Abstract
Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections.
Introduction
Bacteria belonging to the species Acinetobacter baumannii are among the most problematic nosocomial pathogens. These organisms are notorious for their ability to colonize and infect severely ill patients in hospitals. A. baumannii infections are often associated with epidemic spread, and outbreak strains are frequently multidrug resistant (MDR). A most concerning development is the increasing occurrence of strains resistant to carbapenems or even to last resource antimicrobial agents including colistin or the new antibiotic tigecycline [1]–[4].
Strain typing by a variety of techniques [5], [6] has shown genotypic diversity within A. baumannii. Application of various methods has led to the recognition that a limited number of widespread clones are responsible for hospital outbreaks in many countries. Comparisons based on cell envelope protein profiling, ribotyping and AFLP genomic fingerprinting of epidemic and non-epidemic A. baumannii strains from geographically distinct European hospitals first delineated two major groups of epidemic strains, which were named European clones I and II [7]. A third pan-European outbreak clone (clone III) was subsequently distinguished based on ribotyping and AFLP [8]. The three ‘European’ clones should now more appropriately be called ‘international clones’, as they were associated with infection and epidemic spread not only in Europe, but in other parts of the world as well [9]–[19]. Multidrug resistance is often associated with isolates that belong to these international clones [7], [11], [20].
Despite the widely accepted idea that a few genotypic groups are responsible for a large proportion of the burden of A. baumannii infections, the genetic distinctness of clones among themselves and from other genotypes remains to be established. Fingerprinting methods provide limited phylogenetic information, results are not transportable between laboratories, and protocols and thresholds used for clone delineation may differ across studies [7], [11], [12]. In addition, genetic variation observed within clones raises the possibility that these clones harbor subtypes with distinctive temporal and geographical distributions. A standard definition of clonal relationships is needed for global epidemiological understanding and as a foundation for studying the relationships between genotype and phenotype of A. baumannii isolates, such as epidemic potential. Multilocus sequence typing (MLST) is the current standard for investigating the population structure of bacterial species [21]–[23]. MLST has a high potential to discriminate strains within A. baumannii [15], [24], [25], but has not been applied to assess the genetic structure of this species in general and of the international clones in particular.
Although A. baumannii is clinically the most important Acinetobacter species, the closely related genomic species (gen. sp.) 3 and 13TU have also been associated with nosocomial infections and outbreaks [3], [5], [26]–[28]. These three species and the environmental species A. calcoaceticus are genotypically closely related and phenotypically difficult to distinguish [29]–[31]. Therefore, they are sometimes referred to collectively as the A. calcoaceticus - A. baumannii (Acb) complex. The existence of a real phylogenetic demarcation between these closely related species is not firmly established. Multilocus sequence analysis (MLSA) of large collections of isolates belonging to closely related species has been proposed as a powerful approach to address the existence of species and to delineate their borders [32], [33].
The aims of the present study were to determine the genetic structure and diversity of A. baumannii, with a particular focus on the previously described international clones, and to compare antimicrobial resistance in these clones and other A. baumannii isolates. In addition, we determined the phylogenetic relationships and genetic distinctness of A. baumannii with respect to its closely related species. A set of well-described strains, mostly from clinical origin, many of which have been used in previous studies, was used.
Results
A. baumannii is well demarcated from other Acinetobacter species
To determine the phylogenetic relationships and demarcation of A. baumannii from closely related species, the 154 A. baumannii strains were compared to the three other species of the Acb complex and to gen. sp. 13BJ and 15BJ. Based on the alignment of the 2,976 nucleotides of the seven genes, a total of 589 (19.8%) polymorphic sites were found. No insertion or deletion event was observed. Phylogenetic analysis of the concatenated sequences ( Figure 1 ) revealed the very neat demarcation of the four species of the Acb complex, each forming a compact cluster separated from others by a large phylogenetic genetic distance. All species clusters had nearly maximal bootstrap support (99%), and the ratio of divergence among species to the diversity within-species (demarcation parameter [34], Table 1 ) was high for all pairwise comparisons (e.g., range 7.9 to 18 within the Acb complex). The phylogeny indicated that A. baumannii was strongly associated with gen. sp. 13TU, while gen. sp. 3 was associated with A. calcoaceticus (99% bootstrap support in both cases).
Figure 1. Phylogenetic analysis of 173 Acinetobacter strains.
Concatenated sequences of seven protein-coding genes (2,976 nt in total) were compared using the neighbor-joining method and based on a Jukes-Cantor distance matrix. Bootstrap values obtained after 1,000 replicates are given at the nodes. The 154 A. baumannii strains clearly grouped into a compact cluster. Each of the four species of the A. calcaoceticus-baumannii complex was clearly distinct.
Table 1. Sequence divergence within and between Acinetobacter sp.
| Mean % divergence within species (a) | Mean % divergence between species (b) | Ratio (between/within) (c) | |
| A. baumannii vs A. calcoaceticus | 0.35+/−0.009; 0.83+/−0.26 | 9.66+/− 0.581 | 16.32 |
| A. baumannii vs gen. sp. 3 | 0.35+/−0.009; 0.73+/−0.17 | 8.88+/−0.369 | 16.44 |
| A. baumannii vs gen. sp. 13TU | 0.35+/−0.009; 0.16+/−0.029 | 4.65+/−0.18 | 18.24 |
| A. baumannii vs gen. sp. 15BJ | 0.35+/−0.009; 0.034+/−0.017 | 11.60+/−0.8 | 60.42 |
| A. baumannii vs gen. sp. 13BJ | 0.35+/−0.009; 1.5+/−0.78 | 12.25+/−0.845 | 13.24 |
| gen. sp. 3 vs A. calcoaceticus | 0.73+/−0.17; 0.83+/−0.26 | 6.17+/−1.67 | 7.91 |
| gen. sp. 13TU vs sp 3 | 0.16+/−0.029; 0.73+/−0.17 | 8.07+/−1.42 | 18.13 |
| gen. sp. 13TU vs A. calcoaceticus | 0.16+/−0.029; 0.83+/−0.26 | 8.83+/−2.24 | 17.84 |
(a) Mean +/− standard error for pairwise divergence within each of the species shown in order of appearance in the comparison column.
(b) Mean +/− standard error for pairwise divergence between the species, based on all pairwise comparisons of strains from different species.
(c) k parameter: Ratio of the between-species divergence to the average of the within-species divergence levels (Palys et al. 1997).
Comparison of the phylogenies obtained using each gene individually showed strong congruence among the seven genes (Figure S1). However, some discrepancies were observed. For example, as opposed to the concatenate and to five individual genes, rplB did not associate A. baumannii strongly with gen. sp. 13TU. On the contrary, in the rplB phylogeny, all isolates of species 13TU were associated in a short, strongly supported branch with species 3 and with A. calcoaceticus (Figure S1). This observation can be attributed to the horizontal transfer of the rplB gene from a donor related to A. calcoaceticus and gen. sp. 3 into an ancestral strain of gen. sp. 13TU. Gene rpoB showed an intermediate situation for the position of gen. sp. 13TU, which was neither strongly associated with A. baumannii nor with A. calcoaceticus and gen. sp. 3, consistent with previous findings [35]. Interestingly for the purpose of strain identification, no single isolate was placed in a species cluster distinct from the one it belongs to based on concatenated sequences, showing that replacement of genomic sequences by homologous DNA from other species is not frequent.
Restricted nucleotide diversity and lack of phylogenetic structure within A. baumannii
The proportion of variable sites observed among the 154 A. baumannii strains varied from 2% (pyrG) to 4.8% (recA) ( Table 2 ). Considering the seven genes together, there were 95 variable sites, including 55 parsimony-informative ones. Non-synonymous substitutions were rare compared to synonymous substitutions ( Table 2 ), indicating selection against amino acid changes, consistent with the expectation of purifying selection acting on housekeeping genes. The nucleotide diversity (π, average number of nucleotide differences per site between two randomly-selected strains) ranged from 0.2% (fusA) to 0.76% (recA) on the entire population, and from 0.26% (pyrG) to 0.85% (recA) based on unique STs only (excluding a bias towards low diversity due to the incorporation of multiple isolates of the major clones and the seven outbreaks). Hence, the level of divergence of the core genome within A. baumannii is strikingly lower than between A. baumannii and its closest species, 13TU (4.6% on average).
Table 2. Polymorphism among 154 strains of A. baumannii.
| Gene | Size (bp) | No. of alleles | No. of polymorphic sites (non-synonymous sites) | dN | dS | dN/dS | π (%) | π on STs (%) |
| cpn60 | 405 | 13 | 12 (0) | 0 | 0.01981 | 0.000 | 0.448 | 0.38 |
| fusA | 633 | 17 | 16 (3) | 0.00042 | 0.00768 | 0.055 | 0.204 | 0.27 |
| gltA | 483 | 19 | 14(0) | 0 | 0.01137 | 0.000 | 0.253 | 0.34 |
| pyrG | 297 | 7 | 6 (0) | 0 | 0.00942 | 0.000 | 0.219 | 0.26 |
| recA | 372 | 18 | 18 (0) | 0 | 0.03262 | 0.000 | 0.756 | 0.85 |
| rplB | 330 | 9 | 8 (0) | 0 | 0.01057 | 0.000 | 0.27 | 0.27 |
| rpoB | 456 | 16 | 16 (2) | 0.00011 | 0.01526 | 0.0072 | 0.375 | 0.39 |
| Concatenate | 2,976 | 58 | 89 (5) | 0.00011 | 0.01487 | 0.0074 | 0.35 | 0.385 |
dN: non-synonymous substitutions per non-synonymous site.
dS: synonymous substitutions per synonymous site.
π: average number of nucleotide differences per site between two randomly-selected strains. The value is given for 100 sites.
The existence of a phylogenetic pattern within A. baumannii was investigated by neighbor-joining analysis of the concatenated sequences of the seven genes (Fig. S2). There was no evidence of phylogenetic structuring, as no subsets of strains were clearly separated from others. Instead, most sequences appeared roughly equidistant, with the exception of a few tight terminal clusters that correspond to clonal complexes (see below). There was no evidence that these clonal complexes had a common evolutionary origin.
Genotypic diversity within A. baumannii and identification of international clones
The A. baumannii strains were grouped by MLST into 59 distinct sequence types (ST). Forty-seven STs corresponded to a single isolate, whereas three STs comprised 15 strains or more (ST1, n = 24, ST2, n = 33 and ST3, n = 15). These three STs, comprising 46% of the strains altogether, were composed of strains previously identified as international clone I, II and III, respectively ( Table 3 ). Relationships among genotypes were disclosed using the MStree method ( Figure 2 ). Only five clonal complexes (CC) were found, three of which corresponded to international clones I–III. CC1 comprised all strains previously determined to belong to clone I, including its reference strain RUH875. CC1 was composed of ST1, ST7, ST8, ST19 and ST20. Whereas the four latter STs differed from ST1 by a single allelic mismatch, they differed among themselves by two mismatches, indicating that ST1 is the probable founder genotype of CC1, from which the other STs evolved by a single allelic change. The fact that ST1 was also, by far, the most frequent among these five STs, indicates that ST1 experienced a clonal expansion.
Table 3. Strains used in this study and their characteristics.
| Species/strain code(s) | Clone by MLST | ST | Allelic profile | Clone or cluster by AFLP | AFLP cluster no (80%) | AFLP cluster no. (90%) | No. of resistancies* | MDR ** | Outbreak/cross infection *** | City, country, year of isolation | Source | Reference for strain source |
| A. baumannii **** | ||||||||||||
| LUH 3783 ( = NIPH 10) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 66 | 8 | + | Yes | Prague, CZ, 1991 | Blood | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 4576 ( = NIPH 56) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 67 | 2 | - | Unknown | Prague, CZ, 1992 | Burn | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 4624 ( = NIPH 470) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 64 | 6 | + | Unknown | C. Budejovice, CZ, 1997 | Bronchus | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 4640 ( = NIPH 321) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 70 | 7 | + | Unknown | Tábor, CZ, 1994 | Urine | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 6015 ( = 11A352) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 72 | 5 | + | Yes | Rome, IT, 1998 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6224 | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 70 | 8 | + | Yes | Sydney, AU, 1995 | Blood | Valenzuela J Clin Microbiol 2007;45:453 |
| LUH 7140 ( = A789) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 64 | 6 | + | Yes | London, UK, 2000 | Sputum | |
| LUH 8592 | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 63 | 7 | + | No | Sofia, BG, 2001 | Urine | Dobrevski et al 2006 |
| LUH 9668 | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 71 | 6 | + | Unknown | Dublin, IE, 2003 | Wound (horse) | Abbott et al JAC 2005 |
| RUH 0875 | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 69 | 6 | + | Yes | Dordrecht, NL, 1984 | Urine | Dijkshoorn et al JCM 1996, Janssen et al IJSB 1997 |
| RUH 2037 | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 68 | 7 | + | Yes (Outbreak 1, n = 4) | Venlo, NL, 1986 | Sputum | Crombach et al ICM 1989, Dijkshoorn et al JCM 1992 |
| RUH 3238 ( = GNU 1084) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 70 | 5 | + | Yes | Sheffield, UK, 1987 | Burn | Dijkshoorn et al JCM 1996 |
| RUH 3239 ( = GNU 1083) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 68 | 6 | + | Yes | London, UK, 1985-88 | Urine | Dijkshoorn et al JCM 1996 |
| RUH 3242 ( = GNU 1082) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 71 | 6 | + | Yes | Basildon, UK, 1989 | Burn | Dijkshoorn et al JCM 1996 |
| RUH 3247 ( = GNU 1078) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 71 | 7 | + | Yes | Leuven, BE, 1990 | Rectum | Dijkshoorn et al JCM 1996 |
| RUH 3282 ( = GNU 1079) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 71 | 8 | + | Yes | Salford, UK, 1990 | Tracheostomy | Dijkshoorn et al JCM 1996 |
| LUH 6014 ( = 11A221) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 72 | 7 | + | Yes | Rome, IT, 1998 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6050 ( = 36C058) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 62 | 7 | + | Yes | Pretoria, ZA | Respiratory tract | van Dessel et al Res Microbiol 2003 |
| LUH 6013 ( = 11A018) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 35 | 74 | 6 | + | Yes | Rome, IT, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 5881 ( = 17C078) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 73 | 7 | + | Yes | Madrid, ES, 1998 | Respiratory tract | van Dessel et al Res Microbiol 2003 |
| LUH 6125 ( = 14C052) | CC1 | 1 | 1-1-1-1-5-1-1 | I | 34 | 64 | 7 | + | Yes | Krakow, PL, 1998 | Respiratory tract | van Dessel et al Res Microbiol 2003 |
| AYE | CC1 | 1 | 1-1-1-1-5-1-1 | nd | Nd | nd | nd | + ***** | Yes ***** | Kremlin-Bicetre, F, 2001 | Urine | Poirel et al JCM 2003 |
| AB0057 | CC1 | 1 | 1-1-1-1-5-1-1 | nd | Nd | nd | nd | + ***** | nd | Washington D.C., USA, 2004 | Blood | Adams et al 2008 |
| AB307-0294 | CC1 | 1 | 1-1-1-1-5-1-1 | nd | Nd | nd | nd | - ***** | nd | Buffalo, NY, 1994 | Blood | Adams et al 2008 |
| LUH 3782 ( = NIPH 7) | CC1 | 7 | 1-1-1-2-5-1-1 | I | 34 | 66 | 7 | + | Unknown | Prague, CZ, 1991 | Burn | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| RUH 0510 | CC1 | 8 | 1-1-1-1-1-1-1 | I | 34 | 71 | 5 | + | Yes | Nijmegen, NL, 1984 | Bronchus | Janssen et al IJSB 1997, Dijkshoorn et al JCM 1996 |
| LUH 8605 | CC1 | 19 | 1-2-1-1-5-1-1 | I | 36 | 75 | 7 | + | No | Sofia, BG, 2002 | Wound | Dobrewski et al CMI 2006 |
| LUH 8723 | CC1 | 20 | 3-1-1-1-5-1-1 | I | 34 | 65 | 8 | + | Yes (Outbreak 6, n = 5) | Leiden, NL, 2003 | Wound | |
| A1755 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 46 | nd | nd | No | Chelmsford, UK, 2000 | Wound | |
| LUH 3788 ( = NIPH 24) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 40 | 6 | + | Unknown | Prague, CZ, 1991 | Urine | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 4629 ( = NIPH 657) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 40 | 7 | + | Yes | Prague, CZ, 1996 | Tracheostomy | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 5682 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 41 | 5 | + | Unknown | Utrecht, NL, 1993 | Catheter (horse) | |
| LUH 6024 ( = 16A502) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 45 | 7 | + | Yes | Sevilla, ES, 1998 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 8065 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 47 | 8 | + | Yes | Amsterdam, NL, 2001 | Hospital env. | van den Broek et al CMI 2006 |
| LUH 8488 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 46 | 7 | + | Unknown | Leeuwarden, NL, 2003 | Wound | |
| LUH 9233 ( = NIPH 1945) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 43 | 7 | + | Unknown | Prague, CZ, 2003 | Sputum | Nemec et al JAC 2007 |
| RUH 0134 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 40 | 5 | + | Yes (Outbreak 2, n = 6) | Rotterdam, NL, 1982 | Urine | Janssen et al IJSB 1997 |
| RUH 3240 ( = GNU 1086) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 44 | 4 | + | Yes | Newcastle, UK, 1989 | Respiratory tract | Dijkshoorn et al JCM 1996 |
| RUH 3245 ( = GNU 1080) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 45 | 3 | + | Yes | Salisbury, UK, 1989 | Urine | Dijkshoorn et al JCM 1996 |
| RUH 3422 ( = PGS 189) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 40 | 1 | - | No | Odense, DK, 1984 | Crural ulcer | Dijkshoorn et al JCM 1996 |
| LUH 6025 ( = 16A528) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 45 | 7 | + | Yes | Sevilla, ES, 1998 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6045 ( = 18C144) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 44 | 9 | + | Yes | Barcelona, ES, 1997 | Sputum | van Dessel et al Res Microbiol 2003 |
| LUH 6051 ( = 36D042) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 45 | 4 | + | Yes | Pretoria, ZA | Wound | van Dessel et al Res Microbiol 2003 |
| LUH 5868 ( = 06A102) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 45 | 9 | + | Yes | Lille, FR, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6021 ( = 14C003) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 42 | 8 | + | Yes | Krakow, PL, 1998 | Sputum | van Dessel et al Res Microbiol 2003 |
| LUH 7154 ( = A1850) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 28 | 53 | 5 | + | No | Berkshire, UK, 2000 | Urine | Spence et al JCM 2004 |
| LUH 8143 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 28 | 52 | 7 | + | Yes | Singapore, SG, 1997 | Sputum | |
| LUH 8533 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 28 | 51 | 7 | + | Unknown | London, UK, | Urine | |
| RUH 3381 ( = GNU 666) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 28 | 50 | 3 | + | Unknown | Cork, IE, 1989 | Sputum | |
| LUH 5089 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 49 | 6 | + | Unknown | Warsaw, PL, before 1999 | Ascites | |
| LUH 6231 | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 48 | 9 | + | Yes | Sydney, AU, 1999 | Hip | Valenzuela J Clin Microbiol 2007;45:453 |
| LUH 6038 ( = 18A350) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 29 | 54 | 9 | + | Yes | Barcelona, ES, 1998 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6034 ( = 17C003) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 29 | 54 | 10 | + | Yes | Madrid, ES, 1997 | Sputum | van Dessel et al Res Microbiol 2003 |
| LUH 6126 ( = 15A250) | CC2 | 2 | 2-2-2-2-2-2-2 | II | 27 | 45 | 7 | + | Yes | Coimbra, PT, 1998 | Blood | van Dessel et al Res Microbiol 2003 |
| ACICU | CC2 | 2 | 2-2-2-2-2-2-2 | II | Nd | nd | nd | + ***** | nd | Rome, IT, 2005 | Cerebrospinal fluid | Iacono et al AAC 2008 |
| LUH 6011 ( = 09A242) | CC2 | 45 | 2-6-2-2-2-2-2 | II | 27 | 44 | 7 | + | Yes | Athens, GR, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 7855 ( = NIPH 1362) | CC2 | 47 | 2-13-2-2-2-2-2 | II | 40 | 79 | 5 | + | Yes | Prague, CZ, 2000 | Tracheal aspirate | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 5875 ( = 12A133) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 8 | + | Yes | Utrecht, NL, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6009 ( = 04C048) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 8 | + | Yes | Paris, FR, 1997 | Sputum | van Dessel et al Res Microbiol 2003 |
| LUH 6012 ( = 10C070) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 8 | + | Yes | Genoa, IT, 1998 | Sputum | van Dessel et al Res Microbiol 2003 |
| LUH 6028 ( = 16D025) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 7 | + | Yes | Sevilla, ES, 1998 | Wound | van Dessel et al Res Microbiol 2003 |
| LUH 6035 ( = 17C085) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 8 | + | Yes | Madrid, ES, 1998 | Sputum | van Dessel et al Res Microbiol 2003 |
| LUH 6037 ( = 18A155) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 8 | + | Yes | Barcelona, ES, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6215 | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 8 | + | Unknown | Heerlen, NL, 2000 | Skin | |
| LUH 8056 | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 60 | 8 | + | Yes | Groningen, NL, 2000 | Hospital env. | van den Broek et al CMI 2006 |
| LUH 9536 | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 57 | 7 | + | Yes | Gent, BE, 1993 | Sputum | Huys et al RM 2005 |
| LUH 6020 ( = 12A126) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 7 | + | Yes | Utrecht, NL, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6030 ( = 16D083) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 7 | + | Yes | Sevilla, ES, 1997 | Wound | van Dessel et al Res Microbiol 2003 |
| LUH 6036 ( = 18A025) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 58 | 7 | + | Yes | Barcelona, ES, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 6048 ( = 18D047) | CC3 | 3 | 3-3-2-2-3-1-3 | III | 32 | 57 | 0 | - | Yes | Barcelona, ES, 1997 | Wound | van Dessel et al Res Microbiol 2003 |
| LUH 5874 ( = 06A201) | CC3 | 14 | 3-3-2-2-3-1-7 | III | 32 | 58 | 6 | + | Yes | Lille, FR, 1997 | Blood | van Dessel et al Res Microbiol 2003 |
| LUH 4641 ( = NIPH 335) | CC10 | 10 | 1-3-2-1-4-4-4 | cluster B | 25 | 36 | 6 | + | Unknown | Tábor, CZ, 1994 | Sputum | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 6237 | CC10 | 10 | 1-3-2-1-4-4-4 | cluster B | 25 | 35 | 1 | - | No | Darwin, AU, 1981-91 | Blood | |
| RUH 1316 | CC10 | 23 | 1-3-10-1-4-4-4 | cluster B | 25 | 37 | 0 | - | Unknown | Rotterdam, NL, 1964 | Mink | |
| LUH 8406 ( = NIPH 1734) | ST15 | 15 | 6-6-8-2-3-5-4 | cluster A | 1 | 2 | 7 | + | Unknown | M. Boleslav, CZ, 2001 | Sputum | Nemec et al JMM 2004a, Nemec et al JAC 2007 |
| LUH 6374 | ST15 | 15 | 6-6-8-2-3-5-4 | cluster A | 1 | 3 | 5 | + | Yes (Outbreak 4, n = 3) | Leiden, NL, 2000 | Pharynx | van den Broek et al 2009 |
| LUH 8102 | ST15 | 15 | 6-6-8-2-3-5-4 | cluster A | 1 | 1 | 6 | + | Yes | Tilburg, NL, 2000 | Wound | van den Broek et al CMI 2006 |
| LUH 8147 | ST15 | 15 | 6-6-8-2-3-5-4 | cluster A | 1 | 5 | 4 | + | Yes | Buenos Aires, AR, 1995 | Sputum | |
| LUH 8850 | ST15 | 15 | 6-6-8-2-3-5-4 | cluster A | 1 | 1 | 6 | + | Unknown | Leiden, NL, 2003 | Pus | |
| LUH 9716 | ST15 | 15 | 6-6-8-2-3-5-4 | cluster A | 1 | 4 | 10 | + | Yes | Ede, NL, 2004 | Drain bowel | |
| RUH 2208 | CC32 | 28 | 1-1-2-2-10-4-4 | cluster 6 | 17 | 26 | 0 | - | No | Malmö, SE, 1980-81 | Wound | Janssen et al 1997, Dijkshoorn et al JCM 1996 |
| RUH 3428 | CC32 | 28 | 1-1-2-2-10-4-4 | cluster 6 | 17 | 27 | 0 | - | No | Malmö, SE, 1980-81 | Wound | Dijkshoorn et al JCM 1996, Tjernberg & Ursing APMIS 1989 |
| RUH 3425 | CC32 | 32 | 1-1-2-2-3-4-4 | cluster 6 | 7 | 14 | 0 | - | No | Veile, DK, 1990 | Urine | Dijkshoorn et al JCM 1996 |
| RUH 2207 | CC32 | 53 | 1-1-2-2-3-4-2 | 19 | 29 | 0 | - | No | Malmö, SE, 1980-81 | Sputum | Janssen et al IJSB 1997, Tjernberg & Ursing, 1989 | |
| RUH 3023T ( = ATCC19606T) | ST52 | 52 | 3-2-2-7-9-1-5 | cluster C | 7 | 16 | 2 | - | Unknown | Before 1949 | Urine | Janssen et al IJSB 1997, Nemec et al JAC 2007 |
| RUH 1752 | ST52 | 52 | 3-2-2-7-9-1-5 | cluster C | 7 | 15 | 0 | - | Yes (Outbreak 7, n = 3) | Enschede, NL, 1986 | Bronchus | Dijkshoorn et al JCP 1991 |
| RUH 1063 ( = NCTC 7844) | ST52 | 52 | 3-2-2-7-9-1-5 | cluster C | 7 | 15 | 2 | - | Unknown | Before 1948 | Unknown | Janssen et al IJBS 1997, Nemec et al JAC 2007 |
| LUH 8225 | 4 | 1-3-3-2-4-1-4 | 15 | 24 | 0 | - | No | Leiden, NL, 2002 | Bronchus | van den Broek et al 2009 | ||
| LUH 5703 | 5 | 4-1-2-2-4-1-5 | 22 | 32 | 7 | + | Yes (Outbreak 3, n = 4) | Warsaw, PL, 1999 | Cerebrospinal fluid | Wroblewska et al JHI 2004 | ||
| A955 | 6 | 5-4-4-1-3-3-4 | 2 | 6 | No | London, UK, 2000 | Bronchus | |||||
| LUH 4633 ( = NIPH 190) | 9 | 3-1-5-3-6-1-3 | 44 | 83 | 0 | - | Unknown | Prague, CZ, 1993 | Tracheostomy | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 4718 ( = NIPH 329) | 11 | 1-2-6-2-3-4-4 | 18 | 28 | 0 | - | Unknown | Tábor, CZ, 1994 | Tracheostomy | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 4727 ( = NIPH 615) | 12 | 3-5-7-1-7-2-6 | 5 | 10 | 0 | - | Unknown | Prague, CZ, 1994 | Tracheostomy | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 5687 | 13 | 3-1-2-2-4-1-3 | III | 32 | 59 | 0 | - | Unknown | Utrecht, NL, 1996 | Throat (dog) | ||
| LUH 6639 | 16 | 7-7-2-2-8-4-4 | 37 | 76 | 8 | + | Yes (Outbreak 5, n = 6) | Leiden, NL, 2001 | Drain tip | Bernards et al 2004, van den Broek et al 2006 | ||
| SDF | 17 | 3-29-30-1-9-1-4 | Nd | nd | nd | - | no | F, <1999 | Body louse | Fournier et al 2006, Vallenet et al 2008 | ||
| LUH 8326 | 18 | 1-8-9-2-4-6-4 | 24 | 34 | 0 | - | No | Leiden, NL, 2002 | Wound | van den Broek et al 2009 | ||
| LUH 9415 | 21 | 3-3-2-2-4-4-8 | 23 | 33 | 0 | - | No | Leiden, NL, 2004 | Sputum | van den Broek et al 2009 | ||
| RUH 1093 | 22 | 3-9-3-2-4-1-9 | 7 | 13 | 2 | - | No | Rotterdam, NL, 1985 | Sputum | Janssen et al IJBS 1997, Dijkshoorn et al JCM 1996 | ||
| RUH 1317 | 24 | 1-10-2-2-9-1-10 | 9 | 18 | 0 | - | Unknown | Rotterdam, NL, 1965 | Mink | |||
| RUH 1486 | 25 | 3-3-2-4-7-2-4 | 4 | 8 | 0 | - | No | Rotterdam, NL, 1985 | Umbilicus | |||
| RUH 1907 | 26 | 1-2-11-5-3-1-11 | 26 | 39 | 0 | - | No | Rotterdam, NL, 1986 | Bronchus | Dijkshoorn et al JCM 1996, | ||
| RUH 2180 | 27 | 3-3-12-2-9-7-4 | 12 | 21 | 0 | - | No | Nijmegen, NL, 1987 | Sputum | |||
| RUH 3413 | 29 | 1-3-13-1-5-8-12 | 6 | 12 | 3 | + | No | London, UK, 1981 | Skin | Dijkshoorn et al JCM 1996 | ||
| RUH 3423 | 30 | 1-1-2-5-3-2-3 | 45 | 84 | 0 | - | No | Naestved, DK, 1990 | Urine | Dijkshoorn et al JCM 1996 | ||
| RUH 3424 | 31 | 1-2-2-2-11-1-1 | 16 | 25 | 2 | - | No | Veile, DK, 1990 | Urine | Dijkshoorn et al JCM 1996 | ||
| RUH 3429 | 33 | 8-1-14-3-12-1-13 | 4 | 9 | 1 | - | No | Malmö, SE, 1980-81 | Wound | Dijkshoorn et al JCM 1996,Tjernberg & Ursing APMIS 1989 | ||
| LUH 4631 ( = NIPH 60) | 34 | 9-3-2-2-5-4-14 | 30 | 55 | 0 | - | Unknown | Prague, CZ, 1992 | Sputum | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 4707 ( = NIPH 67) | 35 | 1-2-2-2-3-1-2 | 25 | 38 | 0 | - | Unknown | Prague, CZ, 1992 | Tracheostomy | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 4708 ( = NIPH 70) | 36 | 3-2-2-2-7-1-2 | 38 | 77 | 0 | - | Unknown | Prague, CZ, 1992 | Tracheostomy | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 4709 ( = NIPH 80) | 37 | 3-2-15-6-6-4-5 | 20 | 30 | 1 | - | Unknown | Prague, CZ, 1993 | I. v. catheter | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 4711 ( = NIPH 201) | 38 | 10-4-3-2-13-1-2 | 31 | 56 | 0 | - | Unknown | Liberec, CZ, 1992 | Nose | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 4722 ( = NIPH 410) | 39 | 1-2-2-2-5-1-14 | 3 | 7 | 0 | - | Unknown | Brno, CZ, 1996 | Cannula | |||
| LUH 4725 ( = NIPH 601) | 40 | 1-1-2-2-12-1-5 | 43 | 82 | 0 | - | Unknown | Prague, CZ, 1993 | Urine | Nemec et al JMM 2004a, Nemec et al JAC 2007 | ||
| LUH 5684 | 42 | 3-11-16-1-13-1-15 | 8 | 17 | 2 | - | Unknown | Utrecht, NL, 1994 | Blood (horse) | |||
| LUH 5685 | 43 | 3-3-13-2-4-4-5 | 33 | 61 | 0 | - | Unknown | Utrecht, NL, 1994 | Nose (dog) | |||
| LUH 5691 | 44 | 11-2-2-4-13-1-2 | 11 | 20 | 0 | - | Unknown | Utrecht, NL, 1997 | Eye (cat) | |||
| LUH 7852 ( = NIPH 301) | 46 | 5-12-11-2-14-9-14 | 39 | 78 | 7 | + | Unknown | Slaný, CZ, 1994 | Sputum | Nemec et al JMM 2004a | ||
| LUH 8088 | 48 | 3-14-2-2-15-4-5 | 10 | 19 | 0 | - | No | Leiden, NL, 2002 | Sputum | van den Broek et al 2009 | ||
| LUH 9084 | 49 | 3-3-6-2-3-1-5 | 41 | 80 | 0 | - | No | Leiden, NL, 2003 | Urine | van den Broek et al 2009 | ||
| AB900 | 49 | 3-3-6-2-3-1-5 | nd | nd | nd | - ***** | nd | Washington D.C., USA, 2003 | Perinea | Adams et al 2008 | ||
| LUH 9136 | 50 | 3-15-17-2-3-1-2 | 13 | 22 | 3 | + | No | Leiden, NL, 2004 | Sputum | van den Broek et al 2009 | ||
| RUH 0414 | 51 | 3-16-6-2-16-4-2 | 6 | 11 | 0 | - | Unknown | Leiden, NL, 1978 | Auditory canal | Dijkshoorn et al JCM 1996 | ||
| RUH 2209 ( = ATCC 17904) | 54 | 12-3-18-2-17-4-5 | 46 | 85 | 1 | - | Unknown | Before 1962 | Urine | Janssen et al IJSB 1997, Tjernberg & Ursing, 1989 | ||
| RUH 2688 | 55 | 13-4-2-2-6-1-16 | 42 | 81 | 2 | - | No | Rotterdam, NL, 1987 | Throat | Dijkshoorn et al JCM 1996 | ||
| RUH 3410 | 56 | 3-17-7-2-18-1-2 | 14 | 23 | 0 | - | No | London, UK, 1982 | Skin | Dijkshoorn et al JCM 1996 | ||
| RUH 3414 | 57 | 1-3-17-5-3-1-14 | 21 | 31 | 0 | - | No | London, UK, 1988 | Nail fold | Dijkshoorn et al JCM 1996 | ||
| SB 1414 | 58 | 13-4-2-2-7-1-2 | nd | nd | nd | - | Unknown | Utrecht, NL, 1997 | Blood | |||
| LUH 6049 | 59 | 3-2-19-2-5-2-5 | II | 27 | 41 | 6 | + | Unknown | Ankara, TR, 1997 | Wound | ||
| ATCC 17978 | 77 | 3-2-2-2-3-4-28 | nd | nd | nd | Unknown | 1951 | Meningitis | Smith et al Genes Dev 2007 | |||
| A. calcoaceticus | ||||||||||||
| RUH 2201T ( = ATCC23055T) | 62 | 16-19-22-9-19-12-19 | 53 | 92 | 0 | - | Unknown | Delft, NL, before 1911 | Soil | |||
| CIP 6632 | 60 | 14-18-20-8-19-10-17 | nd | nd | nd | Unknown | Unknown | |||||
| LUH 9144 | 61 | 15-18-21-8-19-11-18 | 54 | 93 | 0 | - | No | Leiden, NL, 2004 | Urine | van den Broek et al 2009 | ||
| A. genomic sp. 3 | ||||||||||||
| RUH 2206 ( = ATCC 19004) | 63 | 17-20-23-10-20-13-20 | 57 | 96 | 0 | - | Unknown | Unknown | Cerebrospinal fluid | Janssen et al IJSB 1997, Tjernberg & Ursing 1989 | ||
| RUH 1944 | 70 | 23-20-23-16-25-18-20 | 59 | 98 | 1 | - | Yes | The Hague, NL, 1986 | Urine | Dijkshoorn et al JCM 1993 | ||
| RUH 0509 | 72 | 24-27-27-17-20-18-20 | 58 | 97 | 0 | - | No | Nijmegen, NL, 1984 | Bronchus | Dijkshoorn et al JCP 1993, Janssen et al IJSB 1997 | ||
| RUH 2204 | 73 | 23-28-28-10-25-18-26 | 55 | 94 | 0 | - | No | Malmoe, SE, 1980-81 | Wound | Tjernberg & Ursing 1989, Janssen et al IJSB 1997 | ||
| RUH 1163 | 75 | 17-21-23-10-20-13-27 | 56 | 95 | 0 | - | No | Rotterdam, NL, 1985 | Toe web | Janssen et al IJSB 1997 | ||
| A. genomic sp. 13TU | ||||||||||||
| RUH 0503 | 68 | 20-24-26-14-23-16-23 | 50 | 89 | 2 | - | No | Nijmegen, NL, 1984 | Urine | Janssen et al IJSB 1997 | ||
| RUH 3417 | 68 | 20-24-26-14-23-16-23 | 50 | 89 | 3 | - | Yes | Odense, DK, | Respiratory tract | Dijkshoorn et al JCM 1993 | ||
| RUH 2210 ( = ATCC 17903) | 74 | 22-26-29-14-27-16-23 | 52 | 91 | 0 | - | Unknown | Before 1968 | Unknown | Janssen et al IJSB 1997 | ||
| LUH 7715 | 71 | 20-26-26-14-26-16-25 | 48 | 87 | 0 | - | Yes | Utrecht, NL, 2000 | Sputum | van Dessel et al JHI 2002 | ||
| LUH 8731 | 71 | 20-26-26-14-26-16-25 | 47 | 86 | 1 | - | Yes | Leiden, NL, 2003 | Sputum | |||
| RUH 2624 | 71 | 20-26-26-14-26-16-25 | 49 | 88 | 1 | - | No | Rotterdam, NL, 1987 | Skin | Janssen et al IJSB 1997 | ||
| RUH 2376 | 76 | 20-26-26-18-27-19-23 | 51 | 90 | 0 | - | Unknown | Rotterdam, NL, 1987 | Sputum | Janssen et al IJSB 1997 | ||
| A. genomic sp. 13BJ | ||||||||||||
| LUH 1718 ( = SEIP 5.84) | 65 | 18-22-24-11-21-14-21 | 60 | 99 | 0 | - | Unknown | Unknown | Blood | Bouvet & Jeanjean RM 1989, Janssen et al IJSB 1997 | ||
| LUH 1717 ( = ATCC 17905) | 69 | 21-25-24-15-24-17-24 | 61 | 100 | 0 | - | Unknown | Before 1963 | Conjunctiva | Bouvet & Jeanjean RM 1989, Janssen et al IJSB 1997 | ||
| A. genomic sp. 15BJ | ||||||||||||
| LUH 1729 ( = Adam Ac606) | 66 | 19-23-25-12-22-15-22 | 62 | 101 | 0 | - | Unknown | Unknown | Skin | Bouvet & Jeanjean RM 1989, Janssen et al IJSB 1997 | ||
| LUH 1730 ( = SEIP 23.78) | 67 | 19-23-25-13-22-15-21 | 62 | 102 | 0 | - | Unknown | Unknown | Urine | Bouvet & Jeanjean RM 1989, Janssen et al IJSB 1997 | ||
nd: not determined.
* Numbers of antimicrobial agents to which an isolate was resistant using disc diffusion with 10 antimicrobial agents.
** Resistance to at least one representative of 3 or more of the 5 classes of antimicrobial agents, i.e. beta-lactams (piperacillin, ceftazidime, ampicillin-sulbactam, imipenem), aminoglycosides (gentamicin, amikacin, tobramycin), fluoroquinolones (ofloxacin), tetracyclines (tertracycline) and the combination of sulfonamide and diaminopyriminide (sulfamethoxazol + trimethoprim).
*** Multiple isolates of outbreak 1–7 were analyzed in the current study to check for reproducibility and concordance (see text); only one strain per outbreak was included in the table.
**** The genome of seven A. baumannii strains was fully sequenced (ATCC 17978, AYE, SDF, ACICU, AB0057, AB307-0294 and AB900). For these strains, sequences were extracted from the genome sequence.
***** According to previous publications; criteria may differ from those used for the strains analysed in this work.
Figure 2. Minimum spanning tree analysis of 154 strains of A. baumannii.
The number of allelic mismatches among MLST profiles was used as distance. Each circle corresponds to one sequence type (ST), with its number indicated inside. Circle size increases logarithmically with the number of isolates that had this ST, from one (smallest circles) to 33 (ST2). Colored or grey zones that surround some groups of circles indicate that these profiles belong to the same clonal complex (CC), meaning that they have a single allelic mismatch with at least one other member of the group. Multiresistant clones CC1, CC2, CC3 and ST15 are colored. The colored pie chart sections inside circles indicate the proportion of strains that were part of one of the seven outbreak sets, the location and year of which is indicated besides the corresponding circle, in the same color. Seven genome reference strains are indicated in bold. Note that the inferred relationships displayed among STs differing by more than one allelic mismatch should not be considered as reliable, as many alternative links with the same number of mismatches often exist.
Clonal complex 2 (composed of ST2, ST45 and ST47) comprised all clone II strains, with a single exception: strain LUH6049 (ST59) differed from ST2 by three genes and from ST45 and ST47 by two genes. Hence, ST59 cannot be attributed to CC2 by our definition of CCs, which is based on a single allelic mismatch; however, the closest relatives of ST59 are members of CC2. ST45 and ST47 each differed from ST2 by a single gene, fusA. CC3 (ST3 and ST14) comprised all strains of clone III, excepted strain LUH5687 (ST13), which differed from ST3 by fusA and recA.
Additional groups of genetically related but geographically distant isolates were identified, which correspond to the definition of clone sensu Orskov and Orskov [36]. CC32 included ST32 together with ST28 and ST53 and included isolates from Denmark and Sweden; three strains of CC32 formed AFLP cluster 6 in the 1996 study by Dijkshoorn et al. [7]. CC10 (ST10 and ST23) isolates, previously identified to a tentative novel clone B by AFLP [37], were retrieved in the Czech Republic, the Netherlands and Australia. Finally, ST15 contained nine strains with varied geographic origins (Netherlands, Czech Republic, Argentina). This clone was also identified previously by AFLP analysis and designated tentative clone A [37].
All isolates within a given outbreak set had the same ST ( Table 3 ). One outbreak corresponded to ST2 (Rotterdam 1982), whereas two fell in CC1: Venlo 1986 (ST1) and Leiden 2003 (ST20). The four remaining outbreaks were caused by four distinct STs (ST5, ST15, ST16 and ST52). ST52 caused an outbreak in Enschede (The Netherlands) in year 1986 and also included ATCC19096T, the type strain of A. baumannii, which was isolated before 1949; strains of ST52 were previously included in AFLP cluster C [37].
Strains that have been subjected to genome sequencing were mapped onto the MLST population framework by retrieving their MLST gene sequences. The three strains AB0057 [38], AB307-0294 [38] and AYE [39], [40] fell into ST1, consistent with their genome sequences showing >99.9% similarity at orthologous genes [38]. The multidrug resistant strain ACICU [41] fell in ST2, whereas the susceptible strain AB900 [38] fell into ST49, a double-locus variant of ST3. Finally, strain ATCC 17978 [42] isolated from a 4-month-old infant with fatal meningitis, corresponded to the singleton ST77, while the genome-decaying strain SDF [39], [40] had ST17 ( Fig. 2 ).
Comparison of MLST with AFLP data
AFLP data were obtained for A. baumannii strains of this study ( Table 3 ). In previous ‘polyphasic’ studies, combining several genotypic and phenotypic methods, a similarity level of ∼80% was deduced as the cut-off level to identify clones among sets of well-defined strains [7], [43]. Fifty-six STs and 48 AFLP types (80% cut-off) were distinguished, resulting in a similar discriminatory power (Simpson's index 91.7 vs. 91.4, respectively; 95% confidence interval 88.9 – 94.4 and 88.8 – 94.0, respectively) using this AFLP cut-off. Comparison of MLST data with AFLP data showed almost complete agreement with respect to assignment to clones ( Table 3 ). The two minor exceptions were LUH5687, clone III by AFLP, but being a double-locus variant of ST3, thus not being included in CC3; and LUH6049, a clone II strain by AFLP which showed four allelic mismatches with ST2 (but was still linked to ST2 by the MStree algorithm, Fig. 2 ). Accordingly, a vast majority of strains within CC1, CC2, CC3, CC10 and CC32 had the same AFLP type. Strains with the same ST were always of the same AFLP type, with the only exceptions of ST2 (the most frequent) and ST71 (gen. sp. 13TU). However, AFLP fingerprints in strains of ST2 and ST71 were highly similar, indicating microevolution from a common ancestor, thus being consistent with MLST.
When typing strains in hospital epidemiology, a distinct AFLP cut-off level (90%) is generally used [28]. Using this cut-off, 88 AFLP types were distinguished, resulting in a Simpson's index of 98.5%, and the central STs of the three European clones I, II and III were subdivided into three, 15 and 13 AFLP types, respectively ( Table 3 ). Thus, for local epidemiology purposes, AFLP is more discriminatory than MLST.
Antimicrobial susceptibility of clonal complexes
Susceptibility to 10 antimicrobial agents representing five antimicrobial classes was investigated. Multidrug resistance was found only in A. baumannii strains. Importantly, MDR strains were distributed into a limited number of STs, which corresponded almost exclusively to international clones including CC1, CC2, CC3 and ST15. Conversely, these clones comprised almost exclusively MDR strains ( Figure 3 ): all isolates of CC1, CC2, CC3 and ST15 were MDR except for three isolates (one in each of CC1, CC2 and CC3). MDR strains of CC1, CC2, CC3 and ST15 showed resistance to 5–8, 3–10, 6–8 and 4–10 antimicrobials, respectively. The number of different resistance profiles was 16, 18, 4, and 5, respectively (Table S1). Compared to CC1, CC2 and ST15, MDR strains of clone III were relatively homogeneous in their resistance profiles, differing only in susceptibility to ceftazidime and/or piperacillin.
Figure 3. Distribution of A. baumannii isolates according to the level of multidrug resistance and their genotype.
The isolates allocated to four multidrug resistant international clones (CC1 to CC3 and ST15; colors as on Fig. 2 ) are compared with other A. baumannii isolates. Each of the seven outbreak sets (see text) was represented by only one isolate. Note that most members of clones CC1 to CC3 and ST15 are resistant to multiple antimicrobial agents, whereas most isolates of other genotypes are not.
Seven other MDR strains belonged to ST5, ST10, ST16, ST29, ST46, ST50 and ST59. Notably, two of these MDR strains represented outbreak sets included in this study. Out of these seven outbreak sets, all but one (ST52) included MDR strains. MDR strains belonging to ST15, CC10 and ST52 are included in the AFLP clusters A, B and C, respectively, of a previous study [37].
Susceptibility testing to carbapemens showed nine strains that were resistant to imipenem and were also resistant to meropenem (Table S1). These carbapenem-resistant strains were found exclusively in CC2 (7 strains) or ST15 (2 strains).
Discussion
The main purpose of this study was to determine the population structure of A. baumannii and to characterize the genetic diversity and distinctness of groups of isolates previously ascribed to international clones. In addition, we determined the extent of phylogenetic distinctness of A. baumannii from other species. Our results demonstrate a striking contrast between the low amounts of average nucleotide divergence within A. baumannii (0.35%) and the large genetic distance of this species from gen. sp. 13TU (4.65%), its closest relative. This result is consistent with recent findings [25], [35] and fully supports the taxonomic distinction of these two sequence clusters [44].
The average genetic divergence between A. baumannii isolates (0.35%) is comparable to e.g. Klebsiella pneumoniae (0.37%) [45], but both are atypically homogeneous compared to many bacterial species, including other nosocomial pathogens such as Escherichia coli [46], [47]. Whereas strains within typical bacterial species can diverge by up to 5% at orthologous genes [48], no pair of A. baumannii strains was found to diverge by more than 0.77% (i.e., roughly 3 nucleotide differences per gene portion on average), even though our isolates were selected to represent the breadth of currently known genetic diversity of A. baumannii.
Low amounts of polymorphism may indicate that A. baumannii experienced a severe bottleneck (i.e., a reduction of population size) relatively recently, with little time having elapsed since then for diversity to accumulate again. One hypothesis would be that the bottleneck was a consequence of a narrow ecological niche of A. baumannii. Indeed, this species seems relatively rare in human carriage and almost never found in soil [2]. Other Acinetobacter species have a broader distribution as soil dwellers or as commensals of human skin [2]. Thus, if the ecological niche of A. baumannii were more restricted than that of other species, its population size may have been contracted by ecological changes that reduced its habitat. The lack of phylogenetic structure within the species is consistent with the simultaneous diversification of multiple lineages due to rapid population expansion following a bottleneck, resulting in a star-like phylogeny. An alternative possibility would be that clinical isolates of A. baumannii do not fully represent the diversity of the species, and instead constitute a restricted subset that acquired the ability to colonize and infect humans. Recent studies reported A. baumannii from animals and vegetables [2], [49], [50], and the metabolic versatility of a clone I isolate [40] is indicative of adaptation to diverse habitats. It will be very important to assess the diversity of isolates from non-clinical sources to better understand A. baumannii population structure, ecology and epidemiological dynamics.
Identification of species of the Acb complex using phenotypic methods is difficult [31], [51], while validated genotypic identification methods, such as amplified 16S ribosomal DNA restriction analysis [52] or AFLP analysis [53] require reference databases for identification and are not widely applied. Sequence-based methods provide clear advantages for identification [35], [54]. Sequencing of a single gene already provides good identification confidence, given that no case of strain misplacement was found in the seven individual gene phylogenies, in contrast to other bacterial groups such as genera Streptococcus and Neisseria (e.g., [32]). The apparent absence or rarity of sequence replacement may indicate a loss of ability for homologous recombination, even though the genes for natural competence are present in A. baumannii [40] and strains of A. baumannii clearly are able to incorporate foreign DNA. Alternately, it is possible that an ecological barrier, which would limit opportunity for DNA exchange, has arisen between Acinetobacter species following adaptation towards distinct niches. Still, identification based on at least two genes should be considered more reliable, as horizontal gene transfer can theoretically happen and would lead to wrong identification. In addition, multiple genes buffer against the distorting effect of recombination on phylogenies, as was observed for rplB.
MLST analysis of A. baumannii strains revealed a high degree of discrimination, consistent with previous MLST studies [24], [25]. The selected housekeeping genes were successfully amplified and sequenced in all strains of A. baumannii, A. calcoaceticus, gen. sp. 3 and gen. sp. 13TU, as well as in the distant gen. sp. 13BJ and 15BJ, suggesting applicability of this MLST scheme to many Acinetobacter species. Strain discrimination among strains of species other than A. baumannii was also found previously [24], [25].
Clonal groups within bacterial species often differ by their biological properties, such as virulence or epidemicity [21]–[23]. Typically, these groups are identified by determining phylogenetic relationships among MLST genotypes based on allelic profiles ( Fig. 2 ), rather than nucleotide sequences (Fig. S2), as the former approach is less sensitive to strong distortions caused by homologous recombination [21]. The MStree analysis revealed only five clonal complexes, three of which (CC1 to CC3) corresponded to international clones I to III. For consistency, we baptized as ST1, ST2 and ST3 their central and most prevalent genotypes, which most likely represent the founder of their group [21]. Our results now show formally that clones I – III correspond to typical MLST clonal complexes that can readily be demarcated from other A. baumannii genotypes. Thus, MLST data fully confirm the clonal nature of clones I to III, which was initially inferred from several characteristics including PFGE, protein profile, AFLP or ribotyping [7], [8]. In addition, because the genetically central genotype is numerically highly dominant within each CC (with an extreme situation of ST15), our data are suggestive of very fast clonal expansions, with too little time having elapsed to allow genetic differentiation of many variants. These results thus fit with epidemiological knowledge gathered over the two last decades, as countless reports of outbreaks caused by multiresistant isolates of clones I to III reflect their rapid clonal spread.
Recent evidence shows that beyond the three early recognized clones I to III, multiple clones of A. baumannii have large geographic distributions [18], [19]. ST15, CC10, ST52 and CC32 can be regarded as novel international clones, and they correspond to previously identified AFLP clusters A, B and C [37] and cluster 6 [7], respectively. Rather than giving roman numerals or letters to novel widespread clones, we would recommend to follow the widely successful MLST-based naming system, which proved convenient for other bacterial species [21], [22], [55], [56]. Clones are simply designated by their ST or CC number, with clonal complexes being numbered after the ST number of their central and/or more prevalent genotype (e.g., CC1 to CC3 for clones I to III, respectively). We propose that MLST characterization should be used as a reference to compare A. baumannii strains across studies, as is now the case in nearly 100 bacterial species (mlst.net; pubmlst.org; mlst.ucc.ie; www.pasteur.fr/mlst). For this purpose, a publicly available A. baumannii MLST web site was set-up at www.pasteur.fr/mlst.
We estimated the ratio of recombined to mutated nucleotides during the diversification of clonal complexes [57] at 1.3 (four alleles with two changes, attributed to recombination, versus 6 alleles with one change only, attributed to mutation), similar to the recombination/mutation ratio estimated using the bayesian method ClonalFrame (0.96; confidence interval 0.63 – 1.45). These results indicate that A. baumannii is not a highly recombining species, even though it should be noted that detection of recombination is difficult due to the very low polymorphism of A. baumannii. Therefore, clones defined as widespread STs or CCs are likely to be genetically stable and recognizable over very long periods of time (possibly in the order of thousands or more years), as in other bacterial species with low or moderate homologous recombination rates [58]. It is therefore predictable that isolates can belong to the same ST and be genomically highly similar [38] even though they were isolated decades apart (see members of ST1, ST2 and ST52; Table 3 ). The genetic diversity within the three major international clones is comparable to that observed e.g. for serovar Typhi of Salmonella enterica, which age has been estimated at 50,000 years [59] (even if determining the age of bacterial lineages is highly debatable [60], [61]).
There is rapidly growing genome-wide evidence that members of a single clone can differ by the presence or absence of resistance genes, resistance islands and mobile elements [38]–[41], [62]. For example, several structures of the resistance island are distinguished among clone I members [17], [38], [39] and integron structures and resistance gene content can differ among members of same clone from different geographic regions, while the same mobile elements can be transferred horizontally between members of distinct clones [63]. Hence, MLST genotypes can be regarded as evolutionary vessels with a stable core genome, while their accessory genome, including resistance determinants, undergo rapid evolution. As a consequence, finer typing of isolates that belong to widespread clones is highly necessary for epidemiological purposes and to distinguish within clones, subtypes with particular gene content, phenotype and geographic distribution [64].
The evolutionary success of the international clones currently remains unexplained. Among the distinctive characteristics of the international clones, multidrug resistance to antimicrobial agents is clearly the most salient, as noted early [7], [9], [10]. There is a strong dichotomy in the A. baumannii population between these clones and other members of the species, which are mostly susceptible and only occasionally cause infection. This emphasizes that not all A. baumannii strains are a priori problematic in the hospital setting [28]. Comparisons of features that could favor the widespread clones as colonizers or pathogens in hospitals, such as resistance to desiccation [65] or disinfection [66], biofilm formation [67] or adherence to human cells [68], have so far failed to distinguish isolates belonging to successful clones from other genotypes. Hence, antimicrobial resistance may represent the main reason for the evolutionary success of international clones. Possibly, an increased propensity of these clones to colonize and cause infection in humans exposed them to increased levels of antimicrobials. Alternately, these particular clones may be more prone to acquire foreign genetic material. It will be interesting to determine whether large resistance islands detected in members of clones I and II [17], [38], [39], [41] are a distinctive feature of widespread clones, and whether these clones are carried more frequently by humans, even if at low levels.
It is not yet clear whether the association of multidrug-resistance and clones results primarily from the spread of already established MDR strains, or rather from independent acquisition of resistance determinants by susceptible strains of the same clone. The former scenario can possibly be applied to clone III, which except for one fully susceptible strain, showed nearly identical resistance profiles and genotypes and included recent isolates [63]. In contrast, the situation in clone I, clone II and ST15 is more complex and may result from the fact that these clones are older and thus have undergone many genetic events associated with resistance determinants. Different selection pressures and genetic pools providing resistance determinants, as well as instability of some resistance determinants, all could contribute in explaining the observed intra-clonal diversity.
In conclusion, our study shows that A. baumannii populations of clinical isolates have a genetically highly homogeneous core genome. The phylogenetic structure is indicative of two disjoint waves of expansion: the first wave followed a severe bottleneck that occurred at some undetermined time in the distant past, while a second wave is now developing through the rapid expansion of a limited number of multi-resistant clones that become highly problematic as nosocomial infectious agents.
Materials and Methods
Bacterial strains
A total of 173 Acinetobacter strains were characterized ( Table 3 ). Most isolates were from clinical origin and were, with few exceptions, collected between 1987 and 2005, mainly in European countries. First, 123 genotypically distinct and epidemiologically unrelated A. baumannii strains (‘diversity set’) were included. These isolates were selected from ∼600 isolates (excluding outbreak replicates) from the Leiden University Medical Center AFLP database, such that the selection displayed the maximal diversity at the 90% AFLP similarity cut-off level, and was also diverse in time-space origin. Previous studies have used the ∼80% AFLP similarity level as a cut-off for defining major clones [43]. Thus, the diversity set included 25 strains of the international (previously named ‘European’) clone I, 30 of clone II, and 15 of clone III ( Table 3 ). Second, 24 additional A. baumannii isolates from 7 outbreaks for which one representative was included in the diversity set, were investigated for reproducibility and epidemiological concordance. Isolates of each of the seven outbreaks had an AFLP similarity ≥90% and were from the same time-space origin. Apart from these, there were 48 additional A. baumannii isolates of the diversity set that were from known outbreaks ( Table 3 ). These isolates were considered to represent an outbreak if they shared with other isolates a common time-space origin and a common genotype and/or a common antibiotic susceptibility profile. Isolates were not considered to be part of an outbreak ( Table 3 ) if local data (typing and epidemiology) showed no evidence for this. If there was no indication that a strain belonged to an outbreak or not, they were labeled as ‘outbreak unknown’. Third, we included the seven A. baumannii strains (ATCC 17978, AYE, SDF, ACICU, AB0057, AB307-0294 and AB900) for which a complete genome sequence was published; the sequences of the gene portions corresponding to the MLST templates were extracted from the genome sequences [38]–[42]. Finally, we included 15 isolates of the species that are closely related to A. baumannii (A. calcoaceticus, A. gen. sp. 3 and 13TU), and four isolates of Acinetobacter gen. sp. 13BJ and 15BJ (used as outgroups for the phylogenetic analysis).
AFLP
AFLP data were generated as described [28]. DNA was digested with EcoRI and MseI simultaneously with adapter ligation. PCR was done with a Cy5-labelled EcoRI+A primer and a MseI+C primer (A and C, selective nucleotides). Amplified fragments were separated with the ALF II express system (Amersham Biosciences, Roosendaal, The Netherlands). Digitized fingerprints were analyzed using Pearson's coefficient as a similarity measure and unweighted pair group method with arithmetic mean (UPGMA) linkage for clustering with BioNumerics software 4.1 (Applied-Maths, St-Martens-Latem, Belgium).
Antimicrobial susceptibility testing
Susceptibility was tested by disc diffusion following the CLSI recommendations using Mueller–Hinton agar (Oxoid, Basingstoke, UK) and 10 antimicrobial agents, which are primarily effective against A. baumannii [37]. The resistance breakpoints were adjusted according to the known distribution of inhibition zone diameters among A. baumannii strains. These values were identical to those of the CLSI for intermediate susceptibilities except for tetracycline and piperacillin, for which the CLSI values for resistance were used. The agents (µg per disc; resistance breakpoint in mm) included ampicillin+sulbactam (10+10; ≤14), piperacillin (100; ≤17), ceftazidime (30; ≤17), imipenem (10; ≤15), gentamicin (10; ≤14), tobramycin (10; ≤14), amikacin (30; ≤16), ofloxacin (5; ≤15), sulfamethoxazole+trimethoprim (23.75+1.25; ≤15) and tetracycline (30; ≤14) (Oxoid). Multidrug resistance was defined as resistance to at least one representative of three or more of the five classes of antimicrobial agents, i.e. beta-lactams, aminoglycosides, fluoroquinolones, tetracyclines or the combination of sulfonamide and diaminopyrimidine.
Multilocus Sequence Typing (MLST)
Primer pairs were designed for PCR amplification and sequencing of internal portions of seven housekeeping genes ( Table 4 ). Three of these pairs (cpn60, gltA and recA) were designed by Bartual et al. [24]. Primer pairs for three other genes, which are present in most bacterial phyla (fusA, pyrG and rplB), were designed by adapting, using the A. baylyi and A. baumannii genome sequences, the primers initially proposed by Santos and Ochman [69]. Finally, primers for gene rpoB were designed previously [70]. The portion of rpoB that was amplified with these primers corresponds to positions 1,681 to 2,136. These genes represent seven distinct loci on the A. baumannii chromosome ( Table 4 ). The internal gene portions chosen for MLST allele and profile definition ranged in length from 297 bp (pyrG) to 633 bp (fusA). Further details on this MLST scheme can be found at www.pasteur.fr/mlst. Nucleotide sequences were obtained using Big Dye version 1.1 chemistry on an ABI 3730XL apparatus.
Table 4. Primers used for MLST.
| Locus | Putative function of gene | Forward primer | Reverse primer | Location (a) |
| cpn60 (b) | 60-KDa chaperonin | 5′- ACTGTACTTGCTCAAGC -3′ | 5′- TTCAGCGATGATAAGAAGTGG -3′ | 3,089,652–3,089,248 |
| fusA | protein elongation factor EF-G | 5′- ATCGGTATTTCTGCKCACATYGAT -3′ | 5′- CCAACATACKYTGWACACCTTTGTT -3′ | 1,008,107–1,008,739 |
| gltA (b) | citrate synthase | 5′- AATTTACAGTGGCACATTAGGTCCC -3′ | 5′- GCAGAGATACCAGCAGAGATACACG -3′ | 3,143,730–3,143,248 |
| pyrG | CTP synthase | 5′- GGTGTTGTTTCATCACTAGGWAAAGG -3′ | 5′- ATAAATGGTAAAGAYTCGATRTCACCMA -3′ | 2,201,622–2,201,326 |
| recA (b) | homologous recombination factor | 5′- CCTGAATCTTCYGGTAAAAC -3′ | 5′- GTTTCTGGGCTGCCAAACATTAC -3′ | 2,274,422–2,274,793 |
| rplB | 50S ribosomal protein L2 | 5′- GTAGAGCGTATTGAATACGATCCTAACC -3′ | 5′- CACCACCACCRTGYGGGTGATC -3′ | 3,557,351–3,557,022 |
| rpoB | RNA polymerase subunit B | 5′- GGCGAAATGGCDGARAACCAC -3′ | 5′- GARTCYTCGAAGTTGTAACC -3′ | 307,298–307,753 |
(a) On Acinetobacter baumannii ATCC17978, complete genome (NC009085).
(b) Primers from Bartual et al., 2003.
Data analysis
Sequence chromatograms were edited and stored using BioNumerics v5.10. To achieve high levels of confidence on each nucleotide substitution, all nucleotides within the internal gene portion chosen for MLST analysis were supported by at least two sequence chromatograms. For a given locus, a novel allele number was attributed to each distinct sequence, and a distinct sequence type (ST) number was attributed to each distinct combination of alleles at the seven genes. Allele sequences and allelic profiles are available on Institut Pasteur's MLST web site at www.pasteur.fr/mlst. Relatedness between the different STs was investigated based on comparison of allelic profiles using the minimum spanning tree (MStree) method from BioNumerics. We used the classical criterion of one allelic mismatch to group STs into clonal complexes [21]. Nucleotide diversity was calculated using DNAsp v4 [71]. MEGA [72] was used to compute and draw phylogenetic trees using the Jukes and Cantor substitution model. Simpson's index was calculated using the web resource www.comparingpartitions.info. ClonalFrame analysis was performed following the developer's instructions [73].
Supporting Information
Individual gene phylogenies. Phylogenetic analysis of 173 Acinetobacter strains of several named and unnamed species, based on seven individual genes using the neighbor-joining method with Jukes-Cantor distance. Symbols as on Figure 1.
(0.11 MB PDF)
Intra-specific phylogenetic structure of A. baumannii. An unrooted neighbor-joining phylogenetic analysis of concatenated sequences of the seven MLST genes was performed. Numbers at the tip of the branches correspond to the sequence type (ST) number. Clones I to III (CC1 to CC3) are circled.
(0.08 MB PPT)
Antimicrobial susceptibility of A. baumannii isolates.
(0.01 MB PDF)
Acknowledgments
We are indebted to Sylvie Issenhuth-Jeanjean for technical help, to Tanny vd Reijden and Beppie van Strijen for performing AFLP analysis and for strain collection management, and Martina Maixnerová for antimicrobial susceptibility testing. We thank Chantal Bizet (Collection de l'Institut Pasteur) for providing reference strains, and colleagues who contributed strains to the Leiden Acinetobacter collection over the years: Jon Iredell, Kevin Towner, Rossi Dobrewski, Seamus Fanning, Tyrone Pitt, Jaap Wagenaar, Gerda Noordhoek, Peter Gerner-Smidt, Marta Wroblewska, Jan Arends, Mario Vaneechoutte, Jan Haagsma, Anneke van der Zee, Jane Turton, Ingela Tjernberg, Alfons Horrevorts, Richard Spence, Roland Brimicombe, and Lodewijk Spanjaard.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: Platform Genotyping of Pathogens and Public Health is supported by Institut Pasteur and the Institut de Veille Sanitaire; this work received, in addition, financial support from a generous gift by the Conny-Maeva Charitable Foundation. AN was supported by grant 310/08/1747 of the Grant Agency of the Czech Republic. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Bergogne-Berezin E, Towner KJ. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev. 1996;9:148–165. doi: 10.1128/cmr.9.2.148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev. 2008;21:538–582. doi: 10.1128/CMR.00058-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2007;5:939–951. doi: 10.1038/nrmicro1789. [DOI] [PubMed] [Google Scholar]
- 4.Hoffmann MS, Eber MR, Laxminarayan R. Increasing resistance of Acinetobacter species to imipenem in United States hospitals, 1999-2006. Infect Control Hosp Epidemiol. 2010;31:196–197. doi: 10.1086/650379. [DOI] [PubMed] [Google Scholar]
- 5.Dijkshoorn L, Aucken HM, Gerner-Smidt P, Kaufmann ME, Ursing J, et al. Correlation of typing methods for Acinetobacter isolates from hospital outbreaks. J Clin Microbiol. 1993;31:702–705. doi: 10.1128/jcm.31.3.702-705.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Seltmann G, Beer W, Claus H, Seifert H. Comparative classification of Acinetobacter baumannii strains using seven different typing methods. Zentralbl Bakteriol. 1995;282:372–383. doi: 10.1016/s0934-8840(11)80707-3. [DOI] [PubMed] [Google Scholar]
- 7.Dijkshoorn L, Aucken H, Gerner-Smidt P, Janssen P, Kaufmann ME, et al. Comparison of outbreak and nonoutbreak Acinetobacter baumannii strains by genotypic and phenotypic methods. J Clin Microbiol. 1996;34:1519–1525. doi: 10.1128/jcm.34.6.1519-1525.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.van Dessel H, Dijkshoorn L, van der Reijden T, Bakker N, Paauw A, et al. Identification of a new geographically widespread multiresistant Acinetobacter baumannii clone from European hospitals. Res Microbiol. 2004;155:105–112. doi: 10.1016/j.resmic.2003.10.003. [DOI] [PubMed] [Google Scholar]
- 9.Nemec A, Janda L, Melter O, Dijkshoorn L. Genotypic and phenotypic similarity of multiresistant Acinetobacter baumannii isolates in the Czech Republic. J Med Microbiol. 1999;48:287–296. doi: 10.1099/00222615-48-3-287. [DOI] [PubMed] [Google Scholar]
- 10.Brisse S, Milatovic D, Fluit AC, Kusters K, Toelstra A, et al. Molecular surveillance of European quinolone-resistant clinical isolates of Pseudomonas aeruginosa and Acinetobacter spp. using automated ribotyping. J Clin Microbiol. 2000;38:3636–3645. doi: 10.1128/jcm.38.10.3636-3645.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Nemec A, Dijkshoorn L, van der Reijden TJ. Long-term predominance of two pan-European clones among multi-resistant Acinetobacter baumannii strains in the Czech Republic. J Med Microbiol. 2004;53:147–153. doi: 10.1099/jmm.0.05445-0. [DOI] [PubMed] [Google Scholar]
- 12.Spence RP, van der Reijden TJ, Dijkshoorn L, Towner KJ. Comparison of Acinetobacter baumannii isolates from United Kingdom hospitals with predominant Northern European genotypes by amplified-fragment length polymorphism analysis. J Clin Microbiol. 2004;42:832–834. doi: 10.1128/JCM.42.2.832-834.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Da Silva G, Dijkshoorn L, van der Reijden T, van Strijen B, Duarte A. Identification of widespread, closely related Acinetobacter baumannii isolates in Portugal as a subgroup of European clone II. Clin Microbiol Infect. 2007;13:190–195. doi: 10.1111/j.1469-0691.2006.01628.x. [DOI] [PubMed] [Google Scholar]
- 14.Wisplinghoff H, Edmond MB, Pfaller MA, Jones RN, Wenzel RP, et al. Nosocomial bloodstream infections caused by Acinetobacter species in United States hospitals: clinical features, molecular epidemiology, and antimicrobial susceptibility. Clin Infect Dis. 2000;31:690–697. doi: 10.1086/314040. [DOI] [PubMed] [Google Scholar]
- 15.Ecker JA, Massire C, Hall TA, Ranken R, Pennella TT, et al. Identification of Acinetobacter species and genotyping of Acinetobacter baumannii by multilocus PCR and mass spectrometry. J Clin Microbiol. 2006;44:2921–2932. doi: 10.1128/JCM.00619-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Turton JF, Kaufmann ME, Gill MJ, Pike R, Scott PT, et al. Comparison of Acinetobacter baumannii isolates from the United Kingdom and the United States that were associated with repatriated casualties of the Iraq conflict. J Clin Microbiol. 2006;44:2630–2634. doi: 10.1128/JCM.00547-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Post V, Hall RM. AbaR5, a large multiple-antibiotic resistance region found in Acinetobacter baumannii. Antimicrob Agents Chemother. 2009;53:2667–2671. doi: 10.1128/AAC.01407-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2009 doi: 10.1093/jac/dkp428. [DOI] [PubMed] [Google Scholar]
- 19.Mugnier PD, Poirel L, Naas T, Nordmann P. Worldwide dissemination of the blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg Infect Dis. 2010;16:35–40. doi: 10.3201/eid1601.090852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, et al. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother. 2006;50:4114–4123. doi: 10.1128/AAC.00778-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Feil EJ. Small change: keeping pace with microevolution. Nat Rev Microbiol. 2004;2:483–495. doi: 10.1038/nrmicro904. [DOI] [PubMed] [Google Scholar]
- 22.Maiden MC. Multilocus sequence typing of bacteria. Annu Rev Microbiol. 2006;60:561–588. doi: 10.1146/annurev.micro.59.030804.121325. [DOI] [PubMed] [Google Scholar]
- 23.Spratt BG. Exploring the concept of clonality in bacteria. Methods Mol Biol. 2004;266:323–352. doi: 10.1385/1-59259-763-7:323. [DOI] [PubMed] [Google Scholar]
- 24.Bartual SG, Seifert H, Hippler C, Luzon MA, Wisplinghoff H, et al. Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii. J Clin Microbiol. 2005;43:4382–4390. doi: 10.1128/JCM.43.9.4382-4390.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wisplinghoff H, Hippler C, Bartual SG, Haefs C, Stefanik D, et al. Molecular epidemiology of clinical Acinetobacter baumannii and Acinetobacter genomic species 13TU isolates using a multilocus sequencing typing scheme. Clin Microbiol Infect. 2008;14:708–715. doi: 10.1111/j.1469-0691.2008.02010.x. [DOI] [PubMed] [Google Scholar]
- 26.Seifert H, Schulze A, Baginski R, Pulverer G. Plasmid DNA fingerprinting of Acinetobacter species other than Acinetobacter baumannii. J Clin Microbiol. 1994;32:82–86. doi: 10.1128/jcm.32.1.82-86.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.van Dessel H, Kamp-Hopmans TE, Fluit AC, Brisse S, de Smet AM, et al. Outbreak of a susceptible strain of Acinetobacter species 13 (sensu Tjernberg and Ursing) in an adult neurosurgical intensive care unit. J Hosp Infect. 2002;51:89–95. doi: 10.1053/jhin.2002.1212. [DOI] [PubMed] [Google Scholar]
- 28.van den Broek PJ, van der Reijden TJ, van Strijen E, Helmig-Schurter AV, Bernards AT, et al. Endemic and epidemic Acinetobacter species in a university hospital: an 8-year survey. J Clin Microbiol. 2009;47:3593–3599. doi: 10.1128/JCM.00967-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tjernberg I, Ursing J. Clinical strains of Acinetobacter classified by DNA-DNA hybridization. Apmis. 1989;97:595–605. doi: 10.1111/j.1699-0463.1989.tb00449.x. [DOI] [PubMed] [Google Scholar]
- 30.Bouvet PJ, Grimont PA. Identification and biotyping of clinical isolates of Acinetobacter. Ann Inst Pasteur Microbiol. 1987;138:569–578. doi: 10.1016/0769-2609(87)90042-1. [DOI] [PubMed] [Google Scholar]
- 31.Gerner-Smidt P, Tjernberg I, Ursing J. Reliability of phenotypic tests for identification of Acinetobacter species. J Clin Microbiol. 1991;29:277–282. doi: 10.1128/jcm.29.2.277-282.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hanage WP, Fraser C, Spratt BG. Fuzzy species among recombinogenic bacteria. BMC Biol. 2005;3:6. doi: 10.1186/1741-7007-3-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Bishop CJ, Aanensen DM, Jordan GE, Kilian M, Hanage WP, et al. Assigning strains to bacterial species via the internet. BMC Biol. 2009;7:3. doi: 10.1186/1741-7007-7-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Palys T, Nakamura LK, Cohan FM. Discovery and classification of ecological diversity in the bacterial world: the role of DNA sequence data. Int J Syst Bacteriol. 1997;47:1145–1156. doi: 10.1099/00207713-47-4-1145. [DOI] [PubMed] [Google Scholar]
- 35.Gundi VA, Dijkshoorn L, Burignat S, Raoult D, La Scola B. Validation of partial rpoB gene sequence analysis for the identification of clinically important and emerging Acinetobacter species. Microbiology. 2009;155:2333–2341. doi: 10.1099/mic.0.026054-0. [DOI] [PubMed] [Google Scholar]
- 36.Orskov F, Orskov I. From the national institutes of health. Summary of a workshop on the clone concept in the epidemiology, taxonomy, and evolution of the enterobacteriaceae and other bacteria. J Infect Dis. 1983;148:346–357. doi: 10.1093/infdis/148.2.346. [DOI] [PubMed] [Google Scholar]
- 37.Nemec A, Maixnerova M, van der Reijden TJ, van den Broek PJ, Dijkshoorn L. Relationship between the AdeABC efflux system gene content, netilmicin susceptibility and multidrug resistance in a genotypically diverse collection of Acinetobacter baumannii strains. J Antimicrob Chemother. 2007;60:483–489. doi: 10.1093/jac/dkm231. [DOI] [PubMed] [Google Scholar]
- 38.Adams MD, Goglin K, Molyneaux N, Hujer KM, Lavender H, et al. Comparative genome sequence analysis of multidrug-resistant Acinetobacter baumannii. J Bacteriol. 2008;190:8053–8064. doi: 10.1128/JB.00834-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Fournier PE, Vallenet D, Barbe V, Audic S, Ogata H, et al. Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLoS Genet. 2006;2:e7. doi: 10.1371/journal.pgen.0020007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Vallenet D, Nordmann P, Barbe V, Poirel L, Mangenot S, et al. Comparative analysis of Acinetobacters: three genomes for three lifestyles. PLoS One. 2008;3:e1805. doi: 10.1371/journal.pone.0001805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Iacono M, Villa L, Fortini D, Bordoni R, Imperi F, et al. Whole-genome pyrosequencing of an epidemic multidrug-resistant Acinetobacter baumannii strain belonging to the European clone II group. Antimicrob Agents Chemother. 2008;52:2616–2625. doi: 10.1128/AAC.01643-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Smith MG, Gianoulis TA, Pukatzki S, Mekalanos JJ, Ornston LN, et al. New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis. Genes Dev. 2007;21:601–614. doi: 10.1101/gad.1510307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Dijkshoorn L, Nemec A. Gerischer U, editor. The diversity of the genus Acinetobacter. Acinetobacter molecular microbiology: Caister Academic Press. 2008. pp. 1–34.
- 44.Hanage WP, Fraser C, Spratt BG. Sequences, sequence clusters and bacterial species. Philos Trans R Soc Lond B Biol Sci. 2006;361:1917–1927. doi: 10.1098/rstb.2006.1917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Brisse S, Fevre C, Passet V, Issenhuth-Jeanjean S, Tournebize R, et al. Virulent clones of Klebsiella pneumoniae: identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS One. 2009;4:e4982. doi: 10.1371/journal.pone.0004982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Wirth T, Falush D, Lan R, Colles F, Mensa P, et al. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006;60:1136–1151. doi: 10.1111/j.1365-2958.2006.05172.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Jaureguy F, Landraud L, Passet V, Diancourt L, Frapy E, et al. Phylogenetic and genomic diversity of human bacteremic Escherichia coli strains. BMC Genomics. 2008;9:560. doi: 10.1186/1471-2164-9-560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Konstantinidis KT, Ramette A, Tiedje JM. The bacterial species definition in the genomic era. Philos Trans R Soc Lond B Biol Sci. 2006;361:1929–1940. doi: 10.1098/rstb.2006.1920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Berlau J, Aucken HM, Houang E, Pitt TL. Isolation of Acinetobacter spp. including A. baumannii from vegetables: implications for hospital-acquired infections. J Hosp Infect. 1999;42:201–204. doi: 10.1053/jhin.1999.0602. [DOI] [PubMed] [Google Scholar]
- 50.La Scola B, Raoult D. Acinetobacter baumannii in human body louse. Emerg Infect Dis. 2004;10:1671–1673. doi: 10.3201/eid1009.040242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Bouvet P, Grimont P. Taxonomy of the genus Acinetobacter with the recognition of Acinetobacter baumanii sp. nov., and Acinetobacter junii sp. nov. and emended descriptions of Acinetobacter calcoaceticus and Acinetobacter lwofii. Int J Syst Bacteriol. 1986;36:228–240. [Google Scholar]
- 52.Vaneechoutte M, Dijkshoorn L, Tjernberg I, Elaichouni A, de Vos P, et al. Identification of Acinetobacter genomic species by amplified ribosomal DNA restriction analysis. J Clin Microbiol. 1995;33:11–15. doi: 10.1128/jcm.33.1.11-15.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Janssen P, Maquelin K, Coopman R, Tjernberg I, Bouvet P, et al. Discrimination of Acinetobacter genomic species by AFLP fingerprinting. Int J Syst Bacteriol. 1997;47:1179–1187. doi: 10.1099/00207713-47-4-1179. [DOI] [PubMed] [Google Scholar]
- 54.Nemec A, Musilek M, Maixnerova M, De Baere T, van der Reijden TJ, et al. Acinetobacter beijerinckii sp. nov. and Acinetobacter gyllenbergii sp. nov., haemolytic organisms isolated from humans. Int J Syst Evol Microbiol. 2009;59:118–124. doi: 10.1099/ijs.0.001230-0. [DOI] [PubMed] [Google Scholar]
- 55.Maiden MC, Bygraves JA, Feil E, Morelli G, Russell JE, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A. 1998;95:3140–3145. doi: 10.1073/pnas.95.6.3140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Enright MC, Spratt BG. Multilocus sequence typing. Trends Microbiol. 1999;7:482–487. doi: 10.1016/s0966-842x(99)01609-1. [DOI] [PubMed] [Google Scholar]
- 57.Feil EJ, Maiden MC, Achtman M, Spratt BG. The relative contributions of recombination and mutation to the divergence of clones of Neisseria meningitidis. Mol Biol Evol. 1999;16:1496–1502. doi: 10.1093/oxfordjournals.molbev.a026061. [DOI] [PubMed] [Google Scholar]
- 58.Feil EJ, Spratt BG. Recombination and the population structures of bacterial pathogens. Annu Rev Microbiol. 2001;55:561–590. doi: 10.1146/annurev.micro.55.1.561. [DOI] [PubMed] [Google Scholar]
- 59.Kidgell C, Reichard U, Wain J, Linz B, Torpdahl M, et al. Salmonella typhi, the causative agent of typhoid fever, is approximately 50,000 years old. Infect Genet Evol. 2002;2:39–45. doi: 10.1016/s1567-1348(02)00089-8. [DOI] [PubMed] [Google Scholar]
- 60.Achtman M. Evolution, population structure, and phylogeography of genetically monomorphic bacterial pathogens. Annu Rev Microbiol. 2008;62:53–70. doi: 10.1146/annurev.micro.62.081307.162832. [DOI] [PubMed] [Google Scholar]
- 61.Kuo CH, Ochman H. Inferring clocks when lacking rocks: the variable rates of molecular evolution in bacteria. Biol Direct. 2009;4:35. doi: 10.1186/1745-6150-4-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Nemec A, Krizova L, Maixnerova M, Diancourt L, van der Reijden TJ, et al. Emergence of carbapenem resistance in Acinetobacter baumannii in the Czech Republic is associated with the spread of multidrug-resistant strains of European clone II. J Antimicrob Chemother. 2008;62:484–489. doi: 10.1093/jac/dkn205. [DOI] [PubMed] [Google Scholar]
- 63.Nemec A, Dolzani L, Brisse S, van den Broek P, Dijkshoorn L. Diversity of aminoglycoside-resistance genes and their association with class 1 integrons among strains of pan-European Acinetobacter baumannii clones. J Med Microbiol. 2004;53:1233–1240. doi: 10.1099/jmm.0.45716-0. [DOI] [PubMed] [Google Scholar]
- 64.Turton JF, Matos J, Kaufmann ME, Pitt TL. Variable number tandem repeat loci providing discrimination within widespread genotypes of Acinetobacter baumannii. Eur J Clin Microbiol Infect Dis. 2009;28:499–507. doi: 10.1007/s10096-008-0659-3. [DOI] [PubMed] [Google Scholar]
- 65.Jawad A, Seifert H, Snelling AM, Heritage J, Hawkey PM. Survival of Acinetobacter baumannii on dry surfaces: comparison of outbreak and sporadic isolates. J Clin Microbiol. 1998;36:1938–1941. doi: 10.1128/jcm.36.7.1938-1941.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Wisplinghoff H, Schmitt R, Wohrmann A, Stefanik D, Seifert H. Resistance to disinfectants in epidemiologically defined clinical isolates of Acinetobacter baumannii. J Hosp Infect. 2007;66:174–181. doi: 10.1016/j.jhin.2007.02.016. [DOI] [PubMed] [Google Scholar]
- 67.Wroblewska MM, Sawicka-Grzelak A, Marchel H, Luczak M, Sivan A. Biofilm production by clinical strains of Acinetobacter baumannii isolated from patients hospitalized in two tertiary care hospitals. FEMS Immunol Med Microbiol. 2008;53:140–144. doi: 10.1111/j.1574-695X.2008.00403.x. [DOI] [PubMed] [Google Scholar]
- 68.Lee JC, Koerten H, van den Broek P, Beekhuizen H, Wolterbeek R, et al. Adherence of Acinetobacter baumannii strains to human bronchial epithelial cells. Res Microbiol. 2006;157:360–366. doi: 10.1016/j.resmic.2005.09.011. [DOI] [PubMed] [Google Scholar]
- 69.Santos SR, Ochman H. Identification and phylogenetic sorting of bacterial lineages with universally conserved genes and proteins. Environ Microbiol. 2004;6:754–759. doi: 10.1111/j.1462-2920.2004.00617.x. [DOI] [PubMed] [Google Scholar]
- 70.Salerno A, Deletoile A, Lefevre M, Ciznar I, Krovacek K, et al. Recombining population structure of Plesiomonas shigelloides (Enterobacteriaceae) revealed by multilocus sequence typing. J Bacteriol. 2007;189:7808–7818. doi: 10.1128/JB.00796-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Rozas J, Sanchez-DelBarrio JC, Messeguer X, Rozas R. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 2003;19:2496–2497. doi: 10.1093/bioinformatics/btg359. [DOI] [PubMed] [Google Scholar]
- 72.Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
- 73.Didelot X, Falush D. Inference of bacterial microevolution using multilocus sequence data. Genetics. 2007;175:1251–1266. doi: 10.1534/genetics.106.063305. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Individual gene phylogenies. Phylogenetic analysis of 173 Acinetobacter strains of several named and unnamed species, based on seven individual genes using the neighbor-joining method with Jukes-Cantor distance. Symbols as on Figure 1.
(0.11 MB PDF)
Intra-specific phylogenetic structure of A. baumannii. An unrooted neighbor-joining phylogenetic analysis of concatenated sequences of the seven MLST genes was performed. Numbers at the tip of the branches correspond to the sequence type (ST) number. Clones I to III (CC1 to CC3) are circled.
(0.08 MB PPT)
Antimicrobial susceptibility of A. baumannii isolates.
(0.01 MB PDF)



