Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Apr 15.
Published in final edited form as: J Immunol. 2009 Apr 15;182(8):4744–4750. doi: 10.4049/jimmunol.0804311

Statins Impair CD1d-Mediated Antigen Presentation Through Inhibition of Prenylation1

Masood A Khan *, Richard M Gallo *, Gourapura J Renukaradhya *, Wenjun Du †, Jacquelyn Gervay-Hague †, Randy R Brutkiewicz *
PMCID: PMC2850571  NIHMSID: NIHMS189258  PMID: 19342651

Abstract

Statins are widely used as cholesterol-lowering agents that also decrease inflammation, and target enzymes essential for prenylation, an important process in the activation and intracellular transport of proteins vital for a wide variety of cellular functions. Here, we report that statins impair a critical component of the innate immune response, CD1d-mediated antigen presentation. The addition of specific intermediates in the isoprenylation pathway reversed this effect, whereas specific targeting of enzymes responsible for prenylation mimicked the inhibitory effects of statins on antigen presentation by CD1d as well as MHC class II molecules. This study demonstrates the importance of isoprenylation in the regulation of antigen presentation and suggests a mechanism by which statins reduce inflammatory responses.

Keywords: Antigen Presentation/Processing, MHC, CD1d

INTRODUCTION

The endogenous mevalonate pathway utilizes the 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA), which is responsible for the biosynthesis of cholesterol and isoprenoids, and inhibiting HMG-CoA by statins potently suppresses this pathway (Fig. 1) (1). Statins have been used for the treatment of cardiovascular diseases over the years due to their lipid-lowering effects (2, 3). Their efficacy in the treatment of atherosclerosis has been attributed to both cholesterol-dependent and -independent activities (2, 4, 5). Given the cholesterol-independent effect of statins in inflammation, atherosclerosis and immunomodulation (2), it is not surprising that the immune response would also be affected independently of their lipid-lowering effects.

FIGURE 1.

FIGURE 1

The mevalonate pathway and its targets for prenylation and cholesterol biosynthesis inhibition. Simvastatin and other statins block the biosynthesis of mevalonic acid by inhibiting 3-hydroxy-3-methylglutaryl coenzyme A. The prenylation-specific inhibitors FTI-277 and GGTI-298 inhibit the activities of farnesyl and geranylgeranyl transferases, respectively. The cholesterol biosynthesis inhibitor AY9944 prevents the conversion of 7-dehydrocholesterol into cholesterol by inhibiting 7-dehydrocholesterol reductase.

In addition to their ability to reduce the level of lipids, statins also inhibit the biosynthesis of isoprenoid intermediates such as geranylgeranyl pyrophosphate (GGPP) and farnesyl pyrophosphate (FPP) (6). Isoprenylation, the attachment of GGPP and FPP, is a post-translational modification of several proteins including the small GTP-binding proteins Ras, Rho and Rab (7). Isoprenylation plays some role in the activation and intracellular transport of proteins important for various cellular functions such as differentiation, proliferation, motility and the maintenance of cell shape (8). Moreover, prenylation enables GTPases to be targeted to the cell membrane and allows their subsequent interaction with downstream signal transduction effector molecules (9). Statins therefore impair the functioning of these small GTPases by preventing their correct membrane targeting (10).

Statins have been shown to affect both innate and acquired immune responses (11). Innate immune functions are inhibited via the targeting of TLR2 and TLR4 expression, preventing the activation of endothelial cells and macrophages (12). In contrast, acquired immune responses are affected by statin-dependent inhibition of antigen presentation by MHC class II molecules or T cell function and by the suppression of co-stimulatory molecules (e.g. CD40, CD80 and CD86) on macrophages, lymphocytes and endothelial cells (13, 14). In the adaptive immune response, the inhibition of prenylation plays an important role in the Th1 to Th2 switch and is protective against autoimmune diseases of the central nervous system, experimental arthritis, autoimmune myocarditis and systemic lupus erythematosus (15). Statins also inhibit pro-inflammatory gene expression in a number of leukocytes and vascular cells (15) and also diminish monocyte chemoattractant protein-1 in the neointima (16, 17). NK cell cytotoxicity in patients with cardiovascular disease has also been shown to be impaired by statins (18).

Natural killer T (NKT) cells are T lymphocytes with innate immune effector functions that are activated by lipid antigens presented by the MHC class I-like CD1d molecule (19-21). In the lipid-associated disorder atherosclerosis, T cells and NKT cells play crucial roles in the pathology of the disease (22-26). In advanced plaques, the numbers of DC, T cells, macrophages and HLA-DR expressing cells have been found in higher numbers than initial lesions or stable plaques (27). Further, NKT cells have been shown to contribute to the progression of atherosclerotic lesions (22, 28-30). Importantly, both CD1d expression and NKT cells have been detected in human atherosclerotic plaques (31-33). As statins have been found to reduce inflammation and stabilize atherosclerotic plaques by their activities independent of their lipid-lowering effects (34, 35), it is important to understand their ability to regulate antigen presentation. Interestingly, statins have been shown to alter MHC class II-mediated antigen presentation (36, 37), and although CD1d molecules traffic through some of the same endocytic compartments as MHC class II for antigen loading (19), their effects on antigen presentation by CD1d have not been studied. Thus, in the current study, the ability of statins to regulate lipid antigen presentation by CD1d molecules was investigated. It was found that statins significantly impair antigen presentation independent of their lipid-lowering properties, suggesting an important role for prenylation in the control of antigen presentation.

Materials and Methods

Mice

Female C3H/HeJ and C57BL/6 mice were purchased from the Jackson Laboratory (Bar Harbor, ME). All procedures were approved by the Institutional Animal Care and Use Committee of the Indiana University School of Medicine.

Cell lines and other reagents

Murine LMTK-CD1d1 and LMTK-CD1d1-DR4 cells were cultured in DMEM (BioWhittaker, Lonza, MD, USA) supplemented with 10% FBS (Hyclone, Logan, UT), 2 mM glutamine, and 500 μg/ml of G418. Simvastatin (sodium salt), FTI-277 and GGTI-298 were purchased from Calbiochem (San Diego, CA). Mevalonolactone, geranylgeranyl pyrophosphate (GGPP), farnesyl pyrophosphate (FPP) and squalene were obtained from Sigma-Aldrich (St. Louis, MO). The mouse CD1d-specific NKT cell hybridomas DN32.D3, N37-1A12, N38-2C12 and N38-3C3 were cultured in IMDM (BioWhittaker, Lonza, MD, USA) supplemented with 5% FBS and 2 mM L-glutamine. The HLA-DR4-restricted, human serum albumin (HSA)-specific murine T cell hybridoma, 17.9, was a gift from Dr. Janice Blum (Indiana Univ. School of Medicine, Indianapolis, IN). Mouse B cell lymphoma TA3 cells and the I-Ak-restricted, hen egg lysozyme (HEL)-specific T cell hybridoma 3A9 cells were kindly provided by Dr. Gail Bishop (Univ. of Iowa, Iowa City, IA). HEL was obtained from Sigma-Aldrich. Purified and biotinylated mAb specific for murine IL-2 were purchased from BD Biosciences (San Diego, CA). Recombinant mouse IL-2 used as a standard in the ELISA assays was obtained from PeproTech (Rocky Hill, NJ). Antibodies specific for Rho and Ras were purchased from Cell Signaling Technology, Inc. (Beverly, MA); antibodies against Rab5a (Santa Cruz Biotechnology, Santa Cruz, CA), Rab7 (Sigma-Aldrich) and Rab11 (BD Biosciences) were also used in the experiments described below.

Generation of bone marrow-derived dendritic cells (BMDCs)

Bone marrow cells from C3H/HeJ and C57BL/6 mice were cultured in RPMI 1640 supplemented with 2 mM L-glutamine, 50 μM 2-mercaptoethanol, 10% FBS and antibiotics, as well as 10 ng/ml each of murine GM-CSF and IL-4 as previously described (38). On day 7, the plates were gently flushed (3-4 times) to remove the loosely-adherent cells, which were subsequently used in analyses as BMDCs.

siRNA plasmids and stable cell lines

To generate cell lines that stably expressed siRNA targeted against GGTase I, GGTase II, or for the control (non-specific sequence), we used the pSuppressorNeo vector (Imgenex, San Diego, CA). Primers targeting the β subunit of GGTase I or GGTase II were designed using Imgenex’s siRNA retriever program. Primers for GGTase I were forward: 5′-TCGACAGGATAAAGAGGTGGTGCATGGAATTCGATGCACCACCTCTTTCTCCTGTTTTT-3′ and reverse: 5′- CTAGAAAAACAGGATAAAGAGG TGGTGCATCGAATTCCATGCACCACCTCTTTATCCTG-3′. Primers for GGTase II were forward: 5′-TCGACCGAGAAGAAATCCTGGTGTTGGAATTCGAACACCAGGATTTCTTCTCGGTTTTT-3′ and reverse: 5′-CTAGAAAAACCGAGAAGAAATCCTGGTGTTCGAATTCCAACACCAGGATTTCTTCTCGG-3′. Primers for each target were annealed, phosphorylated, and ligated into the pSuppressorNeo vector. A portion of the ligation reaction was used to transform chemically-competent DH5α E. coli. Drug-resistant clones were selected and propagated, and plasmids were isolated and screened using restriction endonuclease digestions for a unique site found in the siRNA primer sequence. Positive clones were sequenced to ensure the correct insert was present. LMTK cells containing CD1d in the pcDNA-zeo (Invitrogen) were transfected with either of the GGTase siRNA plasmids, or control sequence vector only. Cells containing the siRNA vector were selected for using 500 μg/ml G418, and drug-resistant cells were pooled and maintained as stable cell lines for experiments.

Real-time PCR

Total RNA was isolated from 1 × 106 cells using the High Pure RNA Isolation Kit (Roche; Indianapolis, IN). One μg of this RNA was used to generate cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche), using random hexamers. The mixture of primers and template was denatured (10 min at 65°C) prior to the reverse transcription reaction. This cDNA served as the template in real-time PCR reactions. The Univeral Probe method (Roche) was used to determine expression levels. To the FastStart Universal Probe Master Mix (ROX), we added primers for the gene of interest or β-actin (purchased from IDT), cDNA, and one of the Universal Probes. Primers and probes were designed using ProbeFinder version 2.43 for mice. To analyze GGTase I expression, we used Universal Probe #11 with forward: 5′-TGCTTAGCAGGCTTGAGAGC-3′ and reverse: 5′-TTCA GGAACCGCACAGAAG-3′ primers. To analyze GGTase II expression, Universal Probe #67 was used with forward (5′-GCCTATGTTCAGAGCCTACA-3′) and reverse (5′-CACCGCACAAAATGAGAATC-3′) primers. For analysis of β-actin expression, Universal Probe #11 was used with forward (5′-ACTGCTCTGGCTCCTAGCAC-3′) and reverse (5′-CCTGCTTGCTGATCCACAT-3′) primers. Real-time PCR was performed using an Mx3000P (Stratagene) instrument with MxPro software (version 4.01). The following parameters were used: 1 cycle of 95°C for 10 min and 40 cycles of 95°C for 15 sec, then 60°C for 1 min during which time the analysis was done. Results were analyzed using the standard defaults except that the Mx4000 v1.00 to v3.00 algorithm was used for the adaptive baseline. The Ct of each transcript in the different cell lines was obtained. The ΔΔCt method was used with β-actin as the control to calculate changes in expression.

NKT cell co-culture assays

LMTK-CD1d1 cells were treated with various concentrations (0-50 μM) of simvastatin, GGTI-298 (0-10 μM) or FTI-277 (0-10 μM) for 24 h. Cells treated with vehicle only (DMSO) served as the negative control. In a separate set of experiments, cells were treated with simvastatin (50 μM) in the presence or absence of mevalonate (200 and 400 μM) for 24 h or α-GalCer (500 ng/ml for 1 h). The cells were then washed with PBS, fixed in 0.05% paraformaldehyde and co-cultured with the indicated NKT cell hybridomas as described previously (39). In parallel, BMDCs were treated with the indicated concentrations of simvastatin for 24 h, washed, fixed and used in NKT cell assays as above. LMTK-CD1d1 cells transfected with empty vector or GGTase-specific siRNA were also co-cultured with NKT cells as above. LMTK-CD1d1 cells were treated with various doses of β-MCD (0-20 mM) and nystatin (0-20 μg/ml) for 2 h. The cells were washed, fixed and co-cultured with the indicated NKT cell hybridomas as above.

Determination of cellular cholesterol concentration

LMTK-CD1d1 cells, treated with vehicle, simvastatin (25 and 50μM) or AY9944 (10 and 20μM) overnight, were scraped from 6 well plates. The cells (5 × 106) were washed twice with cold phosphate-buffered saline, and centrifuged at 2000 rpm. The pellet was resuspended in 0.5 ml of isopropyl alcohol, sonicated for 3 min and cleared by centrifugation at 10,000 rpm for 10 min. Supernatants were decanted and isopropyl alcohol was evaporated. A volume of 50 μl of isopropyl alcohol was added to each tube to resuspend the material and aliquots were used to measure the cholesterol level using the EnzychromTM assay kit (BioAssay Systems, Hayward, CA) with cholesterol standards used for calibration according to the manufacturer’s instructions.

MHC class II antigen presentation assay

L-CD1d1-DR4 cells (40) were treated with 10 μM of HSA in the presence or absence of different concentrations of simvastatin for 24 h. The cells were then washed with PBS, fixed in paraformaldehyde and co-cultured with the 17.9 T cell hybridoma, with IL-2 production determined as above. Because these L cells also express CD1d1 molecules, an NKT cell co-culture was performed in parallel as a positive control. In other experiments, the murine B cell lymphoma TA3 cell line was treated with vehicle, simvastatin, FTI-277 or GGTI-298 in the presence or absence of 1 mg/ml of HEL and co-cultured with the HEL-specific, I-Ak-restricted 3A9 T cell hybridoma and IL-2 production was measured as above. BMDCs generated from C3H/HeJ mice were treated with LPS (1 μg/ml) overnight. The cells were washed and treated with the indicated concentrations of simvastatin, FTI-277 and GGTI-298 in the presence or absence of HEL. After two washes in PBS, the BMDCs were co-cultured with the 3A9 T cell hybridoma as above.

Cytotoxic T lymphocyte assay

To determine the effect of prenylation inhibition on antigen presentation by MHC class I molecules, MC57G cells were treated with vehicle (DMSO), simvastatin (50 μM), FTI-277 (10 μM) or GGTI-298 (10 μM) overnight and then mock-infected or infected with vaccinia virus (VV; MOI=5) for 6 h in the presence or absence of inhibitors. The cells were washed, fixed and co-cultured for 24 h with splenocytes isolated from C57BL/6 mice on day 6 after a VV infection (1 × 106 pfu/mouse, i.p.). Supernatants were collected to measure the amount of IFN-γ in the co-cultures by ELISA.

Western blotting

LMTK-CD1d1 cells were treated with the indicated concentrations of simvastatin in the presence or absence of mevalonate. The cells were lysed in lysis buffer (25 mM HEPES buffer, pH 7.5, 150 mM NaCl, 1% NP-40, 10% glycerol, 25 mM sodium fluoride, 10 mM MgCl2, 1 mM EDTA, 10 mM sodium orthovanadate, 25 mM β-glycerophosphate), containing Complete® protease inhibitor tablets (Roche Diagnostics, Indianapolis, IN). The amount of protein in cell lysates was estimated using Bio-Rad protein assay reagents (Hercules, CA). Equal amounts of protein were loaded into each well and resolved on a 10% SDS-PAGE gel, and subsequently transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA). The blot was processed with antibodies specific for the indicated proteins and bands developed using chemiluminescence before exposure on film (41).

For assessing the relative distribution of GTPases in statin-treated cells, LMTK-CD1d1 cells were treated with simvastatin in the presence or absence of mevalonate. Cells were lysed in sucrose-containing HEPES buffer (200 mM sucrose, 20 mM HEPES, 1.5 mM MgCl2, 10 mM KCl, 1 mM EGTA, mM EDTA, 0.1 mM PMSF and Complete® protease inhibitor tablets) on ice for 15 min. The lysates were clarified by centrifugation at 1000 rpm for 5 min at 4°C. The resulting supernatant was centrifuged at 30,000 rpm at 4°C for 30 min. The resulting supernatant was then removed (cytosolic fraction) and the membrane pellet was washed in sucrose-containing HEPES buffer by centrifugation at 30,000 rpm for 30 min. Equal amounts of protein were loaded into each well and were resolved on a 10% SDS-PAGE gel, and transferred to a PVDF membrane. The blots were probed with antibodies specific for the individual GTPases, as well as markers for the cytosolic (GAPDH) and membrane (flotillin) fractions, and developed as above.

Confocal microscopy

LMTK-CD1d1 cells were plated in sterile glass-bottom 35 mm dishes coated with collagen (MatTek, Ashland, MA) at a density of 1×106 cells per dish. Cells were treated with the indicated concentrations of GGTI-298, FTI-277, AY9944 or simvastatin with or without mevalonate for 24 h at 37°C. The cells were stained for CD1d and lysosome-associated membrane protein 1 (LAMP-1) followed by Texas Red- and FITC-conjugated secondary antibodies, and then analyzed by confocal microscopy as previously described (39, 40). The percent co-localization of CD1d and LAMP-1 was determined using MetaMorph software (Version 5; Molecular Devices, Sunnyvale, CA), in which six random fields were chosen from each picture.

Statistical analysis

The data were analyzed by a one way ANOVA and unpaired two-tailed Student’s t-test using GraphPad PRISM software (version 5.0 for Windows; GraphPad, San Diego, CA). A P value below 0.05 was considered significant. The error bars in the bar graphs show the standard deviation from the mean of triplicate samples.

Results

Statin-induced inhibition of CD1d-mediated antigen presentation is prenylation-dependent

In order to determine if prenylation is important for CD1d-mediated antigen presentation, murine LMTK-CD1d1 fibroblasts were treated with various concentrations of the statin simvastatin for 24 h and co-cultured with NKT cells. LMTK-CD1d1 cells treated with simvastatin showed a dose-dependent reduction in the stimulation of NKT cells, with an almost 50-60% decrease in antigen presentation at the highest concentration used, as compared to vehicle-treated cells (Fig. 2A). To ensure that the effect of prenylation inhibition on CD1d-mediated antigen presentation could be observed in primary antigen presenting cells, bone marrow-derived dendritic cells (BMDCs) were treated with different concentrations of simvastatin as above. As found with LMTK-CD1d1 cells, simvastatin treatment of BMDCs also caused a substantial reduction in antigen presentation by CD1d (Fig. 2B). Simvastatin did not alter CD1d cell surface expression on either LMTK-CD1d1 or BMDCs (Supplementary Figs. 1A, B). Nonetheless, inhibiting prenylation could have caused some qualitative changes in the functional expression of CD1d molecules. To test this possibility, simvastatin-pretreated LMTK-CD1d1 cells were incubated with the CD1d-specific ligand α-galactosylceramide (α-GalCer) to determine if there was an effect on exogenous antigen presentation. As expected, α-GalCer substantially enhanced the stimulation of Vα14+ (e.g., DN32.D3), but not Vα14− (e.g., N37-1A12) NKT cells. Interestingly, simvastatin-treated LMTK-CD1d1 cells could not stimulate NKT cells to the same extent as vehicle-treated cells in the presence of α-GalCer (Fig. 1C). Therefore, these results suggest that simvastatin treatment impairs both endogenous and exogenous lipid antigen presentation.

FIGURE 2.

FIGURE 2

Simvastatin inhibits antigen presentation by CD1d in a cholesterol-independent manner. A, LMTK-CD1d1 cells were treated with the indicated concentrations of simvastatin for 24 h, washed, fixed and co-cultured with the indicated NKT cell hybridomas. *, P<0.05 as compared to vehicle. B, BMDCs were treated with vehicle (DMSO) or simvastatin and co-cultured with NKT cell hybridomas as in A. *, P<0.05 as compared to vehicle. C, LMTK-CD1d1 cells were treated with vehicle or simvastatin (25 and 50 μM) for 24 h. The cells were then washed and treated with the CD1d-specific ligand α-GalCer (500 ng/ml) for 1 h and co-cultured as above. *, P<0.05 as compared to vehicle; **, P<0.05 as compared to simvastatin. D, LMTK-CD1d1 cells were treated with the indicated concentrations of the cholesterol biosynthesis inhibitor AY9944 for 24 h. The cells were washed and co-cultured with the NKT hybridomas as above. *, P<0.05 as compared to vehicle.

To determine whether simvastatin affected CD1d-mediated antigen presentation through its effects on cholesterol biosynthesis, LMTK-CD1d1 cells were treated with a highly specific inhibitor of cholesterol biosynthesis, AY9944. Notably, whereas AY9944 did not alter antigen presentation by CD1d molecules even at the highest concentration used (Fig. 2D), it did substantially inhibit cholesterol biosynthesis (Supplementary Fig. 2A). Moreover, treatment of LMTK-CD1d1 cells with cholesterol-depleting agents such as nystatin and β-methyl cyclodextrin (β-MCD) had only a modest effect on CD1d-mediated antigen presentation (Supplemental Fig. 2B, C). The latter results of β-MCD are in line with those recently reported (42). However, it is important to note that β-MCD concentrations above 10 mM are toxic (data not shown).

Mevalonate reverses simvastatin-induced inhibition of CD1d-mediated antigen presentation

Mevalonate, the precursor for the biosynthesis of cholesterol and isoprenoids, is considered a therapeutic target for autoimmune diseases (15, 43). Simvastatin inhibits the biosynthesis of mevalonate by inhibiting the enzyme HMG-CoA reductase. Thus, to determine whether the simvastatin-induced inhibition of CD1d-mediated antigen presentation was mevalonate pathway-dependent, exogenous mevalonate was added to simvastatin-treated CD1d+ cells. Although exogenous mevalonate was able to substantially reverse the effect of simvastatin on CD1d-mediated antigen presentation (Fig. 3A), this approach could not distinguish between whether simvastatin impaired antigen presentation by inhibiting lipid biosynthesis or by isoprenylation (or both). To address this question, LMTK-CD1d1 cells were treated with simvastatin in the presence or absence of the geranylgeranylation precursor, geranylgeranyl pyrophosphate (GGPP), farnesylation precursor farnesyl pyrophosphate (FPP) or the cholesterol biosynthesis precursor squalene. The addition of GGPP, but not FPP, significantly reversed the inhibitory effects of simvastatin on CD1d-mediated antigen presentation (Fig. 3B, C). In contrast, squalene had no effect (Fig. 3D). These results strongly suggest that the simvastatin-induced inhibition of antigen presentation by CD1d is solely prenylation-dependent.

FIGURE 3.

FIGURE 3

Mevalonate and GGPP (but not FPP or squalene) reverse simvastatin-induced inhibition of CD1d-mediated antigen presentation. LMTK-CD1d1 cells were treated for 24 h with A, vehicle or simvastatin (50 μM) in the presence or absence of mevalonate (200 and 400 μM): *, P<0.05 as compared to vehicle; **, P<0.05 as compared to simvastatin. B, GGPP (10 and 25 μM): *, P<0.05 as compared to vehicle; **, P<0.05 as compared to simvastatin. C, FPP (10 and 25 μM): *, P<0.05 as compared to vehicle. D, Squalene (SQL; 10 and 25 μM). The cells were then co-cultured with the indicated NKT cell hybridomas as above. *, P<0.05 as compared to vehicle.

The inhibition of geranylgeranylation alters CD1d-mediated antigen presentation

To further investigate the role of prenylation in the simvastatin-induced inhibition of CD1d-mediated antigen presentation, BMDCs were treated with simvastatin, the farnesylation-specific inhibitor FTI-277, or geranylgeranylation-specific inhibitor GGTI-298 for 24 h. CD1d-mediated antigen presentation was significantly reduced in cells treated with simvastatin or GGTI-298, whereas FTI-277 treatment had only a modest effect (Fig. 4A). Neither of the inhibitors altered the cell surface expression of CD1d molecules (data not shown). Geranylgeranylation is controlled by two enzymes: GGTase I and GGTase II (44). To determine whether GGTase I and/or GGTase II can regulate CD1d-mediated antigen presentation, the activity of these enzymes was reduced using an RNAi system. Consistent with the GGTI-298 treatment above (Fig. 3A), LMTK-CD1d1 cells transfected with RNAi for either GGTase I, or GGTase II in particular, were impaired in their antigen presentation ability (Fig. 4B).

FIGURE 4.

FIGURE 4

Inhibition of geranylgeranyl (but not farnesyl) transferase activity substantially impairs CD1d-mediated antigen presentation. LMTK-CD1d1 cells were treated for 24 h with the indicated concentrations of the geranylgeranyl transferase inhibitor GGTI-298 (a) or farnesyl transferase inhibitor FTI-277 (b) and co-cultured with NKT cell hybridomas; *, P<0.05 as compared to vehicle. (c) BMDCs were treated with vehicle or the indicated concentrations of simvastatin, GGTI-298 or FTI-277 for 24 h and co-cultured with the indicated NKT cell hybridomas. *, P<0.05 as compared to vehicle. (d) LMTK-CD1d1 cells transfected with control or GGTase I and II-specific siRNA-expressing vectors were co-cultured with NKT cell hybridomas as above. *, P<0.05 as compared to vehicle.

Inhibition of prenylation impairs MHC II- (but not MHC class I)-mediated antigen presentation

Like CD1d molecules, MHC class II molecules traffic through late endocytic compartments (19), and statins have been shown to also affect antigen presentation by the latter pathway (36, 37), although the role of prenylation was not studied. Thus, to determine whether the inhibition of prenylation alters MHC class II-mediated antigen presentation under the same conditions as observed with CD1d, HLA-DR4-transfected LMTK-CD1d1 (L-CD1d-DR4) cells (40) were treated with human serum albumin (HSA) in the presence or absence of simvastatin and co-cultured with the HLA-DR-restricted, HSA-specific T cell hybridoma 17.9. These same cells were co-cultured with NKT cell hybridomas as a control side-by-side. MHC class II-mediated antigen presentation was reduced in a concentration-dependent manner without a change in cell surface MHC II molecule expression (Fig. 5A and data not shown), similar to that observed with CD1d. Statins have been shown to reduce the cell surface expression of induced (e.g., by CD40 ligation or IFN-γ) MHC class II molecules, whereas the constitutive expression of MHC class II was found to be unaltered (36, 37, 45). For the current study, the effect of prenylation inhibitors on murine MHC class II (I-Ak)-mediated antigen presentation was also determined by treating the mouse B cell lymphoma TA3 or BMDCs from C3H/HeJ (H-2k) mice in the presence or absence of hen egg lysozyme with different concentrations of simvastatin, FTI-277 or GGTI-298. Simvastatin and GGTI-298 caused a significant reduction in MHC class II-mediated antigen presentation, whereas FTI-277 had only a modest effect in TA3 cells (Fig. 5B) and BMDCs (Fig. 5C). Therefore, these results suggest that under similar conditions that reduce antigen presentation by CD1d, statins also alter MHC class II-mediated antigen presentation by targeting the geranylgeranylation pathway.

FIGURE 5.

FIGURE 5

Simvastatin inhibits antigen presentation by MHC class II (but not MHC class I) molecules. (a) L-CD1d-DR4 cells were treated with the indicated concentrations of simvastatin for 24 h in the presence or absence of HSA (10 μM). The cells were then washed, fixed and co-cultured with the 17.9 T cell hybridoma at a T cell:APC ratio of 2:1 for 24 h. (b) Murine TA3 (I-Ak) or (c) C3H/HeJ BMDCs were treated with the indicated concentrations of simvastatin, GGTI-298 or FTI-277 in the presence or absence of HEL (1 mg/ml) for 24 h. The cells were washed, fixed and co-cultured with the 3A9 T cell hybridoma as in (a). The level of IL-2 in the supernatant was measured by ELISA. (d) Effect of prenylation inhibition on MHC class I-mediated antigen presentation. Murine MC57G cells (treated with vehicle or the indicated inhibitors) were mock- or VV-infected for 6 h, fixed and then co-cultured with VV-specific CTL overnight. IFN-γ production was measured by ELISA. Mock-infected (●); lactacystin (■); GGTI-298 (▲); FTI-277 (▼); vehicle (◆); simvastatin (○).

CD1d molecules are structurally similar to MHC class I molecules (19). Therefore, it was also important to know whether prenylation inhibition alters antigen presentation by MHC class I. To address this question, murine MC57G fibroblasts were treated with vehicle, simvastatin, GGTI-298 or FTI-277 overnight. The cells were mock-infected or infected with vaccinia virus (VV) for 6 h in the presence or absence of prenylation inhibitors. The cells were then washed, fixed and co-cultured with splenocytes from C57BL/6 mice infected 6 days previously with VV as a source of VV-specific CTLs. The production of IFN-γ was used as a measure of VV-specific T cell recognition. Although inhibiting prenylation had no effect on antigen presentation by MHC class I molecules, as expected, the proteosomal inhibitor lactacystin caused a significant reduction (Fig. 5D).

Intracellular distribution of CD1d is altered in cells following prenylation inhibition

As the inhibition of prenylation caused a reduction in CD1d-mediated antigen presentation without altering its cell surface level, this effect might have been due to intracellular changes caused by preventing prenylation. Thus, LMTK-CD1d1 cells were treated with simvastatin, FTI-277, GGTI-298, or the cholesterol biosynthesis inhibitor AY9944, and co-localization of CD1d with the late endosome/lysosome marker LAMP-1 was analyzed by confocal microscopy. A significant decrease in the co-localization of CD1d and LAMP-1 was observed in cells treated with either simvastatin or GGTI-298 (Fig. 5), whereas exposure to FTI-277 or AY9944 had no effect. In agreement with our NKT cell assay results, when cells were treated with simvastatin in the presence of mevalonate, there was a recovery in CD1d/LAMP-1 co-localization (Fig. 5). These data suggest that alterations in CD1d intracellular trafficking following inhibition of prenylation substantially impair antigen presentation by CD1d molecules.

Discussion

The widespread clinical use of statins has decreased the rate of morbidity and mortality of persons suffering from cardiovascular diseases. Besides their lipid-lowering effects, statins also improve or restore endothelial function by decreasing inflammation and enhancing the stability of atherosclerotic plaques (45). In addition, statins also regulate prenylation and are immunomodulatory (6). For example, statins promote Th2 polarization and inhibit Th1 development, resulting in reduced inflammation in various model systems (46). Thus, these drugs have an advantage over other cholesterol-lowering agents in the treatment of cardiovascular disease, where inflammation plays a critical role in its progression. In the current study, inhibiting cholesterol did not reduce antigen presentation by CD1d. Further, squalene, a cholesterol precursor, was not able to reverse the inhibition of CD1d-mediated antigen presentation by simvastatin. This suggests that the ability of simvastatin and other statins to regulate antigen presentation by CD1d is independent of their effects on cholesterol biosynthesis. Besides cholesterol, other pathways targeted by statins are those that regulate the supply of isoprenoids, particularly farnesyl pyrophosphate and geranylgeranyl pyrophosphate (7). In the context of antigen presentation by CD1d, we found that inhibition of geranylgeranylation, but not farnesylation, significantly impaired CD1d- (and MHC class II)-mediated antigen presentation. Statins alter the prenylation of specific GTPases (47) (Supplementary Fig. 3), important for the trafficking of molecules through the endocytic pathway. Prior studies have shown that Rho and Rab GTPases can regulate intracellular trafficking of a variety of proteins and the efficiency of antigen processing and presentation within various endocytic compartments in dendritic cells and B cells (49, 50). Thus, inhibiting the prenylation of these GTPases may have contributed to the altered trafficking of antigen presenting molecules (i.e., both CD1d and MHC class II) through endocytic compartments and consequent effects on antigen presentation (19). Our observation that either simvastatin or GGTI-298 can affect the intracellular localization of CD1d is consistent with idea.

Atherosclerosis is an immuno-inflammatory disease of arterial walls where both innate and adaptive immune responses contribute to disease development and progression (22). Oxidized low-density lipoprotein (LDL) is a major cause of injury in atherosclerosis and adaptive immune responses to oxidized LDL contribute to the development of the disease. Lipid and peptide antigens derived from oxidized LDL bind to CD1d and MHC class II molecules to activate pro-inflammatory T cells (48). A reduction in antigen presentation by either of these pathways results in diminished atherosclerosis. NKT cells have been implicated as proatherogenic in a mouse model of atherosclerosis (49). Furthermore, CD1d-expressing vascular dendritic cells have been found to be in association with NKT cells in atherosclerotic plaques (31). Some DCs interact with T cells within atherosclerotic lesions, whereas others appear to migrate to regional lymph nodes and activate mainstream T cells (50). Such T cell activation requires a transition of DCs from immature to mature forms. In healthy arterial walls, DCs are in their immature form, whereas in atherosclerotic lesions, DCs express high levels of HSP70 that contribute to their activation and maturation (51). NKT cells appear to play a greater role in the progression of atherosclerosis due to their activation by both immature and mature DCs (20). The results of the present study show that the inhibition of prenylation reduces both CD1d- and MHC class II-mediated antigen presentation. Thus, one mode of the anti-atherosclerotic action of statins, in addition to their cholesterol-lowering activity, may be through their inhibitory effect on proinflammatory antigen presentation pathways mediated by both CD1d and MHC class II molecules. In line with this, it is notable that the adoptive transfer of NKT cells or their activation by the CD1d-specific ligand α-GalCer, aggravates disease in mouse models of atherosclerosis (22). The present study shows that inhibition of prenylation modulates the effector activity of NKT cells by impairing lipid antigen presentation by CD1d.

How might this translate in vivo? In addition to its well known LDL-lowering properties, simvastatin is not very bioavailable upon oral administration due to its poor absorption (52), despite showing beneficial effects through immune-mediated mechanisms (53, 54). Further, altering antigen presentation by this class of cholesterol-lowering drugs may lead to somewhat increased susceptibility of statin-treated patients to various pathogens, particularly virus infections (3). Therefore, under some conditions, the long term use of statins may contribute to the impairment of both innate and adaptive immune responses, with consequent effects; such treated patients would simply need to be monitored more closely.

Supplementary Material

Suppl. Fig. 1

Simvastatin does not alter the cell surface expression of CD1d. LMTK-CD1d1 (A) and BMDCs (B) were treated with various concentrations of simvastatin for 24 h. The cells were then washed and stained with a PE-conjugated isotype control or anti-CD1d antibody (1B1) for 30 min at ice. The cells were washed and fixed in 1% paraformaldehyde for 15 min on ice before FACS analysis. Open histogram: isotype control. Filled histogram: anti-CD1d.

Suppl. Fig. 2

Cholesterol-depletion does not alter CD1d-mediated antigen presentation.A, LMTK-CD1d1 cells were treated with vehicle (DMSO), simvastatin (25 and 50 μM) or a specific inhibitor of cholesterol biosynthesis, AY9944 (10 and 20 μM) for 24 h. The cells were lysed and the total level of cholesterol was quantitated. LMTK-CD1d1 cells were treated or untreated with various concentrations of (B) β-methyl cyclodextrin (β-MCD) or (C) nystatin for 4 h. The cells were then washed and co-cultured with the indicated NKT cell hybridomas.

Suppl. Fig. 3

Effects of simvastatin on prenylation in LMTK-CD1d1 cells and its reversal by mevalonate. A, LMTK-CD1d1 cells were treated with simvastatin (50 μM) in the presence or absence of mevalonate (200 and 400 μM) and the prenylation of the indicated Rab GTPases and Ras proteins was analyzed by Western blot. Lane 1 (vehicle); Lane 2 (Mevalonate-200 μM); Lane 3 (Mevalonate-400 μM); Lane 4 (Simvastatin-50 μM); Lane 5 (Simvastatin + Mevalonate-200 μM); Lane 6 (Simvastatin + Mevalonate-400 μM). Lane 4 in (a) shows slower migration of the respective bands, indicative of prenylation inhibition. B and C: LMTK-CD1d1 cells were treated with simvastatin (25 and 50 μM) in the presence or absence of mevalonate (400 μM). The cytosolic (B) and membrane (C) fractions were analyzed for the presence of Rho, Rab5 and Ras by Western blot. GAPDH served as a control cytosolic protein, whereas flotillin was the control membrane protein used. Lanes: 1. Vehicle, 2. Mevalonate-400 μM, 3. Simvastatin-25 μM, 4. Simvastatin-25 + Mev-400, 5. Simvastatin-50 μM, 6. Simvastatin-50 + Mev-400.

FIGURE 6.

FIGURE 6

Altered intracellular localization of CD1d induced by simvastatin is reversed by mevalonate. LMTK-CD1d1 cells were treated with vehicle (DMSO), simvastatin (50 μM), mevalonate (400 μM), simvastatin + mevalonate, GGTI-298 (10 μM), FTI-277 (μM) or AY9944 (10 μM). The cells were then washed, fixed and stained for CD1d (green) and LAMP-1 (red) and analyzed by confocal microscopy (a). Six random fields were chosen to calculate the percent co-localization (b). *, P<0.05 as compared to vehicle; **, P<0.05 as compared to simvastatin.

ACKNOWLEDGEMENTS

We would like to thank Gail Bishop for the 3A9 and TA3 cells, Janice Blum for the 17.9 T cell hybridoma, Wen Tao and Janardhan Sampath for their advice and help with the RT-PCR, and Keith March for helpful discussions.

Abbreviations used in this paper

BMDCs

bone marrow-derived dendritic cells

FTI-277

farnesyl transferase inhibitor

GGTI-298

geranylgeranyl transferase inhibitor

FPP

farnesyl pyrophosphate

GGPP

geranylgeranyl pyrophosphate

β-MCD

β-methyl cyclodextrin

NKT

natural killer T

LAMP-1

lysosome-associated membrane protein 1

Footnotes

1

This work was supported by National Institutes of Health grants RO1 AI46455 and PO1 AI056097 (to R.R.B.), and NSF CHE-0194682 from the National Science Foundation (to J.G.H.). G.J.R. and R.M.G. were supported by NIH training grants T32 DK007519 and T32HLO7910, respectively.

Disclosures

There are no financial conflicts of interest by any of the authors.

References

  • 1.Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature. 1990;343:425–430. doi: 10.1038/343425a0. [DOI] [PubMed] [Google Scholar]
  • 2.Arnaud C, Veillard NR, Mach F. Cholesterol-independent effects of statins in inflammation, immunomodulation and atherosclerosis. Curr. Drug Targets. 2005;5:127–134. doi: 10.2174/1568006043586198. [DOI] [PubMed] [Google Scholar]
  • 3.Goldstein MR, Mascitelli L, Pezzetta F. The double-edged sword of statin immunomodulation. Int. J. Cardiol. 2008 doi: 10.1016/j.ijcard.2008.01.023. In Press. [DOI] [PubMed] [Google Scholar]
  • 4.Wierzbicki AS, Poston R, Ferro A. The lipid and non-lipid effects of statins. Pharmacol. Ther. 2003;99:95–112. doi: 10.1016/s0163-7258(03)00055-x. [DOI] [PubMed] [Google Scholar]
  • 5.Yoshida M. Potential role of statins in inflammation and atherosclerosis. J. Atheroscl. Thromb. 2003;10:140–144. doi: 10.5551/jat.10.140. [DOI] [PubMed] [Google Scholar]
  • 6.Liao JK, Laufs U. Pleiotropic effects of statins. Annu. Rev. Pharmacol. Toxicol. 2005;45:89–118. doi: 10.1146/annurev.pharmtox.45.120403.095748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhang FL, Casey PJ. Protein prenylation: molecular mechanisms and functional consequences. Annu. Rev. Biochem. 1996;65:241–269. doi: 10.1146/annurev.bi.65.070196.001325. [DOI] [PubMed] [Google Scholar]
  • 8.Bifulco M. Role of the isoprenoid pathway in ras transforming activity, cytoskeleton organization, cell proliferation and apoptosis. Life Sci. 2005;77:1740–1749. doi: 10.1016/j.lfs.2005.05.017. [DOI] [PubMed] [Google Scholar]
  • 9.Konstantinopoulos PA, Karamouzis MV, Papavassiliou AG. Post-translational modifications and regulation of the RAS superfamily of GTPases as anticancer targets. Nat. Rev. Drug Discov. 2007;6:541–555. doi: 10.1038/nrd2221. [DOI] [PubMed] [Google Scholar]
  • 10.Cordle A, Koenigsknecht-Talboo J, Wilkinson B, Limpert A, Landreth G. Mechanisms of statin-mediated inhibition of small G-protein function. J. Biol. Chem. 2005;280:34202–34209. doi: 10.1074/jbc.M505268200. [DOI] [PubMed] [Google Scholar]
  • 11.Kuipers HF, van den Elsen PJ. Immunomodulation by statins: inhibition of cholesterol vs. isoprenoid biosynthesis. Biomed. Pharmacother. 2007;61:400–407. doi: 10.1016/j.biopha.2007.06.005. [DOI] [PubMed] [Google Scholar]
  • 12.Niessner A, Steiner S, Speidl WS, Pleiner J, Seidinger D, Maurer G, Goronzy JJ, Weyand CM, Kopp CW, Huber K, Wolzt M, Wojta J. Simvastatin suppresses endotoxin-induced upregulation of toll-like receptors 4 and 2 in vivo. Atherosclerosis. 2006;189:408–413. doi: 10.1016/j.atherosclerosis.2005.12.022. [DOI] [PubMed] [Google Scholar]
  • 13.Ghittoni R, Patrussi L, Pirozzi K, Pellegrini M, Lazzerini PE, Capecchi PL, Pasini FL, Baldari CT. Simvastatin inhibits T-cell activation by selectively impairing the function of Ras superfamily GTPases. FASEB J. 2005;19:605–607. doi: 10.1096/fj.04-2702fje. [DOI] [PubMed] [Google Scholar]
  • 14.Yilmaz A, Reiss C, Tantawi O, Weng A, Stumpf C, Raaz D, Ludwig J, Berger T, Steinkasserer A, Daniel WG, Garlichs CD. HMG-CoA reductase inhibitors suppress maturation of human dendritic cells: new implications for atherosclerosis. Atherosclerosis. 2004;172:85–93. doi: 10.1016/j.atherosclerosis.2003.10.002. [DOI] [PubMed] [Google Scholar]
  • 15.Greenwood J, Steinman L, Zamvil SS. Statin therapy and autoimmune disease: from protein prenylation to immunomodulation. Nat. Rev. Immunol. 2006;6:358–370. doi: 10.1038/nri1839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Martin-Ventura JL, Blanco-Colio LM, Gomez-Hernandez A, Munoz-Garcia B, Vega M, Serrano J, Ortega L, Hernandez G, Tunon J, Egido J. Intensive treatment with atorvastatin reduces inflammation in mononuclear cells and human atherosclerotic lesions in one month. Stroke. 2005;36:1796–1800. doi: 10.1161/01.STR.0000174289.34110.b0. [DOI] [PubMed] [Google Scholar]
  • 17.Bustos C, Hernandez-Presa MA, Ortego M, Tunon J, Ortega L, Perez F, Diaz C, Hernandez G, Egido J. HMG-CoA reductase inhibition by atorvastatin reduces neointimal inflammation in a rabbit model of atherosclerosis. J. Am. Coll. Cardiol. 1998;32:2057–2064. doi: 10.1016/s0735-1097(98)00487-2. [DOI] [PubMed] [Google Scholar]
  • 18.Hillyard DZ, Nutt CD, Thomson J, McDonald KJ, Wan RK, Cameron AJ, Mark PB, Jardine AG. Statins inhibit NK cell cytotoxicity by membrane raft depletion rather than inhibition of isoprenylation. Atherosclerosis. 2007;191:319–325. doi: 10.1016/j.atherosclerosis.2006.05.037. [DOI] [PubMed] [Google Scholar]
  • 19.Brutkiewicz RR, Lin Y, Cho S, Hwang YK, Sriram V, Roberts TJ. CD1d-mediated antigen presentation to natural killer T (NKT) cells. Crit. Rev. Immunol. 2003;23:403–419. doi: 10.1615/critrevimmunol.v23.i56.30. [DOI] [PubMed] [Google Scholar]
  • 20.Van Kaer L. NKT cells: T lymphocytes with innate effector functions. Curr. Opin. Immunol. 2007;19:354–364. doi: 10.1016/j.coi.2007.03.001. [DOI] [PubMed] [Google Scholar]
  • 21.Brutkiewicz RR. CD1d ligands: the good, the bad, and the ugly. J. Immunol. 2006;177:769–775. doi: 10.4049/jimmunol.177.2.769. [DOI] [PubMed] [Google Scholar]
  • 22.Tupin E, Nicoletti A, Elhage R, Rudling M, Ljunggren HG, Hansson GK, Berne GP. CD1d-dependent activation of NKT cells aggravates atherosclerosis. J. Exp. Med. 2004;199:417–422. doi: 10.1084/jem.20030997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Robertson AK, Hansson GK. T cells in atherogenesis: for better or for worse? Arterioscl. Thromb. Vasc. Biol. 2006;26:2421–2432. doi: 10.1161/01.ATV.0000245830.29764.84. [DOI] [PubMed] [Google Scholar]
  • 24.Galkina E, Ley K. Leukocyte influx in atherosclerosis. Curr. Drug Target. 2007;8:1239–1248. doi: 10.2174/138945007783220650. [DOI] [PubMed] [Google Scholar]
  • 25.Mercer JC, Ragin MJ, August A. Natural killer T cells: rapid responders controlling immunity and disease. Int. J. Biochem. Cell Biol. 2005;37:1337–1343. doi: 10.1016/j.biocel.2004.11.019. [DOI] [PubMed] [Google Scholar]
  • 26.Chan WL, Pejnovic N, Liew TV, Lee CA, Groves R, Hamilton H. NKT cell subsets in infection and inflammation. Immunol. Lett. 2003;85:159–163. doi: 10.1016/s0165-2478(02)00223-7. [DOI] [PubMed] [Google Scholar]
  • 27.Yilmaz A, Lochno M, Traeg F, Cicha I, Reiss C, Stumpf C, Raaz D, Anger T, Amann K, Probst T, Ludwig J, Daniel WG, Garlichs CD. Emergence of dendritic cells in rupture-prone regions of vulnerable carotid plaques. Atherosclerosis. 2004;176:101–110. doi: 10.1016/j.atherosclerosis.2004.04.027. [DOI] [PubMed] [Google Scholar]
  • 28.Rogers L, Burchat S, Gage J, Hasu M, Thabet M, Wilcox L, Ramsamy TA, Whitman SC. Deficiency of invariant Vα14 natural killer T cells decreases atherosclerosis in LDL receptor null mice. Cardiovasc. Res. 2008;78:167–174. doi: 10.1093/cvr/cvn005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.VanderLaan PA, Reardon CA, Sagiv Y, Blachowicz L, Lukens J, Nissenbaum M, Wang CR, Getz GS. Characterization of the natural killer T-cell response in an adoptive transfer model of atherosclerosis. Am. J. Pathol. 2007;170:1100–1107. doi: 10.2353/ajpath.2007.060188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nakai Y, Iwabuchi K, Fujii S, Ishimori N, Dashtsoodol N, Watano K, Mishima T, Iwabuchi C, Tanaka S, Bezbradica JS, Nakayama T, Taniguchi M, Miyake S, Yamamura T, Kitabatake A, Joyce S, Van Kaer L, Onoe K. Natural killer T cells accelerate atherogenesis in mice. Blood. 2004;104:2051–2059. doi: 10.1182/blood-2003-10-3485. [DOI] [PubMed] [Google Scholar]
  • 31.Bobryshev YV, Lord RS. Co-accumulation of dendritic cells and natural killer T cells within rupture-prone regions in human atherosclerotic plaques. J. Histochem. Cytochem. 2005;53:781–785. doi: 10.1369/jhc.4B6570.2005. [DOI] [PubMed] [Google Scholar]
  • 32.Melian A, Geng YJ, Sukhova GK, Libby P, Porcelli SA. CD1 expression in human atherosclerosis. A potential mechanism for T cell activation by foam cells. Am. J. Pathol. 1999;155:775–786. doi: 10.1016/S0002-9440(10)65176-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chan WL, Pejnovic N, Hamilton H, Liew TV, Popadic D, Poggi A, Khan SM. Atherosclerotic abdominal aortic aneurysm and the interaction between autologous human plaque-derived vascular smooth muscle cells, type 1 NKT, and helper T cells. Circulation Res. 2005;96:675–683. doi: 10.1161/01.RES.0000160543.84254.f1. [DOI] [PubMed] [Google Scholar]
  • 34.Libby P, Aikawa M. Mechanisms of plaque stabilization with statins. Am J. Cardiol. 2003;91:4B–8B. doi: 10.1016/s0002-9149(02)03267-8. [DOI] [PubMed] [Google Scholar]
  • 35.Dilaveris P, Giannopoulos G, Riga M, Synetos A, Stefanadis C. Beneficial effects of statins on endothelial dysfunction and vascular stiffness. Curr. Vasc. Pharmacol. 2007;5:227–237. doi: 10.2174/157016107781024091. [DOI] [PubMed] [Google Scholar]
  • 36.Ghittoni R, Napolitani G, Benati D, Ulivieri C, Patrussi L, Laghi Pasini F, Lanzavecchia A, Baldari CT. Simvastatin inhibits the MHC class II pathway of antigen presentation by impairing Ras superfamily GTPases. Eur. J. Immunol. 2006;36:2885–2893. doi: 10.1002/eji.200636567. [DOI] [PubMed] [Google Scholar]
  • 37.Shimabukuro-Vornhagen A, Liebig T, von Bergwelt-Baildon M. Statins inhibit human APC function: implications for the treatment of GVHD. Blood. 2008;112:1544–1545. doi: 10.1182/blood-2008-04-149609. [DOI] [PubMed] [Google Scholar]
  • 38.Brutkiewicz RR, Willard CA, Gillett-Heacock KK, Pawlak MR, Bailey JC, Khan MA, Nagala M, Du W, Gervay-Hague J, Renukaradhya GJ. Protein kinase C δ is a critical regulator of CD1d-mediated antigen presentation. Eur. J. Immunol. 2007;37:2390–2395. doi: 10.1002/eji.200737124. [DOI] [PubMed] [Google Scholar]
  • 39.Roberts TJ, Sriram V, Spence PM, Gui M, Hayakawa K, Bacik I, Bennink JR, Yewdell JW, Brutkiewicz RR. Recycling CD1d1 molecules present endogenous antigens processed in an endocytic compartment to NKT cells. J. Immunol. 2002;168:5409–5414. doi: 10.4049/jimmunol.168.11.5409. [DOI] [PubMed] [Google Scholar]
  • 40.Sriram V, Cho S, Li P, O’Donnell PW, Dunn C, Hayakawa K, Blum JS, Brutkiewicz RR. Inhibition of glycolipid shedding rescues recognition of a CD1+ T cell lymphoma by natural killer T (NKT) cells. Proc. Natl. Acad. Sci. USA. 2002;99:8197–8202. doi: 10.1073/pnas.122636199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Renukaradhya GJ, Webb TJ, Khan MA, Lin YL, Du W, Gervay-Hague J, Brutkiewicz RR. Virus-induced inhibition of CD1d1-mediated antigen presentation: reciprocal regulation by p38 and ERK. J. Immunol. 2005;175:4301–4308. doi: 10.4049/jimmunol.175.7.4301. [DOI] [PubMed] [Google Scholar]
  • 42.Roy KC, Maricic I, Khurana A, Smith TR, Halder RC, Kumar V. Involvement of secretory and endosomal compartments in presentation of an exogenous self-glycolipid to type II NKT cells. J. Immunol. 2008;180:2942–2950. doi: 10.4049/jimmunol.180.5.2942. [DOI] [PubMed] [Google Scholar]
  • 43.Buhaescu I, Izzedine H. Mevalonate pathway: a review of clinical and therapeutical implications. Clin. Biochem. 2007;40:575–584. doi: 10.1016/j.clinbiochem.2007.03.016. [DOI] [PubMed] [Google Scholar]
  • 44.Lane KT, Beese LS. Thematic review series: lipid posttranslational modifications. Structural biology of protein farnesyltransferase and geranylgeranyltransferase type I. J. Lipid Res. 2006;47:681–699. doi: 10.1194/jlr.R600002-JLR200. [DOI] [PubMed] [Google Scholar]
  • 45.Liao JK. Statin therapy: having the good without the bad. Hypertension. 2004;43:1171–1172. doi: 10.1161/01.HYP.0000126153.80112.5c. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hakamada-Taguchi R, Uehara Y, Kuribayashi K, Numabe A, Saito K, Negoro H, Fujita T, Toyo-oka T, Kato T. Inhibition of hydroxymethylglutaryl-coenzyme a reductase reduces Th1 development and promotes Th2 development. Circulation Res. 2003;93:948–956. doi: 10.1161/01.RES.0000101298.76864.14. [DOI] [PubMed] [Google Scholar]
  • 47.Ostrowski SM, Wilkinson BL, Golde TE, Landreth G. Statins reduce amyloid-β production through inhibition of protein isoprenylation. J. Biol. Chem. 2007;282:26832–26844. doi: 10.1074/jbc.M702640200. [DOI] [PubMed] [Google Scholar]
  • 48.Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N. Engl. J. Med. 2005;352:1685–1695. doi: 10.1056/NEJMra043430. [DOI] [PubMed] [Google Scholar]
  • 49.Major AS, Singh RR, Joyce S, Van Kaer L. The role of invariant natural killer T cells in lupus and atherogenesis. Immunol. Res. 2006;34:49–66. doi: 10.1385/ir:34:1:49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Bobryshev YV, Lord RS. Mapping of vascular dendritic cells in atherosclerotic arteries suggests their involvement in local immune-inflammatory reactions. Cardiovasc. Res. 1998;37:799–810. doi: 10.1016/s0008-6363(97)00229-0. [DOI] [PubMed] [Google Scholar]
  • 51.Bobryshev YV, Lord RS. Expression of heat shock protein-70 by dendritic cells in the arterial intima and its potential significance in atherogenesis. J. Vasc. Surg. 2002;35:368–375. doi: 10.1067/mva.2002.121067. [DOI] [PubMed] [Google Scholar]
  • 52.Corsini A, Bellosta S, Baetta R, Fumagalli R, Paoletti R, Bernini F. New insights into the pharmacodynamic and pharmacokinetic properties of statins. Pharmacol. Ther. 1999;84:413–428. doi: 10.1016/s0163-7258(99)00045-5. [DOI] [PubMed] [Google Scholar]
  • 53.Ait-Oufella H, Salomon BL, Potteaux S, Robertson AK, Gourdy P, Zoll J, Merval R, Esposito B, Cohen JL, Fisson S, Flavell RA, Hansson GK, Klatzmann D, Tedgui A, Mallat Z. Natural regulatory T cells control the development of atherosclerosis in mice. Nat. Med. 2006;12:178–180. doi: 10.1038/nm1343. [DOI] [PubMed] [Google Scholar]
  • 54.Mausner-Fainberg K, Luboshits G, Mor A, Maysel-Auslender S, Rubinstein A, Keren G, George J. The effect of HMG-CoA reductase inhibitors on naturally occurring CD4+CD25+ T cells. Atherosclerosis. 2008;197:829–839. doi: 10.1016/j.atherosclerosis.2007.07.031. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Suppl. Fig. 1

Simvastatin does not alter the cell surface expression of CD1d. LMTK-CD1d1 (A) and BMDCs (B) were treated with various concentrations of simvastatin for 24 h. The cells were then washed and stained with a PE-conjugated isotype control or anti-CD1d antibody (1B1) for 30 min at ice. The cells were washed and fixed in 1% paraformaldehyde for 15 min on ice before FACS analysis. Open histogram: isotype control. Filled histogram: anti-CD1d.

Suppl. Fig. 2

Cholesterol-depletion does not alter CD1d-mediated antigen presentation.A, LMTK-CD1d1 cells were treated with vehicle (DMSO), simvastatin (25 and 50 μM) or a specific inhibitor of cholesterol biosynthesis, AY9944 (10 and 20 μM) for 24 h. The cells were lysed and the total level of cholesterol was quantitated. LMTK-CD1d1 cells were treated or untreated with various concentrations of (B) β-methyl cyclodextrin (β-MCD) or (C) nystatin for 4 h. The cells were then washed and co-cultured with the indicated NKT cell hybridomas.

Suppl. Fig. 3

Effects of simvastatin on prenylation in LMTK-CD1d1 cells and its reversal by mevalonate. A, LMTK-CD1d1 cells were treated with simvastatin (50 μM) in the presence or absence of mevalonate (200 and 400 μM) and the prenylation of the indicated Rab GTPases and Ras proteins was analyzed by Western blot. Lane 1 (vehicle); Lane 2 (Mevalonate-200 μM); Lane 3 (Mevalonate-400 μM); Lane 4 (Simvastatin-50 μM); Lane 5 (Simvastatin + Mevalonate-200 μM); Lane 6 (Simvastatin + Mevalonate-400 μM). Lane 4 in (a) shows slower migration of the respective bands, indicative of prenylation inhibition. B and C: LMTK-CD1d1 cells were treated with simvastatin (25 and 50 μM) in the presence or absence of mevalonate (400 μM). The cytosolic (B) and membrane (C) fractions were analyzed for the presence of Rho, Rab5 and Ras by Western blot. GAPDH served as a control cytosolic protein, whereas flotillin was the control membrane protein used. Lanes: 1. Vehicle, 2. Mevalonate-400 μM, 3. Simvastatin-25 μM, 4. Simvastatin-25 + Mev-400, 5. Simvastatin-50 μM, 6. Simvastatin-50 + Mev-400.

RESOURCES