yolk sac of both WT and mutant larvae stained heavily with oil red O (Fig. 5A,A′). Injection of the zfad24 init. MO also resulted in loss of oil red O staining (Fig. 5B,C). Together, these results suggest an important role for zFad24 in lipid metabolism during zebrafish development.

Figure 5. Fad24^hi1019 mutants exhibit defects in lipid metabolism.

(A, A′) Oil red O staining in a PTU treated WT (A) and fad24^hi1019 (A′) larvae, arrows show areas of staining in the head and heart, and arrowheads show areas of staining in the vasculature that are absent in the fad24^hi1019 mutant. (B, C) Oil red O staining in the body of control (B) or zfad24 init. MO (C) injected larvae. h = heart, isv = intersegmental vessel, da = dorsal aorta and dlav = dorsal longitudinal anastomotic vessel. Lateral view, anterior to the left at 3 dpf. Bars = 200 μm. Representative results from three experiments with greater than 10 larvae per condition per experiment.

Neutrophils and macrophages infiltrate the trunk of fad24^hi1019 mutants

To characterize the leukocyte redistribution phenotype in fad24^hi1019 mutants, neutrophil localization was examined at different developmental stages. In general, neutrophil distribution was normal until 2.5 dpf (data not shown), and by 3 dpf, all mutants showed extensive infiltration of neutrophils into the trunk (Fig. 6A,A′). L-plastin, a marker for macrophages in early embryos (Herbomel et al., 1999; Bennett et al., 2001; Su et al., 2007) and leukocytes in older embryos (Meijer et al., 2007) showed a similar abnormal distribution in fad24^hi1019 mutants (Fig. 6B,B′). Overlay to examine both MPO and L-plastin staining revealed that all MPO⁺ cells (neutrophils) also expressed L-plastin. However a subpopulation of L-plastin⁺ cells did not express MPO (Fig. 6C,C′). Closer examination of the MPO^- L-plastin⁺ population showed that they had a more elongated morphology than neutrophils (Fig. 6D) and likely represented macrophages. To confirm that macrophages are involved in the inflammatory response in fad24^hi1019 mutants, we examined expression of c-fms (csf1r), a separate macrophage marker that does not co-express with mpo (Meijer et al., 2007; Su et al., 2007). In WT siblings the majority of c-fms⁺ leukocytes were found in the CHT (Fig. 6E) while in fad24^hi1019 homozygotes c-fms⁺ leukocytes had infiltrated into the body (Fig. 6E′). Together, these findings suggest that both neutrophils and macrophages infiltrate into the trunk of fad24^hi1019 larvae.

Figure 6. Leukocyte recruitment into the body of fad24^hi1019 mutants.

A-C are WT and A′-C′ are fad24^hi1019 mutant larvae. Immunolabeling for MPO (A,A′) and L-plastin (B,B′). (C,C′) Overlay of MPO and L-plastin co-immunolabeling shows that neutrophils, MPO⁺ and L-plastin⁺ (arrows), and macrophages, L-plastin⁺ and MPO^- cells (arrowhead), contribute to the inflammatory response. (D) Confocal projections show the more elongated morphology of macrophages (arrowhead) compared to neutrophils (arrow). (E,E′) Whole-mount in situ hybridization for c-fms, a macrophage marker, red box indicates the CHT, and red arrows indicate macrophages in the body of fad24^hi1019 mutants. Black arrows point to c-fms expression in the neural crest. (F,F′) XZ projections of MPO labeled WT and fad24^hi1019 larvae. (G,G′) ZY projections of MPO (green) and p63 (red, to mark the epidermis) double-immunolabeled larvae, white line indicates the midline of the larva. (H) A 3.9 μm optical longitudinal section through the muscle of a fad24^hi1019 larvae immunolabeled for MPO. All images except F,F′G,G′ are in lateral view, anterior to the left and all images are at 3 dpf. Bars = 200 μm. Representative results from three experiments.

To better determine the tissue localization of neutrophils in fad24^hi1019 mutants optical sectioning using a confocal microscope was done on MPO immunolabeled larvae. Projections in the Z direction show that neutrophils infiltrated into much deeper tissues in mutants compared to WT larvae (Fig. 6F,F′). Co-immunolabeling with an antibody to p63, a marker of epidermal cells, demonstrated limited inflammation in the epidermis with most neutrophils being found in deeper tissues (Fig. 6G,G′) including muscle (Fig. 6H). Together this suggests that neutrophils are recruited to multiple tissues in fad24^hi1019 mutants and recruitment is not limited to the epidermis as described for the previously published hi2217 inflammation mutant (Mathias et al., 2007).

To determine the subcellular localization of MPO and L-plastin in neutrophils from fad24^hi1019 larvae we used high magnification confocal microscopy on immunolabeled larvae. Localization of L-plastin is peripheral with concentration at the membrane while MPO is localized to distinct cytoplasmic granules (Fig S2D,E) similar to what has been observed in neutrophils at a wound in WT embryos (data not shown). This suggests that neutrophils in fad24^hi1019 larvae have a normal complement of MPO containing granules in the cytoplasm. Furthermore, MPO in the mutants appears to be active when examined by whole mount endogenous MPO activity assay (Fig. S2F,F′).

To generate a model to visualize the leukocyte trafficking in real-time, fad24^hi1019 carriers were crossed to Tg(mpx:GFP)uwm1 transgenic fish, in which neutrophils express GFP (Mathias et al., 2006). Time-lapse confocal imaging of fad24^hi1019;mpx:GFP larvae at 3 dpf revealed extensive infiltration of highly motile neutrophils into the trunk (see Movie 1 in supplementary material). In contrast, neutrophils in WT larvae were less migratory and remained primarily in the CHT and in the yolk extension, with the exception of one neutrophil that migrated through the body at the level of the horizontal myoseptum (see Movie 2 in supplementary material). Neutrophil migration in fad24 mutants appeared similar to that reported in the tailfin of hai1 mutants (Mathias et al., 2007). Neutrophils did not accumulate in specific areas and did not show reverse migration to the vasculature or CHT as observed in wounded WT embryos (Mathias et al., 2006). Wounding the fin of fad24^hi1019 larvae resulted in neutrophil recruitment, suggesting that neutrophil recruitment to acute inflammatory stimuli is not impaired in the fad24 mutants (Fig. S2 A, see Movie 3 and 4 in supplementary material). A subpopulation of cells expressing low levels of MPO has been described in the Tg(mpx:GFP)uwm1 transgenic line (Mathias et al., 2006) and it was suggested that these cells may be macrophages. This cell population can be distinguished in fad24^hi1019;mpx:GFP larvae (Fig. S2C) and can be found migrating randomly through the body of larvae (see Movie 3 in supplementary material) and responding to wounds inflicted in the fin (Fig. S2 B,C, see Movie 3 and 4 in supplementary material). Taken together, we were not able to detect any defects in migration, morphology or function of neutrophils or macrophages from fad24^hi1019 larvae compared to their WT siblings.

Fad24^hi1019 mutants display decreased muscle organization

Tissue infiltration by neutrophils in fad24^hi1019 mutants is primarily restricted to the trunk, where fad24 is expressed at 3 dpf (Fig. 1F) and obvious body patterning defects can be seen (Fig. 1 A,A′). To determine if defects in muscle architecture exist in fad24 mutants, polarized light microscopy was used to view the birefringence of trunk muscle. Birefringence was reduced in the skeletal muscle of the trunk of fad24^hi1019 mutants compared to WT (Fig. 7A,A′), similar to what has been reported for zebrafish with mutations in structural muscle genes (Granato et al., 1996; Behra et al., 2002; Etard et al., 2005). In addition, mutants showed reduced definition of somites in the trunk (Fig. 7B,B′). To examine muscle fiber organization, muscle fibers were immunolabeled using antibodies specific for fast-muscle or slow-muscle myosin. Confocal images of immunolabeled larvae stained with EB165, a fast-muscle myosin-specific antibody, revealed a general disorganization of muscle fiber clusters in the mutants (Fig. 7C,C′) Mutant muscle fibers were smaller in width compared to WT and had significantly fewer striations (Fig. 7Ca,C′a). Staining with F59, a slow-muscle myosin-specific antibody, revealed a similar disorganization of the slow muscle fibers in fad24^hi1019 mutants (Fig. 7D,D′). Hematoxylin and eosin stained longitudinal sections taken through the developing somites of 3 dpf larvae also clearly showed differences in muscle fiber size and striation (Fig. 7E,E′). To examine somite structure we stained larvae for expression of a myoseptum marker cb1045 (Thisse et al., 2004; Deniziak et al., 2006). Fad24^hi1019 mutants showed normal myoseptum (Fig. 7F,F′) demonstrating that somite boundaries were intact in the mutants. The touch-provoked swim response of mutant larvae was also defective at 3 dpf, and mutant fish tended to swim in circles with poorly coordinated tail movements (data not shown). The larvae displayed progressive muscle degeneration and were generally unable to swim at 5 dpf (data not shown). Taken together, the findings suggest that the fad24^hi1019 mutants display leukocyte infiltration into areas of progressive muscle degeneration.

Leukocytes are not required for the onset of muscle degeneration

Human muscle diseases are often associated with leukocyte infiltration and in some cases this can contribute to the progression of disease (Formigli et al., 1992; Hodgetts et al., 2006). To determine if the leukocyte infiltration observed in fad24^hi1019 mutants is responsible for the onset of the muscle degeneration, pu.1 (also known as spi1), a transcription factor required for neutrophil and macrophage development in zebrafish, was knocked down using a previously characterized MO (Rhodes et al., 2005; Su et al., 2007). Injection of the pu.1 MO successfully reduced neutrophil numbers in WT and mutant larvae at 3 dpf (Fig. 8C,D), but did not alleviate the early (3 dpf) muscle degeneration phenotype (Fig. 8B,D,Ba,Da). These results indicate that neutrophils and macrophages do not cause the initial muscle defect in fad24^hi1019 mutants. However, since the MO was not effective at eliminating leukocytes after 3 dpf, we were not able to determine if leukocytes play a role in the progression of muscle degeneration in the fad24^hi1019 mutant larvae (data not shown).

Figure 8. Onset of muscle degeneration in fad24^hi1019 mutants is not mediated by leukocytes.

Tailfin views at 3 dpf. A,C are WT, B,D are fad24^hi1019 mutants. (A,B,C,D) Co-immunolabeling for zMPO (green) and fast-muscle myosin (red) in uninjected (A,B) and pu.1 MO injected (C,D) larvae, arrows indicated neutrophils. White boxes indicated areas magnified in Aa,Ba,Ca,Da. Lateral view with anterior to the left. Bar = 200 μm. Representative results from three experiments.

Apoptosis in the muscle of fad24^hi1019 contributes to the recruitment of neutrophils

To determine if fad24^hi1019 mutants display apoptosis in areas of abnormal leukocyte recruitment and muscle degeneration TUNEL and acridine orange staining were performed. TUNEL labeling revealed an increase in apoptosis in the body of fad24^hi1019 mutants compared to WT larvae (Fig. 9A,A′) that did not overlap with MPO immunolabeling (Fig. 9B), consistent with apoptosis in tissues of the trunk. Staining live larvae with acridine orange also showed increased apoptosis in the mutants (Fig. 9C,C′). Interestingly, delivery of the pan-caspase inhibitors zVD.fmk or Q-VD-OPh to fad24^hi1019 larvae resulted in an elimination of acridine orange staining in the body of mutant larvae (Fig. 9D,D′ and data not shown). Treatment with caspase inhibitors also reduced neutrophil infiltration into the body of the zebrafish by 50% (Fig. 9E,E′,F), suggesting that tissue apoptosis is an important factor involved in recruiting neutrophils into the trunk of the fad24^hi1019 mutant larvae. Taken together these findings suggest that neutrophilic infiltration is mediated in part by tissue apoptosis in fad24^hi1019 mutants.

Figure 9. Apoptosis is partially responsible for the recruitment of neutrophils to the trunk of fad24^hi1019 mutant larvae.

(A,A′) TUNEL staining in the trunk of WT (A) and fad24^hi1019 mutants (A′). (B) TUNEL staining in fad24^hi1019 mutant coimmunolabeled with MPO. (C,C′) Acridine orange staining in the trunk of WT (C) and fad24^hi1019 mutant (C′) larvae. (D,D′) Acridine orange staining in fad24^hi1019 larvae can be blocked by the addition of the pan-caspase inhibitor zVD.fmk (D′) to the larvae water but not by addition of the vehicle control, DMSO (D). (E,E′) MPO immunolabeling of DMSO (E) and zVD.fmk (E′) treated fad24^hi1019 larvae. (F) Quantification of neutrophils found in the body of fad24^hi1019 larvae when treated with zVD.fmk relative to the vehicle control, DMSO (set to 100%). Average of three replicates analyzed by a paired student's t-test at a 95% confidence level, * = p-value <.05, error bar is standard error of the mean. Lateral view with anterior to the left at 3 dpf. Bars except C = 200 μm. Representative results from three experiments with greater than 10 larvae per condition per experiment.

Discussion

In this report we identify fad24 as a novel regulator of muscle integrity and leukocyte recruitment in vivo. This identification is based on muscle degeneration and abnormal leukocyte infiltration observed in fad24^hi1019 mutants. The abnormal leukocyte distribution and muscle degeneration were accompanied by increases in apoptosis in the trunk and we show that inhibitors of caspase activity impair neutrophil recruitment in the fad24 mutant. Taken together, these findings suggest that zebrafish is a powerful genetic model system to study the links between leukocyte recruitment, muscle degeneration and apoptosis in vivo.

This is, to our knowledge, the first paper to characterize in vivo functions for the regulator of adipogenesis, fad24. Previous studies have identified genes required for lipid metabolism (Schlombs et al., 2003; Schlegel and Stainier, 2006) or for skeletal muscle formation (Granato et al., 1996; Behra et al., 2002; Etard et al., 2005; Cheng et al., 2006; Deniziak et al., 2006; Seeley et al., 2007; Steffen et al., 2007). We identify fad24 as a critical regulator of both lipid metabolism and muscle integrity and show that zebrafish Fad24 protein localizes to the nucleus and targets to nuclear granules, similar to the distribution of human Fad24 (Tominaga et al., 2004). Together, our findings suggest functional conservation between zebrafish and human fad24.

Fad24 mutants share phenotypic characteristics with zebrafish embryos that display embryonic malabsorption syndrome (EMS). For example, previous studies report that treatment of zebrafish embryos with clofibrate induces phenotypes characterized by unutilized yolk reserves, small eyes and head, jaw malformations, heart folding defects, and disorganized muscle fibers (Raldua et al., 2008), similar to what we observe with the Fad24 mutants. Furthermore, the oil red O staining pattern observed in fad24^hi1019 mutants is consistent with a failure of endogenous lipids found in the yolk to be properly transported to the rest of the larva, and is very similar to that described for clofibrate-treated embryos (Raldua et al., 2008) and with embryos deficient in the lipid transport protein mtp (Schlegel and Stainier, 2006). These findings support a role for zebrafish fad24 in regulating embryonic lipid metabolism and suggest that some of the phenotypes observed in fad24^hi1019 mutant larvae may be due to nutritional deprivation. Regulation of proper embryonic lipid metabolism is one potential mechanism through which fad24 may indirectly regulate muscle integrity and leukocyte infiltration.

Previous studies have demonstrated high expression of human fad24 in muscle tissue, however a functional role for fad24 in human muscle has not been previously reported. Fad24 expression is upregulated during myogenesis, suggesting that fad24 may have an important role in regulating muscle development (Tominaga et al., 2004). We also find that zebrafish fad24 is expressed in muscle (Fig. 1E). The muscle degeneration in the fad24^hi1019 mutant is associated with a progressive defect in motor function, with the majority of mutants unable to swim after 5 dpf (data not shown). Our findings suggest that fad24 is necessary for proper muscle development and integrity since fad24-deficient larvae display progressive muscle degeneration.

The fad24 mutants had substantial leukocyte infiltration associated with the muscle degeneration. We and others have previously reported leukocyte infiltration associated with epithelial hyperproliferation (Carney et al., 2007; Mathias et al., 2007), but this is the first report of a mutant with leukocyte infiltration into other tissues. There have been previous reports of neutrophils associated with stressed tissues in other mutants (Le Guyader et al., 2008), however, we did not find abnormal neutrophil distribution to be a common feature of embryos with developmental defects, since only 3 out of 276 mutant lines we screened (fewer than 2%) showed leukocyte infiltration into tissues.

The signals that recruit neutrophils to damaged tissues remain largely unknown. A recent study reports that leukocyte infiltration into tissues can be associated with apoptotic clusters of keratinocytes in hai1 deficient embryos, however no direct link between apoptosis and leukocyte recruitment was established (Carney et al., 2007). We find that fad24^hi1019 larvae have increased numbers of apoptotic cells in areas where neutrophils are also observed. Furthermore we show that inhibition of apoptosis with two different caspase inhibitors impairs neutrophil recruitment to the trunk of fad24^hi1019 mutants. These findings suggest that apoptosis in tissues may be a significant factor that contributes to the neutrophil recruitment in the fad24^hi1019 mutant. Alternatively, the reduced neutrophil recruitment into the body could be explained by the role some caspases play in the processing of proinflammatory cytokines (Thornberry et al., 1992; Martinon and Tschopp, 2007). We cannot, however, rule out the possibility that caspase inhibitors may have an off target effect on neutrophil development or motility. It is also important to note that the exact nature of the cell death seen by increased TUNEL and acridine orange staining is not known. TUNEL labels DNA fragmentation most often associated with apoptotic cells (Gavrieli et al., 1992) and the use of acridine orange to label apoptotic cells in zebrafish is well established (Parng et al., 2002; Tucker and Lardelli, 2007). Pan-caspase inhibitors block acridine orange staining suggesting apoptosis is involved, but we cannot rule out the possibility that some form of secondary necrosis is occurring in the body of the fad24^hi1019 larvae.

It is also possible that fad24 has a more direct role in regulating the inflammatory response. A recent report suggests that Fad24 regulates NF-κB activity by interacting with the p65 subunit (Johmura et al., 2008), providing an alternative mechanism by which Fad24 may regulate apoptosis and leukocyte recruitment. It is also possible that fad24 affects inflammatory responses indirectly by regulating adipogenesis, since adipose tissue is a critical regulator of the inflammatory response through the release of inflammatory cytokines (Wisse, 2004). The exact nature of the cues responsible for mediating leukocyte recruitment in the fad24^hi1019 mutants remain unknown, but likely involves a complex interplay between multiple factors.

Substantial evidence supports the validity of using zebrafish for modeling the pathogenesis of human muscular degenerative disorders. This evidence is derived from mutational analyses of structural genes such as titin (Xu et al., 2002; Steffen et al., 2007) and dystrophin (Guyon et al., 2003). Other important muscle structural proteins have been identified and characterized in zebrafish, including the key members of the dystrophin associated protein complex (Chambers et al., 2001; Parsons et al., 2002; Guyon et al., 2003). This report adds fad24 to the list of genes with muscle degeneration phenotypes when mutated. Although leukocyte recruitment in fad24^hi1019 mutants is not limited to muscle tissue, our findings suggest that zebrafish could provide a powerful model system to study the interplay between recruitment and muscle degeneration in zebrafish models of myopathies. Preliminary results from our laboratory indicate that neutrophilic infiltration is found in both dystrophin and titin-deficient zebrafish morphants or mutants (data not shown). There is substantial evidence to suggest that inflammation is involved in the clinical progression of muscular dystrophies (Grounds and Torrisi, 2004; Hodgetts et al., 2006; Whitehead et al., 2006). We find that leukoctye infiltration is not necessary for the onset of muscle defects in the fad24^hi1019 mutants, however, we were not able to determine if leukocytes are involved in the progression of muscle degeneration because pu.1 MO knock-down was transient and leukocyte numbers recovered after 3 dpf. Future studies will be needed to determine the contribution of leukocytes to the progression of muscle degeneration in zebrafish models of myopathy.

Few studies have addressed the factors that regulate the recruitment of leukocytes to damaged or degenerative tissues. Our findings indicate that tissue apoptosis may contribute to leukocyte recruitment in the Fad24 mutants and that inhibition of caspases may represent an attractive target to limit these responses. Furthermore, zebrafish models of leukocyte recruitment to tissues will provide powerful tools to screen for factors that regulate cell recruitment, and the fad24^hi1019;mpx:GFP transgenic line can be used in large-scale chemical screens aimed at identifying novel compounds that target apoptosis or leukocyte recruitment.

Experimental Procedures

Zebrafish maintenance

All protocols using zebrafish in this study were approved by the University of Wisconsin-Madison Research Animal Resources Center. Adult zebrafish and embryos were maintained according to standard protocols (Nusslein-Volhard, 2002) and staged as previously described (Kimmel et al., 1995). Heterozygous hi1019 (fad24^hi1019,official designation noc3l^hi1019/noc3l⁺) were crossed to Tg(mpx:GFP)uwm1 (Mathias et al., 2006) transgenic adults and raised; embryos from these crosses are referred to in this manuscript as fad24^hi1019;mpx:GFP.

Image acquisition

Images were captured with either (1) a Nikon SMZ-1500 zoom microscope equipped with epifluorescent illumination, (2) a Nikon Eclipse TE300 inverted microscope equipped with epifluorescent illumination or (3) a Fluoview FV1000 FV10-ASW confocal laser scanning microscope. Color images were captured with NIS Elements D 2.30 software, confocal images were captured with Fluoview FV10-ASW software version 01.07, and all other images were captured and analyzed with MetaMorph software. The birefringence of the axial skeletal muscle was examined under polarized light on a Nikon SMZ-1500 zoom microscope as described previously (Felsenfeld et al., 1990).

Whole-mount in situ hybridization

The Hopkins mutant zebrafish collection (Amsterdam et al., 2004) was screened for expression of mpo by in situ hybridization. Briefly, embryos were obtained from crosses of adults known to be heterozygous for individual insertions, raised and fixed at 2-3 dpf in 4% paraformaldehyde in PBS; mpo mRNA was labeled by in situ hybridization as described previously (Bennett et al., 2001). Zebrafish fad24 mRNA expression and the myoseptum was detected in 3 dpf larvae by the same protocol using probe cb522 (accession # CA408054) and probe cb1045 (accession # CF943681) respectively, as done previously (Thisse, 2001). The c-fms probe (Parichy et al., 2000; Herbomel et al., 2001) was kindly provided by L. Ramakrishnan.

Sudan Black staining

Neutrophils were detected using Sudan Black as previously reported (Le Guyader et al., 2008). After staining, larvae were incubated with a 1% KOH and 1% H₂O₂ solution at room temperature for 15 minuets to clear pigment from the larvae making it easier to visualize individual neutrophils.

Endogenous MPO activity assay

Larvae were fixed in 4% paraformaldehyde/PBS for 2 hours at room temperature. To detect MPO activity, a Sigma kit (390-A) was used as follows: Larvae were washed in 1× Trizmal (pH 6.3) containing 0.01% Tween-20 (TT) and then incubated at 37°C in TT containing 1.5 mg/ml substrate (supplied) and .015% hydrogen peroxide for 5-15 min. Larvae were then washed in PBS.

Oil red O staining

Larvae were stained with oil red O as described (Schlegel and Stainier, 2006). Briefly, larvae were fixed in 3.7% formaldehyde for 6 hours at 4°C, washed in PBS, and stained with filtered .3% oil red o (Sigma) in 60% 2-propanol for 2-3 hours at room temperature. Larvae were removed from stain and washed with PBS before imaging.

Zebrafish embryo sectioning

Larvae were fixed in 4% paraformaldehyde, washed in PBS, suffused in 30% sucrose and infiltrated with paraffin. Paraffin sections, 5 μm thick, were processed and stained with Hematoxylin and Eosin as described previously (Hsu et al., 2004).

RNA isolation and RT-PCR

Total RNA was isolated from single embryos or larvae using a STAT-60 (Tel-test, inc.) RNA isolation protocol. Briefly, 100 μl of STAT-60 was added to an embryo followed by vortexing. Debris was pelleted and the supernatant was extracted with chloroform. RNA was precipitated from the aqueous layer with isopropanol, washed, dried and resuspended in nuclease-free water. Zebrafish mRNA transcripts were detected by RT-PCR using a one-step kit purchased from Qiagen. Zebrafish fad24 was detected using primer sets (5′-3′) CGGCAGTTTAAGCAACAGAGT and TCCTCCTGCTGCATCTTTCTG, TGCCGTCACCGTCAGAAAGTTAGT and TAGCTTCAGCTTCCAGCAGTTCCT, and to detect changes in fad24 transcript due to zfad24 ex 17 splicing MO the primer set CCCTGAAATTCTACAGCCACTTG and GCGTCTCATTATCCAGAAGGATG was used.

Whole-mount immunolabeling

Zebrafish larvae were fixed in 4% paraformaldehyde in PBS overnight at 4°C, 1% formaldehyde in PBS for 2 hours at room temperature, or graded methanol in PBS at room temperature and immunolabeled as described previously (Mathias et al., 2006). Zebrafish MPO and L-plastin were detected using polyclonal antibodies (Mathias et al., 2006; Clay et al., 2007). Slow and fast muscle myosin were detected using monoclonal antibodies F59 and EB165, respectively and monoclonal antibody p63 (Novus Biological) was used at 1:250 to detect epidermal cells. F59, EB165, and A41025 were purchased from the developmental studies hybridoma bank and were used at 1:20. For MPO/L-plastin double-immunolabeling, larvae were fixed in 1% Formaldehyde/PBS for 2 hours at room temperature then labeled (as above) sequentially as follows: (1) rabbit anti-zMPO, (2) FITC-conjugated goat anti-rabbit Fab fragment (Jackson), (3) rabbit anti-L-Plastin IgG conjugated to Rhodamine Red using the FluoReporter Rhodamine Red-X Protein Labeling Kit (Molecular Probes), according to manufacturer's instructions.

TUNEL and Acridine Orange labeling

Apoptotic cells were fluorescently labeled by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) as described (Mathias et al., 2007). Apoptotic cells were also labeled by incubation of live zebrafish with 16.7 μg/ml acridine orange in E3 in the dark for 30 minutes. Larvae were washed with E3 and analyzed under a fluorescence microscope (Barrallo-Gimeno et al., 2004).

Morpholino oligonucleotide microinjection

Morpholino oligonucleotides (MO) were purchased from GeneTools, LLC (Philomath, OR, USA) and prepared as described (Mathias et al., 2007); Standard control MO sequence is available from GeneTools and was injected at the same (or greater) volume and concentration. pu.1 MO (1 nl at 1 mM injected) was used as described previously (Langheinrich et al., 2002; Rhodes et al., 2005). Other MO were designed to block translation or splicing of fad24 transcripts (accession # NM_001002863).

zfad24 init (initiation site MO) 1 mM, 1 nl: GCCCATTTTGAGCGATGATTTGACT

zfad24 ex17 (splicing MO) 200 μM,1 nl : AGCAATGTCTCATCTCACCTGCATC.

zVD.fmk and Q-VD-OPh drug treatment

Larvae obtained from crosses of adults known to be heterozygous for the hi1019 insertion were incubated in 100 μM zVD.fmk (Z-Val-DL-Asp-fluoromethylketone, Bachem), 50 μM Q-VD-OPh (Quinolyl-Val-Asp-OPh, R&D systems) or equal volume of DMSO in E3 at 28°C from 24 hpf to 3 dpf. Mutant larvae were then separated from WT and acridine orange or MPO antibody staining was performed as above. Three replicate experiments were done with an average sample size of 13 mutant larvae per condition for each experiment. Due to differences in neutrophil number from clutch to clutch, results are displayed as being relative to the DMSO control condition in each experiment. Average neutrophil counts from each experiment were analyzed by a paired student's t-test at a 95% confidence level. Due to differences in neutrophil number from clutch to clutch the average of each DMSO group was paired to the average of each zVD.fmk group for this analysis.

Cloning, cell culture, and transient expression in zebrafish

Fad24 was cloned using primers based on the Pubmed sequence, NM_001002863. RNA was isolated from 19 somite-staged embryos as above, and mRNA was enriched using Oligotex (Qiagen). SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity (Invitrogen) was used to amplify fad24 which was subsequently cloned into pCR2.1 (Invitrogen). An EGFP tagged Fad24 was created for cell culture experiments by PCR amplification of the fad24 sequence and cloning into pEGFP-C1 (Clontech). For transient overexpression of these constructs in zebrafish the entire EGFP-zFad24 cassette (including the CMV promoter) was cloned into a Tol2 vector. A construct containing full-length Tol2 transposon arms was kindly provided by Mike Nonet (Washington University, St. Louis) and was used to create a construct with minimal Tol2 elements for efficient integration, as described previously (Urasaki et al., 2006). Widespread expression of Tol2 EGFP-zFad24 or Tol2 EGFP was obtained by injection of 525 pl of 25 ng/μl plasmid with 35 ng/μl in vitro transcribed (Invitrogen) Tol2 transposase mRNA.

HEK293 fibroblasts were cultured in Dulbecco's modification of Eagles's Medium (Cellgro), containing 4.5g/L glucose, L-glutamine and sodium pyruvate supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin (Cellgro) and 10% heat-inactivated fetal bovine serum (HyClone). Cells were transfected using 1μg DNA and 3μl Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. At 24 hours post transfection cells were plated onto a glass coverslip coated with human fibronectin for 24 hours. Cells were then fixed with 3% formaldehyde, quenched in glycine and stained 30 minutes with DAPI (Molecular Probes).