Abstract
Pathogens endure and proliferate during infection by exquisitely coping with the many stresses imposed by the host to prevent pathogen survival. Recent evidence has shown that fungal pathogens and yeast respond to insults to the endoplasmic reticulum (ER) by initiating Ca2+ influx across their plasma membrane. Although the high affinity Ca2+ channel, Cch1, and its subunit Mid1, have been suggested as the protein complex responsible for mediating Ca2+ influx, a direct demonstration of the gating mechanism of the Cch1 channel remains elusive. In this first mechanistic study of Cch1 channel activity we show that the Cch1 channel from the model human fungal pathogen, Cryptococcus neoformans, is directly activated by the depletion of intracellular Ca2+ stores. Electrophysiological analysis revealed that agents that enable ER Ca2+ store depletion promote the development of whole cell inward Ca2+ currents through Cch1 that are effectively blocked by La3+ and dependent on the presence of Mid1. Cch1 is permeable to both Ca2+ and Ba2+; however, unexpectedly, in contrast to Ca2+ currents, Ba2+ currents are steeply voltage-dependent. Cch1 maintains a strong Ca2+ selectivity even in the presence of high concentrations of monovalent ions. Single channel analysis indicated that Cch1 channel conductance is small, similar to that reported for the Ca2+ current ICRAC. This study demonstrates that Cch1 functions as a store-operated Ca2+-selective channel that is gated by intracellular Ca2+ depletion. The inability of cryptococcal cells that lacked the Cch1-Mid1 channel to survive ER stress suggests that Cch1 and its co-regulator, Mid1, are critical players in the restoration of Ca2+ homeostasis.
Keywords: Calcium, Calcium/Cellular Regulation, Calcium/Channels, Membrane/Channels, Signal Transduction, Cryptococcus neoformans, Endoplasmic Reticulum Stress, Endoplasmic Reticulum, Fungal Pathogen
Introduction
Store-operated Ca2+ (SOC)2 entry is a process whereby Ca2+ influx across the eukaryotic plasma membrane results from the depletion of Ca2+ from endoplasmic reticulum (ER) stores (1–6). Stresses imposed on the ER can promote a prolonged depletion of Ca2+ that will lead to cell death unless ER Ca2+ levels are replenished (1–3). All lower eukaryotes including the model fungal pathogen, Cryptococcus neoformans, express the Cch1-Mid1 channel (CMC) in their plasma membrane (7–11). C. neoformans is a primary human pathogen because it causes life-threatening meningitis primarily in immunocompromised patients (12, 13). Its ability to survive in low [Ca2+] environments is dependent on the combined activity of Cch1, the predicted pore of the channel complex, and Mid1, a binding partner of Cch1 (7, 14, 20). Genetic analysis has indicated that strains of C. neoformans lacking CCH1 or MID1 were not viable in conditions of limiting extracellular [Ca2+], consistent with its role as the only high affinity Ca2+ channel in the plasma membrane (7, 14).
Treatment of fungal cells with azole antifungals led to an influx of extracellular Ca2+ that promoted the survival of fungi exposed to azole-induced stress (16–19). Because azoles promote ER stress by blocking ergosterol biosynthesis, it had been proposed that the depleted state of Ca2+ stores might activate CMC where it could then function to refill Ca2+ stores (16, 17). This notion was reinforced by experiments demonstrating that changes in secretory Ca2+ levels promoted the influx of extracellular 45Ca2+ possibly through CMC in yeast (20); however, the gating mechanism of Cch1 channel activity has yet to be established.
Resolving channel gating is best accomplished by patch clamp techniques because these techniques can successfully determine specific kinetic parameters of ion channels such as channel selectivity, channel conductance, and activation kinetics (21). We had previously applied patch clamp techniques directly to isolated spheroplasts of C. neoformans to resolve Cch1 function by measuring Cch1 channel activity straightaway; however, this approach was burdened with many technical difficulties that led to inconsistencies in Cch1 channel measurements. Consequently, the expression of Cch1 in a heterologous expression system such as the HEK293 (human embryonic kidney) mammalian cell line appeared to be the best approach that would permit direct functional analysis of the Cch1 channel. Unfortunately, the measurement of Cch1 channel activity in a heterologous expression system had been impossible until recently because of the significant challenge posed by the molecular cloning of CCH1 as a result of the toxicity of the CCH1 gene or gene product in Escherichia coli cells (8). For this reason, standard molecular biological techniques that used E. coli as a host could not be used, and therefore we devised a new approach that ultimately led to the successful cloning of CCH1 and its functional expression (22).
In the present study we report the first electrophysiological characterization and mechanistic study of Cch1 channel activity. The functional expression of Cch1 along with its subunit Mid1 revealed that the Cch1 channel is directly activated by ER-stressing agents that deplete ER Ca2+ levels, suggesting that Cch1 is gated by the passive depletion of intracellular Ca2+ and that it functions primarily to restore Ca2+ homeostasis. Consequently, cryptococcal cells that lacked the Cch1 channel could not survive ER stress, suggesting a critical physiological requirement for CMC.
EXPERIMENTAL PROCEDURES
Cell Culture and Reagents
All C. neoformans var. grubii strains (H99 MATa serotype A) were recovered from 15% glycerol stocks stored at −80 °C prior to use in these experiments. The cch1Δ null mutant strain was constructed previously (7). Strains were maintained on YPD (1% yeast extract, 2% peptone, and 2% dextrose) medium. Cells of C. neoformans were cultured in YPD medium at 30 °C for 24 h. Cells from the HEK293 cell line were cultured in Dulbecco's modified Eagle's medium with 10% calf serum and antibiotics in a 5% CO2 incubator at 37 °C. HEK293 cells were purchased from ATCC (CRL-1573). Where indicated, a cell-impermeable form of BAPTA (Invitrogen) was added to YPD. Tunicamycin, fluconazole, and ketoconazole (Sigma-Aldrich) were dissolved in dimethyl sulfoxide at the concentrations noted in the figure legends. Thapsigargin and BAPTA-AM were purchased from Calbiochem and BAPTA from Invitrogen.
Construction of the Null Mutant Strains
Gene disruption cassettes were generated to knock down Mid1 and create the mid1Δ single mutant and the cch1Δmid1Δ double mutant. The URA5 (uracil) nutritional marker was amplified by PCR (with primers: Ura5-Ssp1-F: CCC AATATT gatcttgggg atggtattga and Ura5R-Ssp1-R: CCC AATATT gatcccagtactacccgctc) and cloned into the middle of pCR2.1-MID1 vector to disrupt the MID1 open reading frame. This disruption cassette was transferred to a wild type C. neoformans strain by biolistic transformation as described previously (23). Colonies appeared after 3 days on −URA dropout medium (0.01% adenine, 0.2% yeast synthetic dropout medium without uracil, 0.5% ammonium sulfate, 0.17% yeast nitrogen base without amino acids and ammonium sulfate, 2% Bacto Agar) supplemented with 1 m sorbitol. The mid1Δ mutant strain was confirmed by PCR. Southern blot analysis was performed to confirm a single integration in the knock-out strain.
A similar approach was taken to construct the cch1Δmid1Δ double mutant strain; however, in this case the NAT marker was used to disrupt the MID1 coding region. The disruption cassette was transformed into a cch1Δ single mutant strain by biolistic transformation. Colonies appeared after 3 days on YPD + 1 m sorbitol agar plates supplemented with 0.1 mg/ml NAT plates. The cch1Δmid1Δ mutant strain was confirmed by PCR and Southern blot analysis.
Plasmids and Transfection
We had determined previously that the CCH1 gene from C. neoformans could not be cloned by standard ligation-mediated techniques that used E. coli as a host because the gene encoding Cch1 or possibly the gene product is toxic to E. coli. We have devised an alternative approach to clone CCH1 cDNA into the pcDNA3.1/CT-GFP-topo expression plasmid under the control of the constitutive mammalian cytomegalovirus promoter (Invitrogen) that bypassed the conventional enzyme-mediated ligation reactions in E. coli. The approach we used to clone CCH1 successfully has been described elsewhere (22). The Cch1 channel protein was tagged with a C-terminal GFP instead of an N-terminal GFP to avoid interfering with the localization of Cch1 to the plasma membrane of HEK293 cells. A nontagged version of a Cch1 plasmid was also constructed and used as a control to assess the effect of the GFP fusion on the kinetics of Cch1. MID1 was cloned into the pcDNA3.1/CT-GFP-topo expression plasmid using conventional molecular biological techniques. The MID1 amplicon was generated from cDNA that was synthesized by the SuperScript III First-Strand synthesis system for RT-PCR (Invitrogen) using total RNA as template with the following primers: Mid-1F: atgccagcga gagaggtgta, Mid-1R: ctatccgttacaccatctat. RNA was isolated from a culture (∼5 × 107 cells) of a wild type strain of C. neoformans var. grubii (H99). Cells were lysed with acid-washed glass beads, and total RNA was isolated and purified according to the manufacturer's instructions (RNeasy kit; Qiagen). Following blue/white colony selection, positive transformants were isolated and sequenced.
HEK293 cells were counted and trypsinized 24 h before transfection. Approximated 1.25 × 105 in 1 ml of complete medium were plated/well such that the cell density was ∼50–80% confluent on the day of transfection. Transient transfection of HEK293 cells with CCH1-GFP plasmid DNA and MID1 was performed with Lipofectamine 2000 and Plus reagents according to the manufacturer's instructions (Invitrogen). Approximately 1 μg of CCH1-GFP and MID1 plasmid DNA was added to 100 μl of Opti-MEM I-reduced serum medium and mixed with 1.75 ml of Lipofectamine 2000, and the mixture was incubated for 30 min at room temperature. The mixture was added directly to HEK293 cells that had been grown in a culture dish and maintained in Dulbecco's modified Eagle's medium supplemented with 4 mm l-glutamine, 10% fetal bovine serum. HEK293 cells were maintained at 37 °C with 5% CO2 18–24 h after transfection before assaying cells for transgene expression.
Protein Analysis
Plasma membranes from HEK293 cells expressing Cch1-GFP or Mid1-GFP were isolated according to the protocol outlined in the Qproteome plasma membrane protein kit (Qiagen). Plasma membrane preparations were separated on a 6.5% SDS-polyacrylamide gel. Western blotting for Mid1 and Cch1 was performed using a rabbit polyclonal antibody to GFP (Abcam) (1:5000) as the primary antibody followed by detection with a goat polyclonal antibody to rabbit immunoglobulin G (IgG) (1:5000) (H&L (horseradish peroxidase); Abcam).
Biotinylation of Mid1 and Cch1 was performed according to the protocol described in the Pierce cell surface biotin protein isolation kit (ThermoScientific). HEK293 cells that had been transfected with Mid1-GFP and Cch1-GFP were biotinylated according to the specifications outlined in the kit. Protein samples were separated on a 6.5% polyacrylamide gel. Western blotting for biotinylated Mid1 and Cch1 was performed as explained above.
Confocal Microscopy
To examine the localization of Mid1 and Cch1 in HEK293 cells, cells expressing plasmids containing Mid1-GFP or Cch1 were fixed in 4% paraformaldehyde for 20 min at room temperature, washed in phosphate-buffered saline and subsequently visualized with a confocal microscope. Immunofluorescence of Cch1 was performed in HEK293 cells that had been fixed in 4% paraformaldehyde and permeabilized. A primary peptide antibody against the C terminus of Cch1 (Antibodies Inc., Davis CA) was added to HEK293 cells at a dilution of 1:500. Cch1 was visualized with a secondary antibody (1:1000) conjugated with Texas Red (Abcam). Fluorescence was examined using a Carl Zeiss LSM-5 inverted confocal microscope. Mid1 and Cch1 were examined with a 488-nm and a 568-nm laser line at 40 × objective. The images were scanned and captured at a resolution of 1024 × 1024 pixels.
Patch Clamp Measurements
Experiments were performed using conventional whole cell and single channel patch clamp techniques (21). To measure currents through Cch1, HEK293 cells expressing Cch1 and Mid1 were visually selected based on bright GFP fluorescence. Currents were stimulated by passive Ca2+ store depletion with a pipette solution containing 10 μm BAPTA-AM or by activation with thapsigargin (100 μm). Recording electrodes were pulled with a vertical puller (Adams and List, New York) from borosilicate glass capillaries, coated with Sylgard, fire-polished and filled with a solution containing either BAPTA-AM or thapsigargin, 130 mm Cs+ methane sulfonate, 5 mm MgCl2, 500 μm Mg-ATP, 20 mm HEPES (pH 7.2) with CsOH. Recording electrodes had a tip resistance of ∼5 MΩ when placed in the following external solution: 2, 5, or 10 mm CaCl2 or BaCl2, 140 mm N-methyl-d-glucamine (140 mm Na+ methane sulfonate in divalent-free solution and free of N-methyl-d-glucamine), 10 mm glucose, 10 mm HEPES (pH 7.4) with NaOH. Whole cell currents were measured by voltage ramps (−120 to +60 mV lasting 200 ms) from a holding potential of −60 mV. All voltages have been corrected for liquid junction potentials. Currents were filtered at 2 kHz with a four-pole Bessel filter (Dagan) contained in the Dagan amplifier and sampled at 5 kHz. Amplifier was interfaced with a Digidata 1322A (Axon Instruments, Foster City, CA) to digitize data. All data were corrected for leak currents. For single channel measurements, the outside-out patch configuration was used. Both the extracellular and pipette solutions used for single channel recordings were the same as those used in whole cell experiments. Single channel records were obtained at voltages of −60 mV and −80 mV and sampled at 25 kHz. Currents were analyzed with pCLAMP 9.0 software (Axon) and graphed with Sigmaplot 8.0 software on an IBM 3GHz computer.
Sensitivity Spot Assays
For spot assays, four strains (wild type, mid1Δ, cch1Δ, and cch1Δmid1Δ) were cultured in YPD medium overnight at 30 °C. Cultures were pelleted and resuspended in sterile H2O. Serially diluted cells (106, 105, 104, 103, 102) were added to YPD agar plates supplemented with ER-stressing agents (tunicamycin, fluconazole, and ketoconazole) and to YPD plates supplemented with BAPTA plus the ER-stressing agents.
RESULTS
Cch1 and Mid1 Are Expressed in the Plasma Membrane of HEK293 Cells
To resolve Ca2+ currents through CMC by patch clamp techniques, HEK293 cells were co-transfected with CCH1 and MID1 (21). Prior to initiating the patch clamp studies, the expression and localization of CMC was examined in HEK293 cells. This heterologous expression system was chosen because previous attempts to resolve CMC-mediated Ca2+ currents directly in intact cells of C. neoformans and in yeast had failed. To express CMC in HEK293 cells, cDNA of MID1 or CCH1 was cloned into mammalian expression vectors, which were subsequently transfected into HEK293 cells. Detection of mRNA transcripts of Cch1 and Mid1 confirmed the expression of the channel in HEK293 cells that were previously transfected with CCH1 and MID1 (Fig. 1A). Transcripts of Cch1 and Mid1 were not detected in nontransfected HEK293 cells.
FIGURE 1.
Cch1 and Mid1 proteins are expressed in the plasma membrane of HEK293 cells. A, reverse transcription-PCR analysis detected transcripts of CCH1 and MID1 in HEK293 cells previously transfected with CCH1 and MID1 cDNA. Transcripts were not detected in nontransfected (NT) cells. Tubulin is shown as a loading control. B, Mid1 was tagged with a C-terminal GFP tag and visualized by confocal microscopy (center panel). Mid1 is expressed predominantly on the cell surface of HEK293 cells, and Mid1 co-localizes with Cch1 (right panel, merge). Immunofluorescence (Texas Red) of Cch1 (nontagged) revealed a surface distribution in HEK cells (left panel) similar to Mid1. A primary peptide antibody to the C terminus of Cch1 and a Texas Red-conjugated secondary antibody were used to visualize Cch1. Scale bars, 10 μm. C, Western blot analysis of isolated plasma membranes from HEK293 cells expressing Cch1 or Mid1 and revealed polypeptides corresponding to the predicted sizes for Cch1 (∼220 kDa) and Mid1 (monomer, ∼100 kDa; complex, ∼200 kDa). D, Western blot analysis of surface biotinylation of HEK293 cells expressing Cch1 or Mid1 revealed two distinct bands unique to the lane corresponding to Mid1 (monomer, ∼100 kDa; complex, ∼200 kDa). These bands were not detected in nontransfected HEK cells (NT). A protein band corresponding to biotinylated Cch1 could not be detected.
To assess the localization of CMC in HEK293 cells, confocal microscopy was performed. Cells expressing a Mid1-GFP fusion protein revealed a cell surface distribution of Mid1 that co-localized with Cch1 (Fig. 1B) (24). Western blot analysis of isolated plasma membranes from HEK293 cells expressing Cch1 or Mid1 revealed the presence of polypeptides corresponding to the predicted size of Cch1 and Mid1, suggesting that both proteins were indeed sufficiently expressed in HEK cells (Fig. 1C). Interestingly, under nonreducing conditions (the absence of β-mercaptoethanol) two distinct protein bands were detected for Mid1 similar to that reported for Mid1 in yeast (40). The 100 kDa band represented the Mid1 monomer, and the 200 kDa band likely corresponded to a Mid1 complex (Fig. 1C) (40). This result suggested that Mid1 likely forms an oligomer through sulfide bonding similar to Mid1 in yeast (40).
To confirm further the expression of Cch1 and Mid1 on the surface of HEK293 cells, biotinylation was performed. Western blot analysis of biotin-labeled HEK293 cells expressing Cch1 or Mid1 revealed two distinct bands corresponding to the monomer and the complex forms of Mid1 (Fig. 1D) similar to that observed in Western blots of isolated plasma membranes from HEK cells expressing Mid1 (Fig. 1C). These distinct bands were not detected in biotinylated HEK cells that did not express Mid1 or Cch1 (nontransfected HEK cells). Unfortunately, Cch1 could not be detected in Western blots from biotinylated HEK cells expressing Cch1 (Fig. 1D). Because Cch1 is such a large and bulky protein based on its predicted structure (24 transmembrane domains), it is conceivable that steric hindrance may have masked surface lysine residues thus preventing sufficient biotin from attaching. Nevertheless, the biotinylation of Mid1 confirms its expression on the surface of HEK293 cells, and the co-localization of Mid1 with Cch1 strongly suggests that Cch1 is also expressed on the surface of HEK cells.
Cch1 Is Activated by the Depletion of Intracellular Ca2+ Stores
To assess whether Cch1-mediated Ca2+ currents were activated by passive Ca2+ store depletion, the Ca2+ chelator BAPTA-AM was added to the patch pipette. This uncharged molecule permeates cell membranes, and once inside the cell the lipophilic blocking groups are cleaved by nonspecific esterases resulting in a charged form that remains trapped within the cytosol (3). Consequently, ER Ca2+ stores are eventually depleted because the chelator captures released Ca2+. Ramp protocols were used to measure the time-dependent development of Ca2+ currents through Cch1 in HEK293 cells expressing Cch1, Mid1, or both. Ca2+ store depletion resulted in the development of robust, time-dependent Cch1 channel currents with either Ca2+ or Ba2+ as the charge carrier. In this case, Ba2+ was used as a surrogate for Ca2+, a common practice when measuring Ca2+ channels (25). Notably, Ba2+ currents developed slower than Ca2+ currents. This was probably due to secondary effects of Ba2+ blocking K+ conductances and affecting the electrical potential difference across the plasma membrane thus reducing the driving force for Ba2+ influx (Fig. 2, A and B) (25). Inward Ca2+ currents through Cch1 developed promptly in response to BAPTA-AM and spontaneously declined to resting levels (Fig. 2C).
FIGURE 2.
Inward divalent currents through the Cch1 channel are activated by the depletion of Ca2+ stores. A–G, representative traces of time course of whole cell Ca2+ currents through the Cch1 channel. B, trace of Ba2+ currents through Cch1. C and E, Ca2+ and Ba2+ currents measured upon the depletion of Ca2+ stores by the addition of 10 μm BAPTA-AM or with 100 μm thapsigargin (TG) in the patch pipette. D, 10 μm La2+ in the bath solution significantly reducing Ca2+ currents through Cch1. F and G, Ca2+ currents not detected in HEK293 cells expressing either Cch1 alone (F) or Mid1 alone (G). H, average of maximum Ca2+ current levels (−80 mV) measured in HEK293 cells alone (nontransfected, NT) or expressing Cch1, Mid1 or both (n = 5). Data are expressed as means ± S.D. (error bars).
The addition of the well characterized Ca2+ channel blockers such as nifedipine and verapamil did not block Cch1-mediated currents at physiological concentrations (data not shown). Some inhibition of Cch1 Ca2+ currents was observed in the presence of nifedipine but only at very high concentrations (10 mm), suggesting that CnCch1 probably lacks the classic binding site for dihydropyridines and phenylalkyamines. In contrast, the addition of 10 μm La3+ resulted in a 75% reduction in the time-dependent inward Ca2+ currents, indicating that La3+ blocked Cch1 channel activity (Fig. 2D). The La3+-induced block of Ca2+ currents is a pharmacological hallmark of SOC channels (3, 4), further strengthening the functional similarity between CMC and SOC channels in mammalian cells.
Consistent with the stimulation of Ca2+ currents by chelation of Ca2+ from the ER, time-dependent inward Ca2+ currents through Cch1 also developed in response to thapsigargin (Fig. 2E). Thapsigargin, an inhibitor of the ER Ca2+-ATPase pump, leads to the depletion of Ca2+ stores because as Ca2+ passively leaks from the ER, Ca2+ levels are no longer balanced by reuptake (26). Store depletion-mediated inward Ca2+ currents were not detected in HEK cells that expressed either Cch1 or Mid1 alone or an empty plasmid, indicating that the activation of these Ca2+ currents was completely dependent on the co-expression of Cch1 and Mid1 and that Cch1 activity required Mid1, consistent with previous genetic evidence (Fig. 2, F–H) (12, 14, 20, 21). Importantly, Mid1 did not conduct any Ca2+ currents on its own during passive Ca2+ store depletion. The mechanism underlying the action of Mid1 on Cch1 function remains unknown.
Cch1 Is Permeable to Both Ca2+ and Ba2+
Macroscopic I-V curves demonstrated that depletion of Ca2+ stores by BAPTA-AM produced Cch1-mediated currents with either Ca2+ or Ba2+ as the charge carrier. Surprisingly, although Ca2+ and Ba2+ were both permeable, Ba2+ currents were steeply voltage-dependent. As membrane potentials became decreasingly hyperpolarized, Ba2+ currents fell to a greater extent than Ca2+ currents, resulting in a more pronounced inward rectification (Fig. 3A). The Ca2+ or Ba2+ channel currents of Cch1 were not affected by the presence of the C-terminal GFP tag on the Cch1 protein as indicated by the I-V plot (Fig. 3E). In addition, currents were not detected in HEK cells expressing empty plasmids, strongly suggesting that the Ca2+ currents detected were mediated by Cch1 (Fig. 3E). The amplitude of Cch1-mediated currents at −40 mV with Ca2+ as the charge carrier was ∼50% less than the amplitude measured at −80 mV (Fig. 3B). However, with Ba2+ the current amplitude at −40 mV was only ∼10% of the current levels detected at −80 mV, indicating that Ba2+ permeation through Cch1 was voltage-dependent. We found that Ba2+ currents were negligible at membrane potentials depolarized beyond −60 mV, whereas Ca2+ currents were detected at these same potentials, reflecting the voltage independence of Ca2+ currents through Cch1 under physiological conditions.
FIGURE 3.
Divalent and monovalent inward currents through the Cch1 channel in HEK293 cells. A, whole cell currents revealed that Cch1 is permeable to both Ca2+ (5 mm) and Ba2+ (5 mm). Arrows indicate Erev (reversal potential) for ECa and EBa. Inward current is carried by Ca2+ or Ba2+, and outward current above +40 mV is carried by Cs+. B, Ba2+ currents are voltage-dependent, whereas Ca2+ currents are voltage-independent. Current levels for Ca2+ and Ba2+ measured at −80 mV and −40 mV were plotted (n = 5). Data are expressed as means ± S.D. (error bars). C, representative single channel record of single channel Ba2+ currents through Cch1. Single channels exhibited long duration openings and a small channel conductance (∼0.08 picosiemens). D, weak Na+ current through the Cch1 channel in the absence of divalent cations. Cch1 maintains a high Ca2+ selectivity in the presence of Ca2+ and high [Na+]. E, Ca2+ or Ba2+ currents were not detected in HEK cells that had been transfected with empty plasmids as shown in the current-voltage (I-V) plot. In addition, the presence of a C-terminal GFP tag on Cch1 did not alter the channel kinetics of Cch1 as shown from the I-V plot measured from HEK cells expressing Cch1 without a GFP tag. E, Ca2+ or Ba2+ channel currents of Cch1 were not affected by the presence of the C-terminal GFP tag on the Cch1 protein as indicated by the I-V plot. Currents were not detected in HEK cells expressing empty plasmids (2) or in nontransfected HEK cells (indicated by flat I-V plots).
The voltage dependence of Ba2+ currents through Cch1 was reflected in the ensemble average of single channel records consistent with the macroscopic I-V curves (Fig. 3C). Single channel events were not detected at −60 mV with Ba2+ as the charge carrier; however, channel activity increased dramatically at −80 mV, indicating the voltage dependence of single channel Ba2+ currents through Cch1 (Fig. 3C). Single channels exhibited long duration openings with a conductance of ∼0.08 picosiemens in 10 mm Ba2+, consistent with the small channel conductance reported for CRAC channels (27).
Cch1 Maintains High Ca2+ Selectivity in the Presence of Monovalent Ions
One of the distinguishing properties of SOC channels is their highly permeability to sodium ions and other monovalent ions in the absence of divalent cations (27). We sought to determine whether CMC shared this feature with SOC channels, and therefore we tested whether Cch1 was permeable to monovalent ions in the absence or presence of divalent cations. The reversal potential of the Ba2+ inward current (EBa) in 5 mm Ba2+ was +42 ± 2 mV and +58 ± 2 mV for the Ca2+ inward current (ECa) in 5 mm Ca2+ (Fig. 3A). These values were far less positive than the predicted EBa and ECa values for experimental conditions where extracellular [Ca2+] and [Ba2+] were about 105 times higher than the [Ca2+] and [Ba2+] inside the patch pipette. These results indicated that Cs+ carried some outward current through Cch1 and in doing so made a significant contribution to the reversal potential of Cch1 by shifting the EBa and ECa to less positive values. However, Cch1 was more selective for Ca2+ than Ba2+ because Erev was more positive and closer to the equilibrium potential for Ca2+. Interestingly, Na+ conductance through Cch1 in the absence of divalent cations was negligible, and the addition of Ca2+ in the presence of Na+ resulted in large inward currents with a shift in Erev to positive potentials approaching ECa (Fig. 3D). These results indicated that unlike some SOC channels in higher eukaryotes that are highly permeable to Na+ in the absence of divalent cations, Cch1 is weakly permeable to Na+ and maintains a strong Ca2+ selectivity even in the presence of high [Na+] (4, 27).
Cryptococcal Cells Require Cch1 Activity to Survive ER Stress
To test the physiological role of the channel, strains of C. neoformans lacking a functional CMC were constructed and tested for survival with ER-stressing agents. To single out the requirement for CMC in low [Ca+], ER-stressing agents were added to YPD medium (free [Ca2+] ∼0.140 mm) where the free [Ca2+] was reduced to ∼500 nm with a cell-impermeable form of a Ca2+ chelator (BAPTA) (28, 29). Lowering [Ca2+] further rendered the CMC mutants inviable, but at ∼500 nm, low affinity Ca2+ channels and/or transporters allow for Ca2+ influx that supports viable CMC mutants (7, 20). In the presence of the ER-stressing agent tunicamycin, a wild type strain of C. neoformans showed no significant growth defect with the exception of the mid1Δ mutant (Fig. 4, A and E); however, the growth of C. neoformans strains lacking a functional CMC was severely compromised. The cch1Δ and mid1Δ single null mutants and the cch1Δmid1Δ double mutants were not viable when exposed to tunicamycin in low extracellular [Ca2+] (Fig. 4, B and F). A similar phenotype was observed in the presence of fluconazole or ketoconazole, drugs belonging to the azole class of antifungals (Fig. 4, C, D, G, and H) (30, 31). These results indicated that cryptococcal cells required CMC to survive ER stress conditions and supported the notion that the Cch1 channel plays an essential role in reestablishing Ca2+ homeostasis.
FIGURE 4.
Cch1-Mid1 channel is essential for the survival of cryptococcal cells during ER stress. Sensitivity spot assays were used to evaluate the requirement for Cch1 and Mid1 in C. neoformans during drug-induced ER stress conditions. A–D, serially diluted cells (106, 105, 104, 103, 102) from wild type, mid1Δ, cch1Δ, and cch1Δmid1Δ-null mutant strains of C. neoformans were added to YPD agar plates with ER-stressing agents, tunicamycin (75 ng/ml), fluconazole (8 μg/ml), and ketoconazole (180 ng/ml). E–H, ER-stressing agents were added to YPD plates supplemented with BAPTA (cell-impermeant), and spot assays were performed as explained above.
DISCUSSION
The results presented here demonstrate that the Cch1-Mid1 proteins constituted a functional Ca2+ channel in HEK293 cells that exhibited some features inherent to the non-voltage-gated SOC channels. This first mechanistic study of Cch1 indicates that it is a Ca2+-selective SOC channel that is gated by the depletion of intracellular Ca2+ based on the following observations: (i) inward Ca2+ currents were activated upon the passive depletion of Ca2+ with BAPTA-AM and thapsigargin at negative membrane potentials; (ii) Cch1 was permeable to Ba2+ ions; and (iii) Ca2+ currents were blocked by La3+.
It is known that in eukaryotes the ER constitutes a finite reservoir of Ca2+ primarily mobilized for signaling that must be replenished to sustain the duration of signaling and ultimately restore Ca2+ homeostasis in the ER and the cytosol (1–3, 32). In C. neoformans mediators of the Ca2+ signaling pathway, such as calcineurin, calmodulin, and the sarco (endo)plasmic reticulum Ca2+-ATPase are central to maintaining intracellular Ca2+ homeostasis while withstanding the multitude of stresses imposed by the host (33). ER stress can be detrimental to fungal cells if ER function is not restored because in addition to its crucial role in the posttranslational processing of proteins, the ER is also a key player in Ca2+ signaling (32). Here, we show that Cch1 activity plays an essential role in the survival of cryptococcal cells in response to ER stress by coupling the depleted state of ER Ca2+ stores to the influx of Ca2+ across the plasma membrane. The presence of a specific Ca2+ chelator and an inhibitor of the Ca2+-ATPase, both capable of depleting intracellular ER Ca2+ stores, led to the development of Ca2+ inward currents at negative membrane potentials, indicating that Cch1 functions primarily to replenish these stores and reestablish Ca2+ homeostasis. This is supported by studies in yeast that have suggested that the Cch1-Mid1 channel likely promotes the influx of Ca2+ during depletion of secretory Ca2+ and that this activity was necessary for yeast survival during ER-stressing conditions (17, 18, 20). The electrophysiological evidence provided here strongly supports a Ca2+ depletion gating mechanism for Cch1 and further substantiates a role for Cch1 in the process of SOC entry in lower eukaryotes (20).
Similar to other Ca2+ channels in higher eukaryotes, Cch1 was also highly permeable to barium ions. Unexpectedly, Ba2+ movement through Cch1 was voltage-dependent; however, Ca2+ influx was not. This suggested that very hyperpolarized potentials were probably needed to displace Ba2+ bound to the Cch1 pore with an incoming Ba2+ ion likely due to weak electrostatic repulsion between Ba2+ ions, thus resulting in the voltage dependence of Ba2+ influx (25). Interestingly, CRAC channels, a subtype of the voltage-independent SOC channels in mammalian cells, also exhibit a similar voltage-dependent influx of Ba2+ at negative membrane potentials (34). Our results indicate that Cch1 is not voltage-gated, and this is further supported by our previous findings demonstrating that the protein sequence of Cch1 in C. neoformans lacks the highly conserved voltage sensor motif, the hallmark of all voltage-gated channels in eukaryotic cells (7, 35–37). Moreover, the recently characterized NALCN neuronal Na+ channel, which like CnCch1 has fewer positively charged amino acids (lysine and arginine) within its voltage-sensing S4 segment and thus lacks a bona fide voltage sensor, was found to be voltage-independent (38).
The activation of Cch1-mediated Ca2+ currents required the presence of Mid1, indicating that Cch1 cannot promote Ca2+ influx independently of Mid1. This is consistent with previous genetic data that demonstrated identical phenotypic defects of strains lacking either Mid1 or Cch1 including nonviability in low [Ca2+] medium (7, 11, 15, 20). Despite the noted requirement for Mid1, its role in the functional regulation of the Cch1 channel remains unknown. Our results rule out the possibility that Mid1 is involved in the trafficking of Cch1 to the plasma membrane because Cch1 was clearly expressed in the plasma membrane of HEK293 cells independently of Mid1. In addition, recent evidence has demonstrated that the localization of Cch1 to the plasma membrane in cryptococcal cells is dependent on an elongation factor (EF3), further suggesting that Mid1 is excluded from this process (14). Under Ca2+-depleted conditions, Mid1 did not promote the influx of divalent cations when expressed on its own, indicating that Mid1 does not have any independent channel activity under these particular conditions (39). It is conceivable that Mid1 may be coupling the depleted state of intracellular Ca2+ to the activity of Cch1. This is a particularly appealing notion based on the pivotal role of STIM1 in the activation of Orai1, a non-voltage-gated, store-operated Ca2+-selective channel in mammalian cells (5). However, although Mid1 appears to have a predicted ER retention signal it does not contain any predicted Ca2+ sensor domains thus if Mid1 did function in this role, other proteins would also likely be involved.
In summary, the SOC gating mechanism of Cch1 indicates that the Cch1 channel functions primarily to replenish depleted Ca2+ levels and reestablish Ca2+ homeostasis. This enables C. neoformans to overcome ER stress-mediated events that are likely rampant during infection and colonization of the host.
Acknowledgments
We thank R. Tham for expertise with confocal microscopy, E. Blumwald for a critical assessment of the manuscript, and to S. Y. Park for technical assistance. We thank members of the laboratory for invaluable discussions.
This work was supported, in whole or in part, by National Institutes of Health Grants AI054477 and AI078848 (to A. G.).
- SOC
- store-operated Ca2+
- ER
- endoplasmic reticulum
- CMC
- Cch1-Mid1 channel
- BAPTA
- 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid cesium salt
- BAPTA-AM
- BAPTA tetraacetoxymethyl ester
- GFP
- green fluorescent protein
- CRAC
- Ca2+ release activated Ca2+.
REFERENCES
- 1.Putney J. W., Jr. (1986) Cell Calcium 7, 1–12 [DOI] [PubMed] [Google Scholar]
- 2.Putney J. W., Jr. (1990) Cell Calcium 11, 611–624 [DOI] [PubMed] [Google Scholar]
- 3.Hogan P. G., Rao A. (2007) TRENDS Biochem. Sci. 32, 235–245 [DOI] [PubMed] [Google Scholar]
- 4.Parekh A. B., Putney J. W., Jr. (2005) Physiol. Rev. 85, 757–810 [DOI] [PubMed] [Google Scholar]
- 5.Zhang S. L., Yu Y., Roos J., Kozak J. A., Deerinck T. J., Ellisman T. H., Stauderman K. A., Cahalan M. D. (2005) Nature 437, 902–905 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Feske S., Gwack Y., Prakriya M., Srikanth S., Puppel S. H., Tanasa B., Hogan P. G., Lewis R. S., Daly M., Rao A. (2006) Nature 441, 179–185 [DOI] [PubMed] [Google Scholar]
- 7.Liu M., Du P., Heinrich G., Cox G. M., Gelli A. (2006) Eukaryot. Cell 5, 1788–1796 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Paidhungat M., Garrett S. (1997) Mol. Cell. Biol. 17, 6339–6347 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hallen H. E., Trail F. (2008) Eukaryot. Cell 7, 415–424 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Zelter A., Bencina M., Bowman B. J., Yarden O., Read N. D. (2004) Fungal Genet. Biol. 41, 827–841 [DOI] [PubMed] [Google Scholar]
- 11.Fischer M., Schnell N., Chattaway J., Davies P., Dixon G., Sanders P. (1997) FEBS Lett. 419, 259–262 [DOI] [PubMed] [Google Scholar]
- 12.Mitchell T. G., Perfect J. R. (1995) Clin. Microbiol. Rev. 8, 515–548 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Casadevall A., Perfect J. R. (1998) Cryptococcus neoformans. American Society for Microbiology, Washington, D. C. [Google Scholar]
- 14.Liu M., Gelli A. (2008) Eukaryot. Cell 7, 1118–1126 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Iida H., Nakamura N., Ono T., Okumura M. S., Anraku Y. (1994) Mol. Cell. Biol. 14, 8259–8271 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Kaur R., Castaño I., Cormack B. P. (2004) Antimicrob. Agents Chemother. 48, 1600–1613 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Bonilla M., Cunningham K. W. (2003) Mol. Biol. Cell. 14, 4296–4305 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bonilla M., Nastase K. K., Cunningham K. W. (2002) EMBO 21, 2343–2353 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Edlind T., Smith L., Henry K., Katiyar S., Nickels J. (2002) Mol. Microbiol. 46, 257–268 [DOI] [PubMed] [Google Scholar]
- 20.Locke E. G., Bonilla M., Liang L., Takita Y., Cunningham K. W. (2000) Mol. Cell. Biol. 20, 6686–6694 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Hamill O. P., Marty A., Neher E., Sakmann B., Sigworth F. J. (1981) Pflugers Arch. Eur. J. Physiol. 391, 85–100 [DOI] [PubMed] [Google Scholar]
- 22.Vu K., Bautos J., Hong M. P., Gelli A. (2009) Anal. Biochem. 393, 234–241 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Davidson R. C., Cruz M. C., Sia R. A. L., Allen B., Alspaugh J. A., Heitman J. (1999) Fungal Genet. Biol. 29, 38–48 [DOI] [PubMed] [Google Scholar]
- 24.Vergara C., Latorre R., Marrion N. V., Adelman J. P. (1998) Curr. Opin. Neurobiol. 8, 321–329 [DOI] [PubMed] [Google Scholar]
- 25.Hille B. (1992) Ionic Channels of Excitable Membranes, 2nd Ed, Sinauer Associates Inc., Sunderland, MA [Google Scholar]
- 26.Rogers T. B., Inesi G., Wade R., Lederer W. J. (1995) Biosci. Rep. 15, 341–349 [DOI] [PubMed] [Google Scholar]
- 27.Kerschbaum H. H., Cahalan M. D. (1999) Science 283, 836–839 [DOI] [PubMed] [Google Scholar]
- 28.Tsien R. Y. (1980) Biochemistry 19, 2396–2404 [DOI] [PubMed] [Google Scholar]
- 29.Marks P. W., Maxfield F. R. (1991) Anal. Biochem. 193, 61–71 [DOI] [PubMed] [Google Scholar]
- 30.Odds F. C., Brown A. J. P., Gow N. A. R. (2003) Trends Microbiol. 11, 272–279 [DOI] [PubMed] [Google Scholar]
- 31.Kauffman C. A. (2006) Curr. Opin. Microbiol. 9, 483–488 [DOI] [PubMed] [Google Scholar]
- 32.Brostrom M. A., Brostrom C. O. (2003) Cell Calcium 34, 345–363 [DOI] [PubMed] [Google Scholar]
- 33.Fan W., Idnurm A., Breger J., Mylonakis E., Heitman J. (2007) Infect. Immun. 75, 3394–3405 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Bakowski D., Parekh A. B. (2007) Cell Calcium 42, 333–339 [DOI] [PubMed] [Google Scholar]
- 35.Catterall W. A. (2000) Annu. Rev. Cell Dev. Biol. 16, 521–555 [DOI] [PubMed] [Google Scholar]
- 36.Durrell S. R., Shrivastava I. H., Guy H. R. (2004) Biophys. J. 87, 2116–2130 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Long S. B., Campbell E. B., MacKinnon R. (2005) Science 309, 903–908 [DOI] [PubMed] [Google Scholar]
- 38.Lu B., Su Y., Das S., Liu J., Xia J., Ren D. (2007) Cell 129, 371–383 [DOI] [PubMed] [Google Scholar]
- 39.Kanzaki M., Nagasawa M., Kojima I., Sato C., Naruse K., Sokabe M., Ida H. (1999) Science 285, 882–886 [DOI] [PubMed] [Google Scholar]
- 40.Yoshimura H., Tada T., Ida H. (2004) Exp. Cell Res. 293, 185–195 [DOI] [PubMed] [Google Scholar]