A miR-21 hairpin structure-based gene knockdown vector

Abstract

RNA interference (RNAi) is widely used to study gene functions as a reverse genetic means from first-generation siRNA to second-generation short hairpin RNA (shRNA) or the newly developed microRNA (shRNA-miR). Here we report a gene knockdown vector system based on the mouse miR-21 hairpin structure. In this system, the pre-miRNA hairpin of the miR-21 gene was modified by replacing the 22-nucleotide mature sequence with shRNA sequences that target genes of interest, flanked by 160-bp upstream and 65-bp downstream sequences of the mouse pre-miR-21. We tested this system by knocking down the enhanced green fluorescence protein (EGFP) reporter gene using different vectors, in which shRNA-miR was driven by the polymerase II (pol II) promoter. We found that miR-21 hairpin-based the shRNA-miR can be directly placed under pol II promoter, like UbC or CMV promoter to knockdown the gene of interest. To facilitate the wide application of the miR-21hairpin-based gene knockdown system, we further knocked down the endogenous gene lamin (A/C), which showed that endogenous lamin A/C expression can be efficiently silenced using the miR-21 hairpin -based lentiviral vector. The miR-21hairpin-based gene knockdown vector will provide a new genetic tool for gene functional studies in vitro and in vivo.

Introduction

RNA interference (RNAi) is a natural cellular process that regulates gene expression and maintains cellular homeostasis [1]. Small interference RNA (siRNA) has been utilized as a reverse genetic tool for gene functional studies. From the first-generation oligo-based siRNA to the second-generation short hairpin shRNA or shRNA-miR, siRNA has emerged as a powerful approach in silencing gene expression in vitro and in vivo. In shRNA-miR, the hairpin structure was derived from an endogenous miRNA gene in which mature miRNA sequence in pre-miRNA was replaced with the target gene sequence. Compared with shRNA-based gene knockdown, the shRNA-miR structure showed several advantages: 1) shRNA-miR-mediated gene knockdown has been shown to be more efficient as a natural way, where the shRNA-miR may join the biogenesis pathway at the pri-miRNA stage, whereas the shRNAs are at the pre-miRNA level. It was reported that 12-fold more siRNA was generated when the same siRNA sequence was embedded in a shRNA-miR structure than in a shRNA structure under the control of the same promoter U6[2]. It was thought that the upstream step may enhance the functional coupling of miRNA biogenesis and the efficiency of subsequent steps [2,3]. 2) shRNA-miR can be driven by the polymerase II promoter, which provides more flexibility in designing the knockdown constructs, in which the coding gene, such as a reporter gene can be expressed simultaneously with the shRNA-miR hairpin as an indicator to track the target cells. Moreover, multiple shRNA-miR structures can be expressed from a single transcript without compromising their processing or inhibitory efficacy [4]. 3) Additional experimental evidence showed that the shRNA structure driven by the polymerase III promoter H1 or U6 leads to cellular toxicity, whereas the shRNA-miR structure does not [5,6,7]. In previous studies, it was shown that it would lead to the inefficient gene silencing if the miR-30-based shRNA-miR structure was placed upstream of a coding gene or reporter gene and directly driven by the cytomegalovirus (CMV) promoter[4]. An artificial miR-155 shRNA-miR hairpin was also cloned downstream of the EGFP reporter gene in a commercialized vector (Invitrogen; Carlsbad, California). Recently we found that a secondary hairpin structure, negatively regulated gene expression when it was placed downstream of a reporter gene, namely in the 3′ untranslated region such as in miR-30 and miR-155 based system. The lentivirus produced from this type of vector structure displayed a reduced reporter gene expression. We designed a miR-21 hairpin based gene knockdown vector in which we placed an artificial miR-21 hairpin-based shRNA-miR against the target gene upstream of the EGFP reporter gene under the control of the human ubiquitin C (UbC) or CMV promoter. We tested endogenous gene knockdown by silencing human lamin A/C expression. We showed that it does not require a distance between hairpin structure and promoter in the case of a modified miR-21 hairpin structure. In addition, we also found that it had no effect on the reporter gene expression when the artificial miR-21 hairpin structure was placed upstream of a reporter gene in a knockdown vector. A miR-21 hairpin based knockdown vector provided a new genetic tool in designing gene knockdown vector. The shRNA-miR-based knockdown approach is a technically simpler and quicker alternative for reverse genetics compared with traditional gene knockout, which is a high-cost, time-consuming, and technically complicated process. Previously, it was shown that the knockout phenotype in mice can be replicated in knockdown mice and knockdown rats [8,9]. The shRNA-miR structure makes it feasible to generate knockdown animal models or create graded hypomorphic models using a drug-inducible system. Therefore, the miR-21 hairpin-based gene knockdown vector will be highly valuable in generating knockdown mice or rats, especially rats, whose embryonic stem cells are not readily available for gene knockout studies.

Materials and Methods

Cell culture

HeLa cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS (Hyclone, Logan, UT), 100 U/ml penicillin, and 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA). HEK293 FT cells were cultured in DMEM media with 10% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin, 1% glutamine, 1% nonessential amino acid, and geneticin with a final concentration of 1 μg/ml.

Construction of lentiviral vectors to express miR-21 gene

To overexpress the miR-21 gene, pri-miR-21 with 400bp upstream and 135bp downstream flanking sequence was amplified from mouse genomic DNA using the primers 5′CGCTCTAGAGTACTCCGGCTTTAACAGG 3′ (forward) and 5′GCGGATCCGACTGCAAACCATGATGCT 3′(reverse). In order to evaluate whether the flanking sequence has an impact on the expression of miR-21, we also amplified a fragment by shortening the pri-miR-21 flanking sequence, from 160bp upstream to 65bp downstream, using the primers 5′CGCTCTAGATCGTGGTCGTGACATCGCATG (forward) and 5′GCGGATCCGGATGGTCAGATGAAAGATACC (reverse). Pre-miR-21 sequences with two different up and downstream flanking sequences were cloned into the XbaI and BamHI sites, immediate downstream of UbC promoter in the pcFUW-EGFP lentiviral vector (kind gift of Dr. Lois Calos, MIT), to generate the pcFUW-400-miR-21-EGFP and pcFUW-160-miR-21-EGFP, respectively. In addition, we also constructed a lentiviral vector, pcFUW-EGFP-160-miR-21, in which the pre-miR-21 sequence with the 160bp short flanking sequence was inserted into the 3′ untranslated region (UTR) of the EGFP reporter gene.

Development of mouse miR-21 hairpin -based knockdown vector

To develop a mouse miR-21 hairpin -based gene knockdown vector, the pri-miR-21 with 160bp upstream and 65bp downstream sequences was further modified by replacing the mature miR-21 sequence (22 bp) with the target sequence and keeping the rest of sequence intact, including the miR-21 hairpin loop. To test mouse miR-21 hairpin-based knockdown in a lentiviral vector, we designed a shRNA-miR structure against the EGFP reporter gene. A 98bp oligonucleotides, 5′CTGTACCACCTTGTCGGAGCAAGCTGTGCCCAAGTTCCTGTTGAATCTCATGGGAACTTCA GGGTCAGCTTGCTCTGACATTTTGGTATCT was synthesized as a template for polymerase chain reaction (PCR). The sequence included a partial flanking sequence, the miR-21 gene hairpin, and the target sequence (italics) against EGFP. For the control, the sequence synthesized against luciferase gene was,5′CTGTACCACCTTGTCGGATCACTTACGCTGAGTACTTCGACTGTTGAATCTCATGGTCGAAGTACTCAGCGTAAGTGATCTGACATTTTGGTATCT. PCR was performed by using the universal primers 5′GGCTCTAGATCGTGGTCGTGACATCGCATGGCTGTACCACCTTGTCGG (forward) and 5′GCGGATCCGGATGGTCAGATGAAAGATACCAAAATGTCAGA (reverse). The conditions for PCR were as follows: denatured at 94°C for 2 min, followed by 25 cycles of 94°C for 20 s, 55°C for 30s, and 70°C for 45s. The 120bp PCR product was purified through agarose gel and digested with both XbaI and BamHI, then cloned into the XbaI and BamHI sites of the pcFUW-pgk-puro lentiviral vector to construct a mouse miR-21 hairpin-based EGFP knockdown vector, pcFUW-miR21EGFPkd-pgk-puro. The same PCR products against EGFP and luciferase were also cloned into XbaI and BamHI sites of pcDNA3.1 to construct pcDNA3.1-miR-21-EGFPkd and pcDNA3.1-miR21LUCkd, respectively.

Construction of shRNA structure-based knockdown vector by targeting EGFP reporter gene

To compare the knockdown efficiency of the miR-21 hairpin-based shRNA-miR, and a shRNA hairpin structure, we designed a shRNA hairpin structure against the EGFP reporter gene using the same target sequence. Two oligonucleotides, 5′CTAGACGCAAGCTGACCCTGAAGTTCTTCAAGAGAGAACTTCAGGGTCAGCTTGCTTTTTT GGAA3′ and 5′ATCTTCCAAAAAAGCAAGCTGACCCTGAAGTTCTCTCTTGAAGAACTTCAGGGTCAGCTTG CGT, were synthesized and annealed, then cloned into the XbaI and BamHI sites of pcFUW-hU6-pgk-puro (UTHSC Viral Vector Core Lab) to construct the EGFP knockdown shRNA-based lentiviral vector pcFU6W-EGFPkd-pgk-puro. In this vector, the shRNA hairpin structure was driven by the human U6 promoter.

Construction of miR-21hairpin -based shRNA-miR lentiviral vector for lamin A/C gene knockdown

To further test whether the miR-21 hairpin-based shRNA-miR structure is capable of knocking down the endogenous gene, we constructed a miR-21 hairpin-based human lamin A/C knockdown lentiviral vector. A97-bp oligonucleotide, CTGTACCACCTTGTCGGACTGGACTTCCAGAAGAACACTGTTGAATCTCATGGTGTTC TTCTGGAAGTCCAGTCTGACATTTTGGTATCT was synthesized as the template, and PCR was performed using the same miR-21 universal primers as we described above. The final miR-21 hairpin-based lamin A/C shRNA-miR structure was inserted into the XbaI and BamHI sites upstream of the EGFP reporter gene in the lentiviral vector pcFUW-EGFP-pkg-puro.

Lentiviral vector production

The lentiviral vectors were produced in 293FT cells by cotransfection of the lentiviral vectors with ViraPower Packaging Mix (Invitrogen). The supernatant was collected 60 h posttransfection and was centrifuged 15 min at 3,000g; 4°C to remove cell debris; then the supernatant was passed through a 0.45-μm filter and collected for ultracentrifugation at 50,000 g for 3 h at 4°C. The pellet was dissolved in phosphate-buffered saline (PBS) and frozen at −80°C. The viral particles were titrated in 293FT cells by counting EGFP-positive cells or using p24 ELISA assay (Perkin Elmer, Boston, MA).

PolyA tailing SYBR-Green real-time PCR

For polyA tailing real-time PCR or reverse-transcriptase PCR, 5 μg of total RNA was treated with DNase I for 15 min at room temperature (Invitrogen) and then added polyA using (polyA) polymerase (NEB; Ipswich, MA) at 37°C for 1 h. The final reaction mixtures were extracted with phenol/chloroform, precipitated with isopropanol, and redissolved in 25 μl diethylpyrocarbonate (DEPC)-treated water. PolyA-tailed RNA (6 μl) was reverse-transcribed into first-strand cDNA using Superscript III transcriptase (Invitrogen) with the oligo-dT adapter primer 5′GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3′. For PCR, 1 μl of RT product was diluted three times and used as a template in each reaction. The reverse primer was from the adapter sequence: 5′GCGAGCACAGAATTAATACGACTCAC3′ and the forward primers were specific to miR-21 mature sequences. U6 small non-coding RNA sequence was amplified as the internal control using the primers 5′GCTTGCTTCGGCAGCACATATAC (forward) and 5′TGCATGTCATCCTTGCTCAGGG3′ (reverse). The SYBR Green-based real-time PCR was performed using the LightCycler 4800 real-time PCR system (Roche Applied Science; Indianapolis, IN). The relative expression of miRNA was calculated based on the formula: 2^{ΔCtmiRNA 21-ΔCtU6}.

Immunofluorescence and Western blot

For immunofluorescence analysis, HeLa cells cultured on the coverslips were fixed for 10 min using 4% PFA at 48 h posttransfection and then washed three times with 0.1% Tween20 in PBS (PBST), followed by incubation with blocking buffer (5% normal goat serum, 3% bovine serum albumin (BSA), and 0.1% Triton-X 100 in PBS) for 1 h and anti-lamin A/C antibody (1:500 dilution, Santa Cruz Biotechnology, Santa Cruz, CA) for 2 h. After rinsing three times for 5 min each with PBST, Alexa 594 conjugated goat anti-rabbit (InVitrogen,1:200) secondary antibody was added for 1 h incubation at room temperature. Then the coverslips were mounted on slide with Vectashield medium containing DAPI (Vector Laboratories, Inc.; Burlingame, CA). The images were taken using inverted fluorescence microscopy.

For Western blot, the cell lyses were collected from lentiviral or plasmid vector-transfected or lentivirus-transduced HeLa or 293FT cells. An equal amount of protein was loaded and run in 10% SDS-PAGE gel and transferred onto a nitrocellulose transfer membrane. The membrane was blocked with 5% non-fat milk for 1 h and probed with the primary antibodies against EGFP, Lamin A/C (Santa Cruz, CA), and β-actin (Sigma St. Louis, MO,).

Results and Discussion

To understand the impact of flanking sequence on the expression of miR-21 gene, we constructed four lentiviral vectors: pcFUW-400-miR-21-EGFP, pcFUW-160-miR-21-EGFP, pcFUW-EGFP-160-miR-21, and the control lentiviral vector pcFUW-EGFP (Fig. 1A). The differences for miR-21 gene among those vectors are the flanking sequence of pre-miR-21 gene and its position relative to reporter gene EGFP while the pre-miR-21 gene was the same sequence among them(Fig.1B). Those four lentiviral vectors were transfected into 293FT cells. Expressions of pri-miR-21 and mature miR-21 were detected using polyA tailing SYBR-Green real-time RT-PCR at 48 h posttransfection. We found that the relative expression of pri-miR-21 was the highest in cells transfected with the pcFUW-EGFP-160-miR-21 vector, followed by pcFUW-160-miR-21-EGFP and pcFUW-400-miR-21-EGFP vectors. However, the expression of mature miR-21 was most efficiently produced in cells transfected with pcFUW-160-miR-21-EGFP, followed by pcFUW-400-miR-21-EGFP and pcFUW-EGFP-160-miR-21 (Fig. 1C). This result indicated that mature miR-21 was more efficiently expressed when the pre-miR-21 had a short (160 bp upstream to 35 bp downstream of pre-miR-21 sequence), than a long (400bp upstream to 135bp downstream of pre-miR-21 sequence) flanking sequence, which indicated that the negative regulatory element may exist between 400bp to 160bp upstream of pre-miR-21 sequence. The expression of reporter gene EGFP was also slightly inhibited when the pre-miR-21 gene has a long flanking sequence(Fig.1D). In addition, the expression of mature miR-21 was higher when the pre-miR-21 with short flanking sequence was inserted upstream than downstream of reporter EGFP. This results may be caused by splicing efficiency in producing mature miR-21, namely, it is less efficient while the hairpin structure is located in 3′ untranslated region(UTR) than in the intron of UBC promoter. In fact, the pri-miR-21 gene was actually in the first intron of UBC promoter when it was placed upstream of reporter gene EGFP, which may be more efficient in splicing mature miR-21.

Fig. 1. Determination of the impact of miR-21 gene flanking sequences on miR-21 expression.

A. Mouse miR-21 genes with two different flanking sequences (−400 bp to +135 bp and −160 bp to +65bp) were cloned into upstream of the reporter gene EGFP and co-expressed under the control of human UbC promoter in lentiviral vector pCFUW-EGFP, respectively. Meanwhile, the pre-miR-21 with a 160bp upstream and 65bp downstream flanking sequence was cloned into the 3′ UTR of the EGFP reporter gene. B. Mouse pre-miR-21 hairpin structure. C. The relative expressions of pri-miR-21 and mature miR-21 against non-coding small RNA U6 were detected by SYBR-Green real-time PCR in 293FT cells transfected with the control vector pcFUW-EGFP (I), miR-21 expression vector pcFUW-400-miR-21-EGFP (II), pcFUW-160-miR-21-EGFP (III), and pcFUW-EGFP-160-miR-21 (IV). D. EGFP gene expressions were detected using Western blot in control vector pcFUW-EGFP (I) and three different miR-21 lentiviral expression vectors, pcFUW-400-miR-21-EGFP (II), pcFUW-160-miR-21-EGFP (III), and pcFUW-EGFP-160-miR-21 (IV). β-actin was blotted as a loading control.

Based on our findings that the pri-miR-21 with a short flanking sequence was sufficient to produce miR-21, we developed a mouse miR-21 hairpin-based knockdown system, in which the 22nt mature miR-21 sequence was replaced with a target sequence of the gene of interest. The shRNA-miR was driven by UbC promoter (pol II). In order to test whether a miR-21 hairpin based shRNA-miR can be used for gene knockdown purpose, we initially tested this system by silencing EGFP reporter gene, which can be easily visualized under fluorescent microscopy. First, we cotransfected 293FT cells using the EGFP lentiviral knockdown vectors pcFUW-miR-21-EGFPkd-pgk-puro (Fig. 2AIII)with EGFP expression pcFUW-EGFP at 2:1, 3:1 and 5:1 ratios. The control lentiviral vector pcFUW-miR21LUCkd-pgk-puro(Fig. 2AI) was cotransfected with the pcFUW-EGFP expression vector at a 5:1 ratio. It was demonstrated that the expression of EGFP gene was silenced as dose-dependent (Fig. 2B). To compare the efficiency of knockdown of miR-21 shRNA-miR with a shRNA hairpin structure, we also cotransfected 293FT cells with a shRNA based lentiviral vector pcFU6W-EGFPkd-pgk-puro(Fig. 2AII) and miR-21 hairpin based pcFUW-miR-21EGFPkd-pgk-puro vectors with EGFP expression vector pcFUW-EGFP at the ratio of 3:1. The same control vector pcFUW-miR21LUCkd-pgk-puro was used. The expression of EGFP was visualized under fluorescent microscopy and detected by western blot at 48h posttransfection, respectively. Our results showed that miR-21--based shRNA-miR(Fig. 2CIII) was more efficient than a shRNA hairpin structure in terms of EGFP knockdown (Fig. 2CII). Our results also provide a new experimental evidence that shRNA-miR is more efficient than a shRNA structure as previous described[2].

Fig. 2. Knockodwn of EGFP expression using shRNA haipin and miR-21 hairpin-based shRNA-miR structures.

A: Lentiviral knockdown vectors: I) miR-21 hairpin based lentiviral vector and hairpin structure against luciferase. II) human polymerase III promoter U6-driven lentiviral shRNA vector and EGFP shRNA hairpin structure. III) mouse miR-21 hairpin based lentiviral vector and shRNA-miR hairpin against EGFP gene. B. dose response of miR21-based EGFP gene knockdown. pcFUW-miR21LUCkd-Pgk-puro was co-transfected with EGFP expression vector pcFUW-EGFP at ratio of 5:1(I), or pcFUW-miR21EGFPkd-pgk-puro was co-transfected-pcFUW-EGFP with 2:1 (II), 3:1 (III) and 5:1 (IV) ratios. EGFP expression was detected by Western Blot analysis using anti-GFP antibody. β-actin was blotted as a loading control. C. Comparison of EGFP knockdown efficiency by shRNA and miR21-based shRNA-miR system. Up panel: EGFP fluoresence was visualized in 293FT cells transfected with control vector pcFUW-miR-21LUCkd –pgk-puro(I), pcFU6W- EGFPkd-pgk-puro (II) and pcFUW-miR21EGFPkd-pgk-puro (III) with EGFP expression vector pcFUW-EGFP. Down panel: EGFP expression was detected by Western blot analysis from uppanel. D. Knockdown of EGFP expression using miR21 hairpin-based shRNA-miR directly followed CMV promoter. I: pcDNA3.1-miR-21LUCkd, as a control. II: pcDNA3.1-miR-21-EGFPkd.

To facilitate the wide application of miR-21 based shRNA-miR system, we also cloned miR-21 hairpin-based EGFP shRNA-miR structure into a pCDNA3.1 plasmid vector by silencing EGFP expression. In this vector, miR-21 hairpin-based shRNA-miR against the EGFP gene was inserted directly downstream of the CMV promoter. When cotransfected with EGFP expression vector pcFUW-EGFP in 293FT cells, it was clearly demonstrated that the expression of EGFP was efficiently suppressed (Fig. 2D). It has been reported that knockdown was not efficient when the miR-30-based shRNA-miR was directly placed under the CMV promoter, which requires a distance between promoter and miR-30 based shRNA-miR[4]. However, we found that this was not the case in miR-21 hairpin-based knockdown vector. The miR-21 hairpin-based shRNA-miR can be directly placed under a polymerase II promoter or by placing it downstream of a reporter gene, which didn’t affect the efficiency of gene knockdown. Moreover, the miR-21 hairpin-based shRNA-miR can be easily transferred into any gene expression vector to knockdown the gene expression. We have transferred miR-21 shRNA-miR into an adenoviral shuttle vector, driven by tetracycline inducible promoter Tet and constructed an inducible adenoviral vector knockdown vector, which can be used to efficiently knockdown the gene. We have tested this adenoviral inducible system based on miR-21 based shRNA-miR structure by silencing EGFP expression(data not shown).

To test knockdown of the miR-21 hairpin-based shRNA-miR using lentivirus, we cotransduced 1 MOI of EGFP-expressing lentivirus with either 5, 10, or 15 MOI of miR-21 hairpin shRNA-miR lentivirus against EGFP in HeLa cells and tested EGFP knockdown. The negative control is miR-21 hairpin based shRNA-miR against luciferase gene and 15 MOI was used to cotransduce with 1 MOI of EGFP lentivirus. The expression of EGFP gene was visualized under fluorescent microscopy and detected by western blot, which showed the silencing effect was dose-dependent (Fig. 3A,B,C,D, E).

Fig. 3. Knockdown of EGFP expression using lentivirus in HeLa cells.

A. HeLa cells transduced with 5 MOI of pcFUW-LUCkd-pgk-puro control vector and 1 MOI of pcFUW-EGFP cotransduced HeLa cells in light field. B. EGFP green fluoresence visualized from A. C: Morphology of HeLa cells transduced with 5 MOI of pcFUW-EGFPkd-pgk-puro and 1 MOI of control vector pcFUW-EGFP in light field. D. EGFP expression from C was silenced under fluorescence microscopy. E. EGFP expression in HeLa cells was detected by Western blot after co-transduction with 1 MOI pcFUW-EGFP with 15 MOI control vector pcFUW-miR21LUCkd-pgk-puro (I) and different MOI of EGFP knockdown viruses pcFUW-miR21EGFPkd 5(II), 10(III) and 15(IV), respectively.

To further evaluate miR-21 hairpin-based shRNA-miR knockdown system, we constructed a miR-21 hairpin shRNA-miR lentiviral vector to knockdown the human lamin A/C gene expression. In this vector, miR-21 hairpin-based shRNA-miR was cloned upstream of the EGFP reporter and co-expressed to monitor the efficacy of knockdown and track the knockdown cells under the control of the UbC promoter (Fig. 4A). We transiently transfected HeLa cells using the lentiviral vector pcFUW-miR-21Laminkd for lamin A/C knockdown and the control vector pcFUW-miR21-LUCkd for luciferase. Cells were fixed at 48 h posttransfection. The expression of lamin A/C was detected using immunofluorescence staining. The cells expressing EGFP displayed a low signal in the pcFUW-miR21Laminkd vector-transfected cells, but not in the untransfected cells and cells transfected with the control vector pcFUW-miR21LUCkd (Fig. 4B). To test whether lentiviral knockdown by miR-21 hairpin shRNA-miR against Lamin A/C is effective, lentiviruses produced in 293 FT cells were used for transduction. We transduced HeLa cells with 10 MOI of miR-21 hairpin-mediated shRNA-miR lentivirus against lamin A/C and used 10 MOI shRNA-miR as a control against luciferase. After 48 hours, the transduced cells were selected by adding 1ug/ml of puromycin. The puromycin resistant cells were harvested to detect the expression of LaminA/C and EGFP by Western blot. It was shown that lamin A/C was efficiently silenced whereas the expression of EGFP was unaltered (Fig. 4C).

Fig. 4. Knockdown of endogenous lamin A/C using miR-21 hairpin-based lentiviral knockdown vector.

A. miR-21 hairpin-based lamin A/C knockdown lentiviral vector and shRNA-miR hairpin against human lamin A/C. B. Lamin A/C expression was detected in individual cells by indirect immunostaining using lamin A/C antibody. C. Lamin A/C knockdown was detected by Western blot following transduction using 10 MOI of lamin A/C knockdown virus and puromycin selection.

In this work, we created a new shRNA-miR knockdown system which is based on miR-21 gene structure. Comparing with current used miR-30-based gene knockdown system, the miR-21 hairpin-based gene knockdown sequences can be directly placed downstream of pol II promoter, like CMV or UbC, or after a reporter gene, without losing gene knockdown efficiency and inhibiting reporter gene expression. The miR-21shRNA-miR knockdown vector provides a new tool to facilitate the wide applications of shRNA-miR knockdown vector in gene functional studies in vitro and in vivo.