Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 May 1.
Published in final edited form as: Hepatology. 2010 May;51(5):1584–1592. doi: 10.1002/hep.23569

Glucagon-like Peptide-1 Receptor (GLP-1R) is present on human hepatocytes and has a direct role in decreasing hepatic steatosis in vitro by modulating elements of the insulin signaling pathway

Nitika Arora Gupta 1,2,*, Jamie Mells 3,*, Richard M Dunham 4, Arash Grakoui 4, Jeffrey Handy 5, Neeraj Kumar Saxena 5, Frank A Anania 5
PMCID: PMC2862093  NIHMSID: NIHMS191985  PMID: 20225248

Abstract

Background

Glucagon-like Peptide-1 (GLP-1) is a naturally occurring peptide secreted by the L-cells of the small intestine. GLP-1 functions as an incretin and stimulates glucose-mediated insulin production by pancreatic β-cells. In this study, we demonstrate that Exendin-4/GLP-1 has a cognate receptor on human hepatocytes; and that Exendin-4 has a direct effect on the reduction of hepatic steatosis in the absence of insulin.

Results and Discussion

Both GLP-1R mRNA and protein were detected on primary human hepatocytes, and receptor was internalized in the presence of GLP-1. Exendin-4 increased the phosphorylation of PDK-1, AKT, and PKC-ζ, in HepG2 and HuH-7 cells. siRNA against GLP-1R abolished the effects on PDK-1 and PKC-ζ Treatment with Exendin-4 quantitatively reduced triglyceride stores compared to control-treated cells.

Conclusion

This is the first report that the G-protein coupled receptor (GPCR) GLP-1R is present on human hepatocytes. Furthermore, Exendin-4 appears to have in vitro, the same beneficial effects we have seen in our previously published in vivo study in ob/ob mice, directly reducing hepatocyte steatosis. Future use for human non-alcoholic fatty liver disease, either in combination with dietary manipulation or other pharmacotherapy, may be a significant advance in treatment of this common form of liver disease.

Keywords: GLP, AKT, PDK-1, PKCζ, steatosis, GPCR

BACKGROUND

GLP-1 is a peptide product of the L-cells of the small intestine and proximal colon and has been the subject of considerable laboratory research over the past two decades. Although the primary function of GLP-1 is to serve as an incretin in β cells of the mammalian pancreas, the functioning peptide is quickly cleaved by the dipeptidyl peptidase IV (DPPIV) rendering the peptide functionally inactive 1–3. The principle pleotropic effects of GLP-1 include enhanced satiety, delayed gastric emptying 4, 5 and increased lower gastrointestinal motility 1, 6. GLP-1 binds to its cognate receptor, glucagon-like peptide-1 receptor 1 (GLP-1R), a G-protein coupled receptor (GPCR) that has been found in many tissues including the brain and pancreas 4, 7. However, great consternation persists about whether GLP-1 has a functioning receptor on hepatocytes. Mice which lack GLP-1R (DIRKO) do not seem to have marked hepatic metabolic changes 8–12. Exendin-4 is a 39 amino acid agonist of GLP-1R, and is derived from the saliva of the Gila monster, Heloderma suspectum. At present Exendin-4 is being used to augment insulin production in type 2 diabetics 13. While we recently published that Exendin-4 significantly reduced hepatic steatosis found in ob/ob mice we did not elucidate a cellular mechanism, nor determine if the effects were the result of direct action on hepatocytes, or is such beneficial effects were related to non-hepatic effectors 14.

Non-alcoholic fatty liver disease (NAFLD) is strongly associated with other clinical features of the metabolic syndrome including obesity, type 2 diabetes mellitus, hypertension, and dyslipidemia. Insulin resistance is a central feature of “metabolic syndrome.” Hepatocyte insulin resistance in particular—in part related to impaired insulin signal transduction—may be a key problem in the development of hepatocyte steatosis. Here we positively identified the GLP-1 receptor in not only transformed hepatocytes HuH7 and Hep-G2 cells, but also in primary human hepatocytes. We have also demonstrated, as with other GPCRs, on binding to its ligand, GLP-1R internalizes 3. GLP-1 or Exendin-4 can activate key signaling molecules downstream of insulin receptor substrate-2 (IRS-2). Furthermore, in the absence of insulin, we demonstrated a significant loss of triglycerides from steatotic hepatocytes following Exendin-4 treatment. To our knowledge this is the first report that convincingly demonstrates GLP-1R on hepatocytes, and provides a signaling mechanism whereby GLP-1 proteins can independently reduce hepatocyte triglyceride accumulation.

MATERIALS AND METHODS

Hepatocyte cultures

Hep-G2 and HuH7 cells were purchased from ATCC (Manassas, VA) and cultured using DMEM (Invitrogen, Carlsbad, CA) with 10% fetal bovine serum (FBS, Hyclone, Logan, Utah). Cells were treated with 10nM of GLP-1 or Exendin-4 10nM (Sigma, St. Louis, MO) for varying time intervals from 5 minutes to 12 hours in accordance with previously published reports 15, 16.

Primary Hepatocyte Culture

Primary hepatocytes, purchased from Lonza (Allendale, NJ), were grown to confluence in media (HMM CC-3197 with HMM single quots CC-4192) on collagen coated plates (BD-Biosciences, Bedford, MA), at a density of 0.15 mL cells/0.5 mL media. RNA and protein were subsequently extracted. This was done in the absence of insulin.

RT-PCR

Total RNA was extracted from HuH7 and human hepatocytes by TRIzol® reagent (Invitrogen). PCR was performed using primers for GLP-1R: 5′-TTG GGG TGA ACT TCC TCA TC-3′ for forward and 5′-CTT GGC AAG TCT GCA TTT GA-3′ for reverse, and real time PCR was performed.

Immunoblot assay to detect GLP-1R and Exendin-4 signaling pathway

Lysates from HuH7 and HepG2 cells were prepared after treatment of the cells with Exendin-4 or GLP-1 for 5, 15, 30, 60, 90, 180, and 360 minutes. Equal amounts of protein were resolved on SDS-PAGE 17, transblotted, and subjected to immuno-detection using primary antibody for GLP-1R which was purchased from abcam (ab39072; 1:500), the phosphorylated and total species of PDK-1, AKT, and PKC-ζ. β-actin served as a loading control 17.

Sub-cellular fraction analysis

HuH7 cells were treated with Exendin-4 for 30 min and one h. Cells treated with pre-immune serum served as controls. Cytosolic, membrane and nuclear fractions were separated using manufacturer’s instructions (Biovision # K270). These fractions (20 μg) were resolved on SDS- PAGE and subjected to immuno-detection against the GLP-1R antibody.

Bioluminescence Assay

Cell surface expression assays were performed as previously described by Xu et al 18. Briefly, 35 mm3 collagen coated dishes (BD#354459) were used to plate an equal number of HuH7 cells. The cells were treated with GLP-1 or Exendin-4 for 4 min, 10 min and 30 min. After cells were formalin fixed, cells were treated with 3% non-fat dry milk in PBS and subsequently incubated with primary antibody, Anti-GLP1-R [1:500] for 1 h, followed by secondary antibody [1:1000]. Antibody-receptor binding was detected by supersignal Elisa pico enhanced chemiluminescence (ECL) reagent (Pierce, Rockford, IL). The luminescence, which corresponds to the amount of receptor on the cell surface, was determined by using a TD 20/20 luminometer (Turner Designs, Sunnyvale, CA). Control cells were treated with pre-immune serum.

Immunoflorescence and Confocal Microscopy

To visualize GLP1-R, HuH7 cells were grown on chamber slides and treated with GLP-1 or Exendin-4 for 4 min, 15min, 30 min and 1h and routine immunostaining was performed. Briefly, the cells were fixed with paraformaldehyde, permeabilized with 0.5% triton X-100 + 0.08% saponin in H+ at 25° for 40 min and then incubated with 50 μ of rhodamine phalloidin diluted 1:60 at 25° for 45 min. Cells were blocked with 2% BSA for 1 h at 25°, followed by incubation with primary antibody, GLP1-R [1:200] overnight at 4°C. After washing, cells were incubated with secondary antibody (Anti-rabbit FITC). Fluorescence and confocal microscopy were performed.

Oil Red O staining and triglyceride assays

HuH7 and Hep G2 cells were exposed to medium containing 1% free fatty acids (FFA)-free BSA, and fat loaded with 400μM of palmitic and oleic acid (Sigma). After 12 h, cells were treated with 20 nM of Exendin-4 for 6 h and stained with Oil Red O staining (Polyscience, Niles, IL) to visualize triglyceride (TG) accumulation. TG quantification assay was performed following manufacturer’s instructions (Biovision # K622-100). These experiments were conducted in the absence of insulin.

Methionine-choline Deficient (MCD) Media Treatment and Flow Cytometric Analysis

After serum starvation for 24 h HepG2 cells were exposed to either control media or MCD medium (Gibco) supplemented with 10% FBS as previously described19. These experiments were also conducted under insulin-free conditions. Cells were treated with Exendin-4 for up to 24 h and stained with Nile Red (MP Biomedical, Solon, Ohio) at a concentration of 0.5μg/ml and incubated for 15 min at 37°C as previously described 20. Flow cytometry was performed. Briefly, cells were resuspended in PBS plus 0.5% BSA and analyzed on a FACS Calibur (Becton Dickinson, San Jose, CA) on the FL3 channel (670LP filter with 488nm excitation) and FL4 channel (660/20 filter with 633nm excitation).

siRNA against GLP-1R

Three primer pair sequences for siRNA-GLP-1R and negative control (Stealth Negative control) were purchased from Invitrogen as shown in Table 1. HuH7 cells were transfected using Lipofectamine® RNAiMAX reagent (Invitrogen) following the reverse transfection protocol by the manufacturer. Cells were plated at 50% confluency and transfected with the siRNA sequences at 30 nM and maintained for 48 h. GLP-1R knock down was confirmed by immunoblot. Cell lysates were prepared and subjected to immunoblot analysis for GLP-1R, PDK1, AKT and PKC-ζ.

Table 1.

Primer Pairs for siRNA experiments

siRNA-Glp-1R Forward Reverse
Primer 1 UCCACCAAGAGCCAGUAGUAAUUGG CCAAUUACUACUGGCUCUUGGUGGA
Primer 2 AUAAUGAGCCAGUAGUUCAUGUUGG CCAACAUGAACUACUGGCUCAUUAU
Primer 3 AUGACCCGAACAAAGAUGAGGAAGU ACUUCCUCAUCUUUGUUCGGGUCAU

Statistical Analyses

The data are presented as the mean ± SE. Statistical analysis was performed using Graphpad Instat 3 software (www.graphpad.com). Groups were compared using parametric tests (paired Student t test or one-way ANOVA with posttest following statistical standards). P values of less than .05 were considered statistically significant.

RESULTS

Confirmation of GLP-1R on HuH7 cells and human hepatocytes

Western blot analysis shows the presence of GLP-1R in HuH7 cells and primary human hepatocytes. (Figure 1A).

Figure 1. Identification of GLP-1R on hepatocytes.

Figure 1

A Primary human hepatocyte and HuH7 cells show the presence of GLP-1R by western blot analysis. Brain lysate was used as a positive control. B: Bioluminescence analysis for GPCRs demonstrates the presence of GLP-1R on HuH7 cells. Bars show % increase in bioluminescence in GLP-1R as compared with no- primary-antibody treatment. (Means ± SE; *p < 0.05 compared with control no- primary antibody monolayer). The experiment was repeated three times in triplicate.

Bioluminescence confirms specific GLP-1R localization

As shown in Figure 1B there was a multifold increase of the GLP-1R for HuH7 cells as compared to the pre- immune serum treated controls (p<0.05).

GLP-1R is internalized in HuH7 cells

GLP-1R is internalized on stimulation by GLP-1 or Exendin-4 (Figure 2). This was first demonstrated by cell surface expression analysis (bioluminescence assay) Figure 2A. We then confirmed the microscopic findings by sub-cellular fractionation as seen in Figure 2B. This demonstrated that following GLP-1R exposure to its agonist, the membrane-bound fraction was reduced. Upon stimulation with either GLP-1 or Exendin-4, there was a decrease in the amount of receptor seen on the cell membrane as seen by confocal microcopy in Figure 2C. These data suggest that there is loss of the receptor from the cell membrane.

Figure 2. GLP-1R is present on the plasma membrane and was internalized upon agonist stimulation.

Figure 2

A Monolayers were stimulated with GLP or Exendin-4 for 5 min, 15 min, 30 min. (10 nM) as described in MATERIALS AND METHODS. Bars show % decrease in bioluminescence compared with unstimulated (no ligand) monolayer (means ± SE; *p < 0.05 compared with unstimulated monolayer). The experiment was repeated three times and compared with untreated controls and pre-immune serum treated controls. B: Cell fractionation of HuH7 monolayers was performed as described in MATERIALS AND METHODS. Samples from membrane (M), cytoplasm(C) and nuclear (N) fractions were subjected to Western blot analysis using anti-GLP-1R antibody (1:500). Blots were also probed for Na+-K+-ATPase, Lamin A/C and β-actin to confirm equal protein loading. The results are representative of 2 independent experiments. C: Confocal imaging of GLP-1R was performed on filter grown monolayers of HuH-7 cells. Cells were stained with rabbit polyclonal antibody against GLP-1R (1:200) followed by Alexa Fluor secondary antibody. Rhodamine (blue arrow) was used to stain the cytoskeleton. In 1) GLP-1R (yellow arrow) is seen localized to the membrane and in 2) upon agonist stimulation GLP-1R is decreased from the membrane.

Fluorescence and Confocal Microscopy confirm bioluminescence and subcellular fractionation results

Both confocal and fluorescent imaging confirmed that GLP-1R is internalized. In Figure 2C (left panel) displays untreated cells where GLP-1R (detected in green) is seen lining the cell membrane. On treatment with GLP-1 or Exendin-4 the receptor (Figure 2C, right panel) was detected primarily in the cytoplasm than on the plasma membrane (yellow arrows). These data support the detection of internalization of the receptor by bioluminescence assay which was also confirmed by subcellular fractionation analysis.

Exendin-4 reduces triglyceride stores in HuH7 and HepG2 cells

To determine whether a physiologic endpoint of putative GLP-1 receptor signaling could be achieved, we explored whether, following Exendin-4 treatment there was a significant reduction in the cellular triglyceride content by several approaches. As seen by images following Oil Red O staining (Figure 3A), following engorgement of HuH7 cells with palmitate and oleate, Exenidin-4 greatly reduced TG stores; and, this was further corroborated by TG quantitation (Figure 3B). The reduction in cellular lipid content (both neutral and polar lipids) by Exendin-4 was also confirmed using flow cytometry, with Nile Red staining in cells rendered steatotic by methione-choline deficient media (Figure 3C).

Figure 3. Reduction of steatosis on exposure to Exendin-4.

Figure 3

A HuH7 cells were treated with palmitic acid ( 400uM/l) and oleic acid ( 400uM/l) for 12 h under insulin-free conditions; and subsequently exposed to Exendin-4 (20nM) for 6 h. Figure 3a) shows Oil red O staining of HuH7 cells treated with FFA and Exendin-4. A marked increase in Oil red O stained droplets (red) are visible in the cells treated with FFA as compared with the non treated cells. On exposure to Exendin4 there is a significant loss of fat droplets (40X). B: Triglyceride assay was performed on HuH7 cell lysate after treatment with palmitic and oleic acid followed by exposure to Exendin-4 as described in MATERIALS AND METHODS. Bars show % increase in TG content and then % decrease on treatment with Exendin-4. (Means ± SE; *p < 0.05 compared with untreated steatotic cells). The experiment was repeated three times in triplicate and compared with FFA exposed and non Exendin4 treated controls. C.: HepG2 cells were grown in either control media or methionine-choline deficient (MCD) media. Cells were then treated with Exendin-4 for 24 h. Following treatment, intracellular lipids (polar and neutral) were stained with Nile Red (NR) (0.5μg/ml). Flow cytometry was performed as described in Materials and Methods. 3T3L1 cells were served as a positive control. The figure is representative of three independent experiments.

Exendin-4 increases phosphorylation of PDK-1, AKT, and PKC-ζ proteins

Exendin-4 resulted in a significant increase in phosphorylation at 60 min of PDK-1, and AKT (Figure 4) (p<.05,). The phosphorylation of PKC-ζ was significantly increased at 30, 60, and 90 min (p<.05) (Figure 4). siRNA against GlP-1R (Supplemental figure) was used to abolish effects seen in Huh7 cells treated with Exendin-4. The knockdown of GLP-1R abolished the effects for PDK-1 and PKC-ζ (Figure 5), p<.05, n=3), but not AKT (data not shown).

Figure 4. GLP-1R signals through key insulin signal transduction elements.

Figure 4

HuH-7 cells were treated with GLP/Exendin-4 (10nM) following the time course indicated: 5, 15, 30, 60, 90 and 120 m and Western blot was performed. β-actin was used as loading control. A: Phosphorylation of PDK was induced. B–C: AKT phosphorylation was also increased in a time dependent manner as was the phosphorylation of PKC-ζ. All data presented are representative of the mean ± SE of at least 3 experiments *p<0.05 vs. basal or untreated.

Figure 5. Knockdown of GLP-1R by siRNA.

Figure 5

HuH7 cells were transfected with siRNA (at 30nM) against GlP-1R, and Western blot analysis with β-actin serving as loading control was performed. A) Knockdown was achieved as compared to control with 30nM siGLP-1R. B) Transfected HuH7 cells were treated with Exendin-4 (10nM) for 60 min. siRNA GLP-1R abolished the Exendin-4 mediated-effects on PDK-1 and PKC-ζ. (B and C, respectively). These studies represent multiple independent experiments. (*p<.05 vs. control).

DISCUSSION

A key problem facing biologists and clinicians includes a plausible molecular basis for metabolic syndrome and its hepatic complications. It is widely believed that NAFLD is a component of this epidemic and is the commonest reason a patient sees a gastroenterologist in developed countries. While we previously published intriguing findings in which the long-acting GLP-1 agonist, Exendin-4, significantly reduced hepatic triglycerides stores in the livers of ob/ob mice, we did not provide a molecular mechanism for how GLP-1 proteins mediated this beneficial effect 14. Furthermore there was a lack of evidence—particularly with regard to human liver—as to whether or not GLP-1 receptors are present, specifically on hepatocytes, and whether or not they are biologically active, though recent data since our publication demonstrates presence of GLP-1R on cholangiocytes 21.

In this report we provide a direct molecular explanation for the effects of GLP-1 or a long-acting homologue, Exendin-4, in steatotic liver cells. Our data strongly suggest that as in other mammalian tissues, the GLP-1 receptor is present in human hepatocytes. These data are corroborated not only by conventional analysis (RT-PCR, Immunoblot) but also by bioluminescence, which also demonstrates internalization of GLP-1R. These data are supported by confocal microscopy and subcellular fractionation which suggest that the receptor is internalized. Future work is ongoing to directly measure ligand-receptor interactions, which we recognize gauge specific properties than the antibody-receptor analyses presently conducted. On the other hand, the physiologic data indicating a direct reduction of cellular TG is a strong corollary to the receptor work presented herein.

GLP-1R is a member of the seven transmembrane family of G protein coupled receptors 22 and their signaling and functioning capabilities have been well defined. Several elegant studies by Widmann et al have demonstrated that GLP-1R is internalized on stimulation with its agonist and recycles back to the plasma membrane after several hours following endocytosis 3. They have also reported that the receptor after endocytosis is partly internalized into an endosomal compartment such as endoplasmic reticulum, desensitized 23 or recycled back to the plasma membrane. However other target organelles for internalization cannot be excluded. Several mechanisms of internalization have been proposed and β-arrestin-1 may be an important adapter protein for several GPCRs. 24, 25. Sonoda et al 26 postulated a role of β-arrestin-1 in receptor signaling but not in trafficking, a hypothesis consistent with a report by Syme et al 27. Internalization was measured by the loss of surface expression of the receptor (as in our study) and has also been seen in response to partial GLP-1R agonists 28. While the confocal data are convincing and are corroborated with our blots from the membrane and nuclear fractions, the immunoblot data regarding transfer of GLP-1R to the cytoplasmic fraction is not as robust as visualized in the confocal data. Future work to clarify the internalization results will need to be performed but are out of the scope of the present manuscript. New techniques, for example using self-labeling protein tags that would covalently be linked with fluorophores, and would selectively label the specific pool of GPCRs present at the plasma membrane without labeling any of the internal pools may be feasible. Thus a non-permeable labeled substrate will label only the plasma membrane bound GPCR proteins. This selective labeling approach may significantly reduce the signal intensity obtained by the confocal microscopic examination of cells performed with Exendin-4 as we have demonstrated here. While we have demonstrated the hepatic GLP-1 receptor can be internalized, the data here cannot quantify the degree to which Exendin-4 induces this process. While we recognize that much of the work performed here was in transformed malignant hepatocyte cell-lines—primarily Huh7 cells, the identification of GLP-1R was also performed in primary human hepatocytes. We suspect that one of the reasons that some, but not all, previous authors have not been able to identify the GLP-1 receptor is the availability of better quality antibodies against the receptor and both the purity and availability of viable human hepatocytes for in vitro experimentation.

From a clinical and translation perspective these data are exciting as they offer a plausible explanation as to why GLP-1 or GLP-like proteins may be beneficial in the treatment of metabolic syndrome and NAFLD in particular. Importantly, these data indicate a direct effect of GLP-1 protein, as opposed to an indirect or pleotropic effect. As has been recently reported, patients undergoing bariatric surgery are found to have higher circulating levels of GLP-1 with significant histological improvement in their livers 29–32 especially those who undergo ileal transposition 31. In the present work we provide evidence for direct cellular effects of GLP-1 proteins. First by potentiating hepatocyte steatosis in vitro by supplementing HuH7 cells with palmitic and oleic acids, and gauging the reduction of steatosis by Oil Red O staining and supportive TG quantification. Flow cytometric analysis demonstrated that MCD increased cellular neutral lipid content, which was significantly decreased by Exendin-4 treatment. Interestingly, polar lipid content was only slightly altered by MCD, but was dramatically decreased by Exendin-4 treatment, which also warrants further investigation.

The fact that treatment with Exendin-4 at concentrations seen in either treated diabetics 33, or at levels of GLP-1 seen in post-bariatric surgery patients 34, 35, results in decreased hepatic TG content. These data clearly underscore that GLP-1 has a direct, independent, and novel action on steatotic hepatocytes.

Our work also provides a molecular mechanism to explain the signal effectors of GLP-1 in its potential role in hepatocyte TG reduction. A key signaling effector for insulin signaling downstream from insulin receptor signaling protein 1(IRS-1) is AKT. Based on our data we have outlined a proposed molecular pathway whereby GLP-1 or homologues intersect the insulin signaling pathway in hepatocytes (Figure 6), since this and inter-related pathways in hepatocytes has emerged as critical for the molecular basis of the emergence of hepatocyte insulin resistance.. It has been widely reported that AKT phosphorylation is markedly diminished in steatotic hepatocytes 36. Here we show that GLP-1 ligands increase not only the phosphorylation status of AKT but other key molecules downstream. Our signaling studies are noteworthy, because they confirm that Exendin-4 not only activated AKT, but also resulted in robust phosphorylation of both PDK-1 and PKC-ζ. By contrast we failed to knock down AKT phosphorylation by siGLP-1R but successful did so against PKD-1 and PKC-ζ. These data provide a plausible mechanism by which Exendin-4 may be bypassing AKT activation in patients with hepatic insulin resistance.

Figure 6. Proposed GLP-1R signal transduction scheme.

Figure 6

In our previous work we demonstrated that GLP-1 or Exendin-4 increased cAMP production. Here we propose that the GLP-1 action shares key downstream components of the insulin signaling pathway, including PKCζ, which has been shown to be a key factor in NAFLD.

PDK-1 activates PKC-ζ; moreover PKC-ζ appears to have a significant role in Exendin-4 mediated lypolysis in rat adipocytes. Studies by Arnes et al in the rat liver showed that GLP-1 significantly increased Glut 2 mRNA levels increasing lipolysis 37. In addition, knockout studies of IRS-1 and IRS-2 in rat hepatocytes by Sajan et al, demonstrated that both appear to activate the AKT pathway, however only IRS-2 appears to activate the PKC-ζ38. Our data suggest that GLP-1R activates the same pathway as IRS-2. and may account for why we failed to knock down AKT phosphorylation but were able to significantly knock down PDK-1 phosphorylation and PKCζ. What is apparent from our data is that more than one pathway related to insulin signal transduction can act to execute an action of insulin, but in this case such an action (reduction in TG store in liver cells) was executed by GLP-1 proteins. The siRNA studies knocking out the GLP-1R demonstrate a novel insulin action of GLP-1 proteins by up regulating key elements of the hepatocyte insulin signaling pathway. (Figure 6)

Future cellular analysis should focus on GLP-1 proteins serve as insulin sensitizing agents in hepatocytes as opposed to an incretin effect seen in pancreatic β cells. These cellular data may reveal a definitive role for a higher dose distribution of GLP -1 analogues to reduce hepatic steatosis particularly in patients with type 2 diabetes mellitus, and raises the possibility that such agents may, in combination, be safely administered to reduce hepatic TG stores in NAFLD.

Supplementary Material

Acknowledgments

This work was supported by US Public Health Service Awards R24 DK064399, R01 DK062092, K01 DK076742 and R01 DK 075397, EVC/CFAR Flow cytometry Core(P30 A1050409), Cancer research Institute Investigator award, the Yerkes research Center Base grant RR 00165, US Public Health Service grants A1070101

Abbreviations

GLP

Glucagon like peptide

TG

Triglyceride

GLP-1R

Glucagon like peptide receptor

FFA

Free-Fatty Acids

MCD

Methionine-choline Deficient

RDU

Relative Density Units

NR

Nile Red

Contributor Information

Nitika Arora Gupta, Email: narorag@emory.edu.

Jamie Mells, Email: jmells@emory.edu.

Richard M. Dunham, Email: rdunham@emory.edu.

Arash Grakoui, Email: arash.grakoui@emory.edu.

Jeffrey Handy, Email: Jhandy@emory.edu.

Neeraj Kumar Saxena, Email: nksaxen@emory.edu.

Frank A. Anania, Email: fanania@emory.edu.

References

  • 1.Acitores A, Gonzalez N, Sancho V, Valverde I, Villanueva-Penacarrillo ML. Cell signalling of glucagon-like peptide-1 action in rat skeletal muscle. J Endocrinol. 2004;180(3):389–398. doi: 10.1677/joe.0.1800389. [DOI] [PubMed] [Google Scholar]
  • 2.Widmann C, Burki E, Dolci W, Thorens B. Signal transduction by the cloned glucagon-like peptide-1 receptor: comparison with signaling by the endogenous receptors of beta cell lines. Mol Pharmacol. 1994;45(5):1029–1035. [PubMed] [Google Scholar]
  • 3.Widmann C, Dolci W, Thorens B. Agonist-induced internalization and recycling of the glucagon-like peptide-1 receptor in transfected fibroblasts and in insulinomas. Biochem J. 1995;310 ( Pt 1):203–214. doi: 10.1042/bj3100203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Baggio LL, Drucker DJ. Biology of incretins: GLP-1 and GIP. Gastroenterology. 2007;132(6):2131–2157. doi: 10.1053/j.gastro.2007.03.054. [DOI] [PubMed] [Google Scholar]
  • 5.Baggio LL, Drucker DJ. Clinical endocrinology and metabolism. Glucagon-like peptide-1 and glucagon-like peptide-2. Best Pract Res Clin Endocrinol Metab. 2004;18(4):531–554. doi: 10.1016/j.beem.2004.08.001. [DOI] [PubMed] [Google Scholar]
  • 6.Sancho V, Nuche B, Arnes L, Cancelas J, Gonzalez N, Diaz-Miguel M, et al. The action of GLP-1 and exendins upon glucose transport in normal human adipocytes, and on kinase activity as compared to morbidly obese patients. Int J Mol Med. 2007;19(6):961–966. [PubMed] [Google Scholar]
  • 7.Drucker DJ. The biology of incretin hormones. Cell Metab. 2006;3(3):153–165. doi: 10.1016/j.cmet.2006.01.004. [DOI] [PubMed] [Google Scholar]
  • 8.Ayala JE, Bracy DP, Hansotia T, Flock G, Seino Y, Wasserman DH, et al. Insulin action in the double incretin receptor knockout mouse. Diabetes. 2008;57(2):288–297. doi: 10.2337/db07-0704. [DOI] [PubMed] [Google Scholar]
  • 9.Hansotia T, Maida A, Flock G, Yamada Y, Tsukiyama K, Seino Y, et al. Extrapancreatic incretin receptors modulate glucose homeostasis, body weight, and energy expenditure. J Clin Invest. 2007;117(1):143–152. doi: 10.1172/JCI25483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Flock G, Baggio LL, Longuet C, Drucker DJ. Incretin receptors for glucagon-like peptide 1 and glucose-dependent insulinotropic polypeptide are essential for the sustained metabolic actions of vildagliptin in mice. Diabetes. 2007;56(12):3006–3013. doi: 10.2337/db07-0697. [DOI] [PubMed] [Google Scholar]
  • 11.Hansotia T, Drucker DJ. GIP and GLP-1 as incretin hormones: lessons from single and double incretin receptor knockout mice. Regul Pept. 2005;128(2):125–134. doi: 10.1016/j.regpep.2004.07.019. [DOI] [PubMed] [Google Scholar]
  • 12.Hansotia T, Baggio LL, Delmeire D, Hinke SA, Yamada Y, Tsukiyama K, et al. Double incretin receptor knockout (DIRKO) mice reveal an essential role for the enteroinsular axis in transducing the glucoregulatory actions of DPP-IV inhibitors. Diabetes. 2004;53(5):1326–1335. doi: 10.2337/diabetes.53.5.1326. [DOI] [PubMed] [Google Scholar]
  • 13.Drucker DJ. Development of glucagon-like peptide-1-based pharmaceuticals as therapeutic agents for the treatment of diabetes. Curr Pharm Des. 2001;7(14):1399–1412. doi: 10.2174/1381612013397401. [DOI] [PubMed] [Google Scholar]
  • 14.Ding X, Saxena NK, Lin S, Gupta NA, Anania FA. Exendin-4, a glucagon-like protein-1 (GLP-1) receptor agonist, reverses hepatic steatosis in ob/ob mice. Hepatology. 2006;43(1):173–181. doi: 10.1002/hep.21006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kemp DM, Habener JF. Insulinotropic hormone glucagon-like peptide 1 (GLP-1) activation of insulin gene promoter inhibited by p38 mitogen-activated protein kinase. Endocrinology. 2001;142(3):1179–1187. doi: 10.1210/endo.142.3.8026. [DOI] [PubMed] [Google Scholar]
  • 16.Vila Petroff MG, Egan JM, Wang X, Sollott SJ. Glucagon-like peptide-1 increases cAMP but fails to augment contraction in adult rat cardiac myocytes. Circ Res. 2001;89(5):445–452. doi: 10.1161/hh1701.095716. [DOI] [PubMed] [Google Scholar]
  • 17.Saxena NK, Titus MA, Ding X, Floyd J, Srinivasan S, Sitaraman SV, et al. Leptin as a novel profibrogenic cytokine in hepatic stellate cells: mitogenesis and inhibition of apoptosis mediated by extracellular regulated kinase (Erk) and Akt phosphorylation. Faseb J. 2004;18(13):1612–1614. doi: 10.1096/fj.04-1847fje. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Xu J, He J, Castleberry AM, Balasubramanian S, Lau AG, Hall RA. Heterodimerization of alpha 2A- and beta 1-adrenergic receptors. J Biol Chem. 2003;278(12):10770–10777. doi: 10.1074/jbc.M207968200. [DOI] [PubMed] [Google Scholar]
  • 19.Sahai A, Pan X, Paul R, Malladi P, Kohli R, Whitington PF. Roles of phosphatidylinositol 3-kinase and osteopontin in steatosis and aminotransferase release by hepatocytes treated with methionine-choline-deficient medium. Am J Physiol Gastrointest Liver Physiol. 2006;291(1):G55–62. doi: 10.1152/ajpgi.00360.2005. [DOI] [PubMed] [Google Scholar]
  • 20.Vejux A, Lizard G, Tourneur Y, Riedinger JM, Frouin F, Kahn E. Effects of caspase inhibitors (z-VAD-fmk, z-VDVAD-fmk) on Nile Red fluorescence pattern in 7-ketocholesterol-treated cells: investigation by flow cytometry and spectral imaging microscopy. Cytometry A. 2007;71(8):550–562. doi: 10.1002/cyto.a.20410. [DOI] [PubMed] [Google Scholar]
  • 21.Marzioni M, Alpini G, Saccomanno S, Candelaresi C, Venter J, Rychlicki C, et al. Glucagon-like peptide-1 and its receptor agonist exendin-4 modulate cholangiocyte adaptive response to cholestasis. Gastroenterology. 2007;133(1):244–255. doi: 10.1053/j.gastro.2007.04.007. [DOI] [PubMed] [Google Scholar]
  • 22.Thorens B. Expression cloning of the pancreatic beta cell receptor for the gluco-incretin hormone glucagon-like peptide 1. Proc Natl Acad Sci U S A. 1992;89(18):8641–8645. doi: 10.1073/pnas.89.18.8641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Widmann C, Dolci W, Thorens B. Desensitization and phosphorylation of the glucagon-like peptide-1 (GLP-1) receptor by GLP-1 and 4-phorbol 12-myristate 13-acetate. Mol Endocrinol. 1996;10(1):62–75. doi: 10.1210/mend.10.1.8838146. [DOI] [PubMed] [Google Scholar]
  • 24.Lefkowitz RJ, Shenoy SK. Transduction of receptor signals by beta-arrestins. Science. 2005;308(5721):512–517. doi: 10.1126/science.1109237. [DOI] [PubMed] [Google Scholar]
  • 25.DeWire SM, Ahn S, Lefkowitz RJ, Shenoy SK. Beta-arrestins and cell signaling. Annu Rev Physiol. 2007;69:483–510. doi: 10.1146/annurev.physiol.69.022405.154749. [DOI] [PubMed] [Google Scholar]
  • 26.Sonoda N, Imamura T, Yoshizaki T, Babendure JL, Lu JC, Olefsky JM. Beta-Arrestin-1 mediates glucagon-like peptide-1 signaling to insulin secretion in cultured pancreatic beta cells. Proc Natl Acad Sci U S A. 2008;105(18):6614–6619. doi: 10.1073/pnas.0710402105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Syme CA, Zhang L, Bisello A. Caveolin-1 regulates cellular trafficking and function of the glucagon-like Peptide 1 receptor. Mol Endocrinol. 2006;20(12):3400–3411. doi: 10.1210/me.2006-0178. [DOI] [PubMed] [Google Scholar]
  • 28.Jorgensen R, Kubale V, Vrecl M, Schwartz TW, Elling CE. Oxyntomodulin differentially affects glucagon-like peptide-1 receptor beta-arrestin recruitment and signaling through Galpha(s) J Pharmacol Exp Ther. 2007;322(1):148–154. doi: 10.1124/jpet.107.120006. [DOI] [PubMed] [Google Scholar]
  • 29.De Ridder RJ, Schoon EJ, Smulders JF, van Hout GC, Stockbrugger RW, Koek GH. Review article: Non-alcoholic fatty liver disease in morbidly obese patients and the effect of bariatric surgery. Aliment Pharmacol Ther. 2007;26 (Suppl 2):195–201. doi: 10.1111/j.1365-2036.2007.03483.x. [DOI] [PubMed] [Google Scholar]
  • 30.Dixon JB. Surgical treatment for obesity and its impact on non-alcoholic steatohepatitis. Clin Liver Dis. 2007;11(1):141–154. ix–x. doi: 10.1016/j.cld.2007.02.005. [DOI] [PubMed] [Google Scholar]
  • 31.Liu X, Lazenby AJ, Clements RH, Jhala N, Abrams GA. Resolution of nonalcoholic steatohepatits after gastric bypass surgery. Obes Surg. 2007;17(4):486–492. doi: 10.1007/s11695-007-9086-2. [DOI] [PubMed] [Google Scholar]
  • 32.Mummadi RR, Kasturi KS, Chennareddygari S, Sood GK. Effect of bariatric surgery on nonalcoholic fatty liver disease: systematic review and meta-analysis. Clin Gastroenterol Hepatol. 2008;6(12):1396–1402. doi: 10.1016/j.cgh.2008.08.012. [DOI] [PubMed] [Google Scholar]
  • 33.Chia CW, Egan JM. Incretin-based therapies in type 2 diabetes mellitus. J Clin Endocrinol Metab. 2008;93(10):3703–3716. doi: 10.1210/jc.2007-2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.de Carvalho CP, Marin DM, de Souza AL, Pareja JC, Chaim EA, de Barros Mazon S, et al. GLP-1 and Adiponectin: Effect of Weight Loss After Dietary Restriction and Gastric Bypass in Morbidly Obese Patients with Normal and Abnormal Glucose Metabolism. Obes Surg. doi: 10.1007/s11695-008-9678-5. [DOI] [PubMed] [Google Scholar]
  • 35.Laferrere B, Teixeira J, McGinty J, Tran H, Egger JR, Colarusso A, et al. Effect of weight loss by gastric bypass surgery versus hypocaloric diet on glucose and incretin levels in patients with type 2 diabetes. J Clin Endocrinol Metab. 2008;93(7):2479–2485. doi: 10.1210/jc.2007-2851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Piro S, Spadaro L, Russello M, Spampinato D, Oliveri CE, Vasquez E, et al. Molecular determinants of insulin resistance, cell apoptosis and lipid accumulation in non-alcoholic steatohepatitis. Nutr Metab Cardiovasc Dis. 2008;18(8):545–552. doi: 10.1016/j.numecd.2007.08.002. [DOI] [PubMed] [Google Scholar]
  • 37.Arnes L, Moreno P, Nuche-Berenguer B, Valverde I, Villanueva-Penacarrillo ML. Effect of exendin-4 treatment upon glucose uptake parameters in rat liver and muscle, in normal and type 2 diabetic state. Regul Pept. 2008 doi: 10.1016/j.regpep.2008.08.005. [DOI] [PubMed] [Google Scholar]
  • 38.Sajan MP, Standaert ML, Nimal S, Varanasi U, Pastoor T, Mastorides S, et al. The critical role of atypical protein kinase C in activating hepatic SREBP-1c and NF{kappa}B in obesity. J Lipid Res. 2009;50(6):1133–1145. doi: 10.1194/jlr.M800520-JLR200. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

RESOURCES