Abstract
The transcription factor Fli-1 is implicated in the pathogenesis of both murine and human lupus. Decreased expression of Fli-1 in heterozygous (Fli-1+/−) Murphy Roths Large (MRL)/lpr mice resulted in significantly lower kidney pathological scores and markedly increased survival. In this study, bone marrow (BM) transplantation was used to investigate the role of decreased expression of Fli-1 in haematopoietic versus non-haematopoietic cell lineages in autoimmune disease development. Wild-type (WT) MRL/lpr that received BM from Fli-1+/− MRL/lpr mice had statistically significantly lower autoantibodies, less proteinuria, reduced renal disease and prolonged survival compared to WT MRL/lpr mice that received BM from WT MRL/lpr mice. Although not statistically significant, Fli-1+/− MRL/lpr mice that received BM from WT MRL/lpr mice also had lower autoantibodies and improved survival compared to WT MRL/lpr mice that received BM from WT MRL/lpr mice. Our data indicate that expression of Fli-1 in haematopoietic cell lineages has a significant effect on disease development in MRL/lpr mice.
Keywords: bone marrow transplantation, Fli-1 transcription factor, hematopoietic cells, lupus
Introduction
Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease with a wide spectrum of clinical and immunological abnormalities [1,2]. SLE is characterized by autoantibody production, arthritis, glomerulonephritis and vasculitis [1,2]. Many factors impact SLE development with a genetic predisposition coupled with environmental triggers contributing to the development of disease [3]. The Fli-1 gene is a member of the Ets gene family of transcription factors and is expressed highly in haematopoietic lineages [4,5]. Expression of Fli-1 protein was implicated in SLE in previous reports from our laboratory and others. Overexpression of the Fli-1 gene occurs in peripheral blood lymphocytes of SLE patients compared to normal healthy controls, and the level of Fli-1 expression paralleled clinical activity measurements of SLE [6]. New Zealand Black/New Zealand White (NZB/NZW) mice, a murine lupus model, had higher Fli-1 mRNA expression in splenic lymphocytes than normal control mice [6]. Two- to threefold overexpression of Fli-1 protein in transgenic mice resulted in the development of a lupus-like disease [7]. The phenotype of the Fli-1 transgenic mice included autoantibody production, renal deposition of immune complexes, glomerulonephritis, hypergammaglobulinaemia, an increased number of autoreactive T and B lymphocytes, and increased mortality [7]. Targeted disruption of the Fli-1 gene resulted in haemorrhage into the neural tube and embryonic death due in part to thrombocytopenia and inadequate vascular formation [8,9]. Heterozygous (Fli-1+/−) mice develop normally. The expression level of Fli-1 protein, including immune cells, in Fli-1+/− mice is half that found in Fli-1+/+ wild-type (WT) mice [8].
Murphy Roths Large (MRL)/MpJ-Faslpr (MRL/lpr) mice have many clinical manifestations found in human SLE [10]. Autoantibodies produced by these mice are similar in spectrum to those seen in human lupus including anti-double-stranded DNA (anti-dsDNA) antibodies and anti-Sm antibodies [10]. MRL/lpr mice develop proliferative glomerulonephritis at an early age (4–5 months) and renal failure is a primary cause of death in these mice [10]. The lpr (lymphoproliferation) phenotype is due to a defect in the fas gene, a key mediator of apoptosis [11,12]. We found that MRL/lpr mice had higher splenic Fli-1 protein expression than normal control BALB/c mice as early as 10 weeks of age [13]. We generated Fli-1+/− MRL/lpr mice with 50% reduced expression of Fli-1 protein and found that Fli-1+/− MRL/lpr mice had significantly lower serum autoantibodies and proteinuria than littermate WT MRL/lpr mice [13]. Fli-1+/− MRL/lpr mice had significantly reduced pathological renal disease and markedly prolonged survival compared to WT MRL/lpr mice.
Bone marrow (BM) transplantation is used to investigate the contribution of haematopoietic versus non-haematopoietic cell lineages in autoimmune disease development [14,15]. In this study, our aim was to investigate whether BM-derived cells play a role in the profound improvement of renal disease and survival in Fli-1+/− MRL/lpr mice. We hypothesized that, due to the more profound impact of Fli-1 deficiency on renal disease and survival than on autoantibody production, both haematopoietic cell lineages and non-haematopoietic lineages would have a greater impact on disease expression. We performed BM transplantation from Fli-1+/− MRL/lpr mice to WT MRL/lpr mice, as well as the reverse transplant, and evaluated disease development in these mice. We report here that WT MRL/lpr mice receiving BM from Fli-1+/− mice had statistically significantly lower serum autoantibodies, lower proteinurea, reduced renal disease and longer survival compared to WT MRL/lpr mice that received BM from WT MRL/lpr mice. The Fli-1+/− MRL/lpr mice receiving BM from WT MRL/lpr mice also had improved disease development compared to WT MRL/lpr mice that received BM from WT MRL/lpr mice. These findings indicate that the impact of Fli-1 on disease development in MRL/lpr mice is complex, and involves both haematopoietic cell and non-haematopoietic cell mediated mechanisms
Materials and methods
Mice
Fli-1+/− MRL/lpr mice were generated as described previously [13]. WT MRL/lpr mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Fli-1+/− MRL/lpr mice used in this study were back-crossed with WT MRL/lpr mice for 12 generations. The major histocompatibility complex (MHC) locus for MRL/lpr Fli-1+/− mice was the same as in WT MRL/lpr mice. Two groups of mice, WT MRL/lpr and Fli-1+/− MRL/lpr, were generated by breeding Fli-1+/− MRL/lpr mice with WT MRL/lpr mice. Mice were examined twice-weekly for external disease manifestations such as skin rash, ear necrosis and lymph node enlargement. All mice were housed under pathogen-free conditions at the animal facility of the Ralph H. Johnson Veterans Affairs Medical Center.
Irradiation and BM transplantation
Four groups of 10-week-old MRL/lpr mice (10–12 mice/group) were irradiated with fractionated irradiation (5 Gy X2; 4-h interval). Three h after final irradiation each mouse in the four groups received 1 million BM cells by tail vein injection. In group 1, WT MRL/lpr mice received BM from Fli-1+/− MRL/lpr mice (Fli-1+/−→ WT). In group 2, Fli-1+/− MRL/lpr mice received BM from WT MRL/lpr mice (WT → Fli-1+/−). In group 3, WT MRL/lpr mice received BM from WT MRL/lpr mice (WT → WT). In group 4, Fli-1+/− MRL/lpr mice received BM from Fli-1+/− MRL/lpr mice (Fli-1+/−→ Fli-1+/−). BM cells collected from donor mice at the age of 8 weeks.
To monitor the efficiency of irradiation, eight WT MRL/lpr mice were irradiated as above without receiving BM transplantation. This total body irradiation was performed using a 6 × 106 eV linear accelerator (Clinac 600, Varian, Palo Alto, CA, USA). BM cells were flushed from femurs using Alpha modified Eagle's medium (MEM) without deoxyribosides and ribosides, supplemented with 0·1% bovine serum albumin (BSA), penicillin and streptomycin (MP Biomedicals, Aurora, OH, USA). The sex of BM cell donors was mismatched to receivers to determine the efficiency of BM transplantation. All irradiated mice were treated with 1 mg/ml neomycin sulphate for 3 weeks while in recovery from the BM transplantation. Sera were collected from the four groups of mice 12 weeks after BM transplantation at 4-week intervals. Mice were killed at 24 weeks after BM transplantation for assessment of renal disease. BM transplantation was performed in another four groups of mice (10–12 mice/group, equal female and male) as described above, and these mice were used to assess the impact of different BM transplantation on survival.
Genotyping of the mice by polymerase chain reaction (PCR)
For genotyping of the mice, PCR was used to detect fragments of WT and Fli-1+/− allele as reported previously [13]. The primers for PCR were as follows: Fli-1 exon IX/forward primer (positions 1156–1180), GACCAACGGGGAGTTCAAAATGACG; Fli-1 exon IX/reverse primer (positions 1441–1465), GGAGGATGGGTGAGACGGGACAAAG; and Pol II/reverse primer, GGAAGTAGCCGTTATTAGTGGAGAGG. DNA was isolated from tail snips (4-week old mice) using a QIAamp Tissue kit (Qiagen, Santa Clarita, CA, USA). PCR conditions were one cycle at 94°C for 10 min followed by 35 cycles at 94°C for 1 min, 68°C for 1 min and 72°C for 1 min. A 309-base pairs (bp) fragment indicates the presence of the WT allele, and a 406-bp fragment is amplified from the mutated allele.
Fluorescent in situ hybridization (FISH)
BM cells were prepared for FISH using standard techniques. Briefly, cells were cultured overnight in Chang bone marrow culture (BMC) media (Irvine Scientific, Santa Ana, CA, USA), supplemented with penicillin and streptomycin. Then ethidium bromide (Sigma, St Louis, MO, USA) was added to the culture at a concentration of 10 µg/ml and the cells were incubated for 45 min. Next, colcemid (Invitrogen/Gibco, Grand Island, NY, USA) was added to the culture at 0·1 µg/ml and incubated for an additional 40 min. Red blood cells were disrupted in hypotonic solution buffer (0·075 M KCl). Cells were then fixed in methanol acetic acid solution at the ratio of 5 : 2. Cells were suspended in fixation buffer at 1 × 107 cells/ml. A drop of each sample was placed on a microscope slide. After air-drying, slides were then dehydrated with ethanol. Next, slides were denatured at 65°C in denaturing solution [0·6× standard saline sodium citrate (SSC) and 70% formamide]. Slides were then quenched in 70% ice-cold ethanol and dehydrated again in ethanol. BM cells were then hybridized to cyanine 3 (Cy3)-labelled mouse X-chromosome paint and fluorescein isothiocyanate (FITC)-labelled mouse Y-chromosome paint in hybridization solution (Cambio, Cambridge, UK) overnight at 37°C. Slides were then washed in Stringency Wash solution (50% formamide and 0·5 × SSC) at 45°C for 5 min. After washing twice with SSC at 45°C, the slides were incubated with wash detergent solution (4 × SSC, 0·05% Tween-20) for 4 min at 45°C, and mounted with Gelmount (Biomedia, Foster City, CA, USA) containing 125 ng/ml 4,6-diamidino-2-phenylindole (DAPI; Invitrogen-Molecular Probes, Carlsbad, CA, USA). Finally, slides were examined using a Leica epifluorescent microscope with standard epifluorescence filters for FITC, Cy3 and DAPI (Leica, Bannockburn, IL, USA). Two hundred cells were counted from each sample.
Urine albumin excretion
Mice were placed in metabolic cages for 24-h urine collection every 4 weeks, beginning at the 12 weeks of age after BM transplantation. Antibiotics (ampicillin and gentamicin from Invitrogen and chloramphenicol from Sigma) were added in collection tubes to inhibit bacterial growth. Urinary albumin excretion was determined by enzyme-linked immunosorbent assay (ELISA) as described previously [16].
Measurement of autoantibodies
Anti-dsDNA and anti-glomerular basement membrane (GBM) antibodies were measured by ELISA as described previously [13]. Briefly, 96-well ELISA plates were coated with 5 mg/ml double-stranded calf thymus DNA (Sigma) in sodium salt citrate buffer at 37°C overnight. To each well was added 200 µl of 1% BSA for blocking. After washing with phosphate-buffered saline (PBS)-T, sera were added in serial dilutions starting at 1 : 100. Horseradish peroxidase (HRP)-conjugated goat anti-mouse immunoglobulin G (IgG) (chain specific) (Sigma) was added after washing with PBS-T. Finally, substrate containing 3, 3′, 5, 5′-tetramethylbenzidene (TMB; Sigma) in 0·1 M citrate buffer (pH 4·0) and 0·015% H2O2 was added for colour development. Optical density (OD) at A380 was measured by a microtitre plate reader (Dynatech, McLean, VA, USA).
Pathology assessment of kidneys
Kidneys were removed when the mice were killed at the age of 24 weeks after BM transplantation. One kidney was fixed with 10% buffered formalin, embedded in paraffin, and then sectioned. The sections were stained with haematoxylin and eosin. The haematoxylin and eosin kidney slides were examined in a blinded fashion and graded for glomerular inflammation, proliferation, crescent formation and necrosis. Scores from 0 to 3+ (0, none; 1+, mild; 2+, moderate; and 3+, severe) were assigned for each of these features and then added together to yield a final renal pathology score. The scores for crescent formation and necrosis were doubled to reflect the severity of those lesions. The maximum score was 18. Interstitial and tubular changes were also recorded. Vasculitis was judged as either present or absent.
Statistics
The unpaired t-test was used to test for significant differences between the two groups. A P < 0·05 was considered to be statistically significant. The Mann–Whitney U-test was used when appropriate. Survival significance was determined via analysis of a survival curve with Prism software from GraphPad Software, Inc. (San Diego, CA, USA).
Results
Efficiency of irradiation
In order to confirm the efficiency of irradiation, the opposite sex donor BM cells were used when the BM transplants were performed. At the end of the study, BM cells were extracted from killed mice and hybridized to Cy3-labelled mouse X-chromosome paint and FITC-labelled mouse Y-chromosome paint to determine the percentage of BM cells that had grafted onto the hosts. As shown in Fig. 1, BM transplanted mice had more than 96% BM cells from the donors. The percentage of BM cells from donors is probably higher, as the remaining 4% of BM cells did not show clear staining by FISH. Furthermore, all eight MRL/lpr mice that did not receive BM cells died less than 2 weeks after irradiation due to lack of haematopoietic cells. These results demonstrate that our irradiation protocol is sufficient to ablate recipient BM cells.
Fig. 1.

Efficiency of bone marrow transplantation was monitored by fluorescent in situ hybridization (FISH). Bone marrow (BM) cells were taken from mice at 24 weeks after BM transplantation and prepared for FISH using standard techniques. First, cells were cultured overnight in Chang BM culture (BMC) media and incubated with 0·1 mg/ml colcemid for 40 min. A drop of cells was place on a microscope slide after being fixed with methanol and acetic acid solution. After slides were denatured at 65°C; cells were then hybridized to cyanine 2 (Cy3)-label mouse X-chromosome paint and fluorescein isothiocyanate (FITC)-labelled mouse Y-chromosome paint in hybridization solution. The nuclei were stained with 125 ng/ml 4,6-diamidino-2-phenylindole (DAPI) counterstain as described in Methods and materials. (a) BM cells from male mouse receipt with female donor. (b) BM cells from female mouse receipt with male donor.
BM from Fli-1+/− MRL/lpr mice impact autoantibodies production
To determine the role of decreased Fli-1 expression in haematopoietic BM derived cells versus non-haematopoietic cells on the profound improvement of autoantibody production, renal disease and survival in Fli-1+/− MRl/lpr mice, we performed BM transplantation from Fli-1+/− MRL/lpr donor mice to WT MRL/lpr recipient mice and evaluated disease development. BM transplantation from WT MRL/lpr mice to Fli-1+/− MRL/lpr mice was also performed to study the role of the expression of Fli-1 in non-haematopoietic cells on lupus development. There were four groups of mice: group 1 (Fli-1+/−→ WT), WT MRL/lpr mice received BM from Fli-1+/− MRL/lpr mice; group 2 (WT → Fli-1+/−), Fli-1+/− MRL/lpr mice received BM from WT MRL/lpr mice; group 3 (WT → WT), WT MRL/lpr mice received BM from WT MRL/lpr mice; and group 4 (Fli-1+/−→ Fli-1+/−), Fli-1+/− MRL/lpr mice received BM from Fli-1+/− MRL/lpr mice. An equal number of female and male mice was used in each group. There were no statistically significant differences for development of skin rash, ear necrosis and lymphadenopathy among the four groups of mice, although fewer mice in groups 1 and 3 had such disease phenotypes. Sera were collected from the mice starting at 12 weeks after BM transplantation at 4-week intervals. Autoantibodies were first detected in serum from the mice approximately 16 weeks after BM plantation (data not shown). The mice in group 1 (Fli-1+/−→ WT) had significantly lower serum autoantibody titres compared to the mice in group 3 (WT → WT) at 20 and 24 weeks after BM transplantation time-points (at 20 weeks, group 1, OD 0·407 ± 0·05 versus group 3, 0·581 ± 0·06, P = 0·0497; at 24 weeks, group 1, 0·409 ± 0·09 versus group 3, 0·728 ± 0·09, P = 0·022, Fig. 2). The mice in group 2 (WT →Fli-1+/−) also had lower autoantibody levels compared to the mice in group 3 (WT → WT), but the difference was not statistically significant.
Fig. 2.

Decrease of anti-dsDNA autoantibodies in wild-type (WT) Murphy Roths Large/lymphoproliferation (MRL/lpr) mice received bone marrow (BM) from Fli-1+/− MRL/lpr mice. Sera were collected from four groups of mice (Fli-1+/−→ WT, group 1, WT → Fli-1+/−, group 2, WT → WT, group 3 and Fli-1+/−→Fli-1+/−, group 4) at the ages of 20 and 24 weeks after BM transplantation. Each group comprised 10–12 mice. Anti-dsDNA antibodies were tested by enzyme-linked immunosorbent assay (ELISA) at 1 : 200 dilutions. Shown are optical density (OD)380 values. *P < 0·05.
BM from Fli-1+/− MRL/lpr mice affects proteinuria and renal disease
To monitor renal disease development, urine was collected from the four groups of mice at 4-week intervals starting at 12 weeks after BM transplantation. Albuminuria was first detected in the urine collected from some of the mice at 16 weeks after BM transplantation. The albuminuria was significantly lower in group 1 (Fli-1+/−→ WT) mice compared to group 3 (WT → WT) mice at the time-points of 20 and 24 weeks after BM transplantation (Fig. 3, at 20 weeks, group 1, 21·83 ± 9·7 µg/mouse/day versus group 3, 159·6 ± 49·73 µg/mouse/day, P = 0·042; at 24 weeks, group 1, 21·98 ± 6·48 µg/mouse/day versus group 3, 563·4 ± 183·2 µg/mouse/day, P = 0·0295). The group 2 mice (WT → Fli-1+/−) also had lower albuminuria at 24 weeks after BM transplantation compared to group 3 (WT → WT) mice. The mice were killed 24 weeks after BM transplantation and renal disease was assessed by a blinded observer as described in Materials and methods. As shown in Fig. 4, group 1 MRL/lpr mice (Fli-1+/−→ WT) had significantly reduced renal pathology scores compared with group 3 MRL/lpr mice (WT→WT) (group 1, 3·8 ± 1·0 versus group 3, 8·4 ± 1·44, P = 0·0244). In the kidney sections, most of the group 1 MRL/lpr mice (Fli-1+/−→ WT) had mild glomerular proliferation, inflammation and epithelial reactivity (Fig. 5b), whereas group 3 MRL/lpr mice (WT → WT) had significantly more glomerular proliferation and renal inflammation with cellular crescents and necrosis (Fig. 5a). Group 4 mice (Fli-1+/−→ Fli-1+/−) had the lowest renal scores of the four groups of mice with BM transplantation. Compared to group 3 (WT → WT) mice, group 2 mice (WT → Fli-1+/−) also had reduced renal pathological scores, although the difference is not statistically significant.
Fig. 3.

Reduced proteinuria in the wild-type (WT) Murphy Roths Large lymphoproliferation (MRL/lpr) mice received bone marrow (BM) from Fli-1+/− MRL/lpr mice. Twenty-four-h urines were collected at the ages of 20 and 24 weeks after BM transplantation from four groups of mice (group 1: Fli-1+/−→ WT, group 2: WT → Fli-1+/−, group 3: WT → WT, group 4: Fli-1+/−→ Fli-1+/−). Each group comprised 10–12 mice. Urinary protein levels were measured by albumin enzyme-linked immunosorbent assay (ELISA) and represented as µg/mouse/day. *P < 0·05.
Fig. 4.

Decreased renal pathological scores in the wild-type (WT) Murphy Roths Large lymphoproliferation (MRL/lpr) mice received bone marrow (BM) from Fli-1+/− MRL/lpr mice. The mice were killed at the age of 24 weeks after BM transplantation and kidneys were stained by the haematoxylin and eosin method. The kidneys were graded for glomerular inflammation, proliferation, crescent formation and necrosis. Scores from 0 to 3+ were assigned for each of these features and then added together to yield a final renal score. Data presented are the mean ± standard deviation. Four groups of mice received BM (group 1: Fli-1+/−→ WT, n = 9; group 2: WT → Fli-1+/−, n = 8; group 3: WT → WT, n = 7; group 4: Fli-1+/−→ Fli-1+/−, n = 10). *P < 0·05.
Fig. 5.

Reduced kidney inflammation in the wild-type (WT) Murphy Roths Large lymphoproliferation (MRL/lpr) mice received bone marrow (BM) from Fli-1+/− MRL/lpr mice. A representative kidney section from a WT MRL/lpr mouse received bone marrow from WT MRL/lpr mice with glomerular proliferation, infiltration of inflammatory cells, crescents and necrosis (a) and a representative kidney section from a WT MRL/lpr mouse received BM from Fli-1+/− MRL/lpr mouse with minimal proliferation and inflammation (b).
BM from Fli-1+/− MRL/lpr mice markedly prolong the survival
To assess the impact of reduced expression of Fli-1 in haematopoietic versus non-haematopoietic cell lineages on survival in MRL/lpr mice, an additional four groups of mice were generated and followed without manipulation. As shown in Fig. 6, by 51 weeks after BM transplantation, 50·5% of group 1 (Fli-1+/−→ WT) mice had survived compared to 24% of group 3 mice (WT → WT, P = 0·0194). The survival of group 2 (WT → Fli-1+/−) mice was also improved compared to group 3 mice, as 50% of group 3 mice died at the age of 24 weeks after BM transplantation, whereas 100% of group 2 mice survived, although the difference in overall survival was not statistically significant (P = 0·0596). As a control, 11 of 12 mice in group 4 (Fli-1+/−→ Fli-1+/−) mice survived to 51 weeks after BM transplantation.
Fig. 6.

Increased survival in wild-type (WT) Murphy Roths Large lymphoproliferation (MRL/lpr) mice received bone marrow (BM) from Fli-1+/− MRL/lpr mice. The following four groups of mice (n = 10–12 in each group) were studied for the survival (group 1: Fli-1+/−→ WT, group 2: WT → Fli-1+/−, group 3, WT → WT, group 4: Fli-1+/−→ Fli-1+/−). Group 1 (Fli-1+/−→ WT) mice had survived significantly longer compared with group 3 mice (WT → WT, P = 0·0194).
Discussion
The Fli-1 transcription factor is implicated in lupus disease development in both animal models of lupus and lupus patients [6,7,13]. In this report, we performed BM transplantation to identify the role of haematopoietic versus non-haematopoietic cell lineages with reduced Fli-1 expression in autoimmune disease development. We hypothesized that Fli-1 expression in both cell lineages would have a significant impact on disease development, as Fli-1+/− MRL/lpr mice had lower autoantibody levels than WT MRL/lpr mice, but the protection against renal disease and death was much greater than the decrease in autoantibody levels. We found, however, that WT MRL/lpr mice receiving BM from Fli-1+/− mice had significantly lower serum autoantibodies, lower proteinurea, reduced renal disease and longer survival rate compared to WT MRL/lpr mice receiving BM from WT MRL/lpr mice. Fli-1+/− MRL/lpr mice receiving BM from WT MRL/lpr mice also had reduced disease manifestations compared to WT MRL/lpr mice that received BM from WT MRL/lpr mice, although disease in these mice was more severe than the WT MRL/lpr mice that received BM from Fli-1+/1 MRL/lpr mice. These data demonstrate that decreased expression of Fli-1 in BM-derived haematopoietic cells plays a significant role on disease development in MRL/lpr mice, while expression of Fli-1 in non-haematopoeitic cells is of less significance.
Pathogenic autoantibodies play an important role in lupus disease development. Serum autoantibodies were significantly lower in WT MRL/lpr mice that received BM from Fli-1+/− MRL/lpr mice compared to WT MRL/lpr mice that received BM from WT MRL/lpr mice. The primary effect of reduced expression of Fli-1 on autoantibody production is probably through its role in B cell activation. We found that proliferation of B cells from Fli-1+/− MRL/lpr mice is reduced significantly after B cell receptor stimulation compared to WT MRL/lpr mice [17] and that decreased levels of total serum IgG paralleled the decreased serum autoantibodies in Fli-1+/− MRL/lpr mice compared to WT MRL/lpr mice [13]. Recently, we demonstrated that Fli-1 plays a very important role in B cell development [18]. In Fli-1ΔCTA/Fli-1ΔCTA homozygous B6 mice that express a truncated Fli-1 protein lacking the carboxy-terminal transcriptional activation domain, the follicular B cell population is decreased significantly, whereas marginal zone B cells were increased markedly. Thus, Fli-1 may affect autoantibody production by altering B cell development [18]. The role of follicular B cells and marginal zone B cells in autoreactive B cell development is not clear at this time, as both types of B cells were implicated, depending upon the model, in autoantibody production. Some studies suggested that marginal zone B cells contribute to the pathogenic autoantibody production; other studies, however, implicated the follicular B cell population for the autoreactive B cell development [19–21]. The B cell clearly has important pathogenic roles in disease development independent of autoantibody production. Although not tested as yet, Fli-1 may also impact B cell antigen-presenting function and/or cytokine production.
We found that Fli-1+/− MRL/lpr mice that received WT MRL/lpr BM had lower renal scores and improved survival, although there was no statistical significance. Glomurulonephritis with lupus is a major cause of death in both human patients and animal models of lupus. Expression of Egr-1 was demonstrated recently to be an important mediator of mesangial cell proliferation during experimental glomerulonephritis [22,23]. Direct inhibition of expression of Egr-1 by anti-sense oligonucleotides resulted in decreased renal disease in this experimental model [23]. A previous report demonstrated that Fli-1 enhanced the expression of Egr-1 through direct promoter transactivation [24]. It is possible that the decreased renal disease and improved survival in Fli-1+/− MRL/lpr mice receiving WT MRL/lpr mice BM was due to the lower expression of Egr-1 in these mice, although local renal expression of Egr-1 would appear to be more important in renal pathology than expression of Egr-1 in inflammatory cells. Preliminary microarray analysis demonstrated decreased expression of Egr-1 in the kidneys of Fli-1+/− MRL/lpr mice compared to WT MRL/lpr mice, and the expression of Egr-1 in the kidneys from Fli-1+/− MRL/lpr mice was about threefold lower compared to WT MRL/lpr mice by real time PCR (data not shown).
BM transplantation in animal models of inflammatory/autoimmune diseases is used to study the contribution of haematopoietic versus non-haematopoietic cell lineages to disease development [14]. Control C57BL/6J mice developed lupus nephritis 3 months after receiving BM from (NZW × BXSB)F1 mice, a well-characterized murine model of lupus. Recently, we found that reduced expression of Fli-1 protein had a profound effect on disease development in the NZM2410 mice that are a strain derived by intercrossing NZW × NZB F1 mice. Fli-1+/− NZM2410 mice, like Fli-1+/− MRL/lpr mice, had significantly lower serum autoantibody titres and decreased proteiuniria compared to WT NZM2410 mice. Fli-1+/− NZM2410 mice survived significantly longer compared to WT NZM2410 mice (unpublished data). However, Green et al.[25] demonstrated recently that non-haematopoietic factors also contribute to lupus disease development in the α-mannosidase II-deficient mice model. We believe that our data also support an effect of non-haematopoeitic cells on MRL/lpr mice disease development based on the decreased disease in the Fli-1+/− MRL/lpr mice receiving BM from WT MRL/lpr mice. Using mice with specific cell Fli-1 disruption will provide further insight into how Fli-1 affects lupus disease development. We are now generating conditional Fli-1 knock-out MRL/lpr mice for future study.
In summary, our data demonstrate that the expression of Fli-1 in BM derived haematopoietic cells has a significant effect on autoimmune disease development in MRL/lpr mice and that decreased expression of Fli-1 in non-haematopoietic cell lineages also probably contributes to the improvement of autoimmune disease development in MRL/lpr mice, These data also indicate that the expression of a single gene in different cell types can have separate but synergistic effects on disease development.
Acknowledgments
This study was supported by National Institutes of Health grants (AR054546 to X. K. Z.) and the Medical Research Service, Department of Veterans Affairs (to X. Z. and G. G.).
Disclosure
None.
References
- 1.Mills JA. Systemic lupus erythematosus. N Engl J Med. 1994;330:1871–9. doi: 10.1056/NEJM199406303302608. [DOI] [PubMed] [Google Scholar]
- 2.Mok CC, Lau CS. Pathogenesis of systemic lupus erythematosus. J Clin Pathol. 2003;56:481–90. doi: 10.1136/jcp.56.7.481. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Cooper GS, Dooley MA, Treadwell EL, St Clair EW, Parks CG, Gilkeson GS. Hormonal, environmental, and infectious disease risk factors for the development of systemic lupus erythematosus. Arthritis Rheum. 1998;41:1714–24. doi: 10.1002/1529-0131(199810)41:10<1714::AID-ART3>3.0.CO;2-U. [DOI] [PubMed] [Google Scholar]
- 4.Watson DK, Smyth FE, Thompson DM, et al. The ERGB/Fli-1 gene: isolation and characterization of a new member of the family of human ETS transcription factors. Cell Growth Differ. 1992;3:705–13. [PubMed] [Google Scholar]
- 5.Ben-David Y, Giddens EB, Letwin K, Bernstein A. Erythroleukemia induction by Friend murine leukemia virus: insertional activation of a new member of the ets gene family, Fli-1, closely linked to c-ets-1. Genes Dev. 1991;5:908–18. doi: 10.1101/gad.5.6.908. [DOI] [PubMed] [Google Scholar]
- 6.Georgiou P, Maroulakou IG, Green JE, et al. Expression of ets family of genes in systemic lupus erythematosus and Sjogren's syndrome. Int J Oncol. 1996;9:9–18. [PubMed] [Google Scholar]
- 7.Zhang L, Eddy A, Teng YT, et al. An immunological renal disease in transgenic mice that overexpress Fli-1, a member of the ets family of transcription factor genes. Mol Cell Biol. 1995;15:6961–70. doi: 10.1128/mcb.15.12.6961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Spyropoulos DD, Pharr PN, Lavenburg KR, et al. Hemorrhage, impaired hemotopoiesis, and lethality in mouse embryos carrying a targeted disruption of the Fli1 transcription factor. Mol Cell Biol. 2000;20:5643–52. doi: 10.1128/mcb.20.15.5643-5652.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hart A, Melet F, Grossfeld P, et al. Fli-1 is required for murine vascular and megakaryocytic development and is hemizygously deleted in patients with thrombocytopenia. Immunity. 2000;13:167–77. doi: 10.1016/s1074-7613(00)00017-0. [DOI] [PubMed] [Google Scholar]
- 10.Theofilopoulos AN, Dixon FJ. Murine models of systemic lupus erythematosus. Adv Immunol. 1985;37:269–390. doi: 10.1016/s0065-2776(08)60342-9. [DOI] [PubMed] [Google Scholar]
- 11.Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature. 1992;356:314–17. doi: 10.1038/356314a0. [DOI] [PubMed] [Google Scholar]
- 12.Watson ML, Rao JK, Gilkeson GS, et al. Genetic analysis of MRL-lpr mice: relationship of the Fas apoptosis gene to disease manifestations and renal disease-modifying loci. J Exp Med. 1992;176:1645–56. doi: 10.1084/jem.176.6.1645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zhang XK, Gallant S, Molano I, et al. Decreased expression of the Ets family transcription factor Fli-1 markedly prolongs survival and significantly reduces renal disease in MRL/lpr mice. J Immunol. 2004;173:6481–9. doi: 10.4049/jimmunol.173.10.6481. [DOI] [PubMed] [Google Scholar]
- 14.Ikehara S, Kawamura M, Takao F, et al. Organ-specific and systemic autoimmune disease originate from defects in hematopoietic stem cells. Proc Natl Acad Sci USA. 1990;87:8341–4. doi: 10.1073/pnas.87.21.8341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Li HS, Ligons DL, Rose NR, Guler ML. Genetic difference in bone marrow-derived lymphoid lineages control susceptibility to experimental autoimmune myocarditis. J Immunol. 2008;180:7480–4. doi: 10.4049/jimmunol.180.11.7480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Sekine H, Reilly CM, Molano I, et al. Complement component C3 is not required for full expression of immune complex glomerulonephritis in MRL.lpr mice. J Immunol. 2001;166:6444–51. doi: 10.4049/jimmunol.166.10.6444. [DOI] [PubMed] [Google Scholar]
- 17.Bradshaw S, Zheng W-J, Tsoib L-C, Gilkeson G, Zhang XK. A role for Fli-1 in B cell proliferation: implications for SLE pathogenesis. Clin Immunol. 2008;129:19–30. doi: 10.1016/j.clim.2008.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhang XK, Moussa O, LaRue A, et al. The transcription factor Fli-1 modulates marginal zone and follicular B cell development. J Immunol. 2008;181:1644–54. doi: 10.4049/jimmunol.181.3.1644. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li Y, Li H, Weigert M. Autoreactive B cells in the marginal zone that express dual receptors. J Exp Med. 2002;195:181–8. doi: 10.1084/jem.20011453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Wellmann U, Wergner A, Winkler TH. Altered selection processes of B lymphocytes in autoimmune NZB/W mice, despite intact central tolerance against DNA. Eur J Immunol. 2001;31:2800–10. doi: 10.1002/1521-4141(200109)31:9<2800::aid-immu2800>3.0.co;2-e. [DOI] [PubMed] [Google Scholar]
- 21.Grimaldi CM, Michael DJ, Diamond B. Expansion and activation of a population of autoreactive marginal zone B cells in a model of estrogen-induced lupus. J Immunol. 2001;167:1886–90. doi: 10.4049/jimmunol.167.4.1886. [DOI] [PubMed] [Google Scholar]
- 22.Rupprecht HD, Hoffer G, de Heer E, Sterzel RB, Faller G, Schoecklmann HO. Expression of the transcriptional regulator Egr-1 in experimental glomerulonephritis: requirement for mesangial cell proliferation. Kidney Int. 1997;51:694–702. doi: 10.1038/ki.1997.100. [DOI] [PubMed] [Google Scholar]
- 23.Carl M, Akagi Y, Weidner S, Isaka Y, Imai E, Rupprecht HD. Specific inhibition of Egr-1 prevents mesangial cell hypercellularity in experimental nephritis. Kidney Int. 2003;63:1302–12. doi: 10.1046/j.1523-1755.2003.00865.x. [DOI] [PubMed] [Google Scholar]
- 24.Watson DK, Robinson L, Hodge DR, Kola I, Papas TS, Seth A. FLI1 and EWS-FLI1 function as ternary complex factors and ELK1 and SAP1a function as ternary and quaternary complex factors on the Egr1 promoter serum response elements. Oncogene. 1997;14:213–21. doi: 10.1038/sj.onc.1200839. [DOI] [PubMed] [Google Scholar]
- 25.Green RS, Stone EL, Tenno M, Lehton E, Farquhar MG, Marth JD. Mammalian N-glycan branching protects against innate immune self-recognition and inflammation in autoimmune disease pathogesis. Immunity. 2007;27:308–20. doi: 10.1016/j.immuni.2007.06.008. [DOI] [PubMed] [Google Scholar]
