Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2010 Mar 1;54(5):1834–1841. doi: 10.1128/AAC.01608-09

Detection of E119V and E119I Mutations in Influenza A (H3N2) Viruses Isolated from an Immunocompromised Patient: Challenges in Diagnosis of Oseltamivir Resistance ▿ †

Margaret Okomo-Adhiambo 1, Gail J Demmler-Harrison 2, Varough M Deyde 1, Tiffany G Sheu 1, Xiyan Xu 1, Alexander I Klimov 1, Larisa V Gubareva 1,*
PMCID: PMC2863645  PMID: 20194700

Abstract

The clinical use of the neuraminidase inhibitor (NAI) oseltamivir is associated with the emergence of drug resistance resulting from subtype-specific neuraminidase (NA) mutations. The influenza A/Texas/12/2007 (H3N2) virus isolated from an oseltamivir-treated immunocompromised patient exhibited reduced susceptibility to oseltamivir in the chemiluminescent neuraminidase inhibition (NI) assay (∼60-fold increase in its 50% inhibitory concentration [IC50] compared to that for a control virus). When further propagated in cell culture, the isolate maintained reduced susceptibility to oseltamivir in both chemiluminescent and fluorescent NI assays (∼50- and 350-fold increases in IC50, respectively). Sequencing analysis of the isolate revealed a mix of nucleotides coding for amino acids at position 119 of the NA [E119(V/I)]. Plaque purification of the isolate yielded E119V and E119I variants, both exhibiting reduced susceptibility to oseltamivir. The E119I variant also showed decreased susceptibility to zanamivir and the investigational NAIs peramivir and A-315675. The emergence of E119V variants in oseltamivir-treated patients has been previously reported; however, the E119I mutation detected here is a novel one which reduces susceptibility to several NAIs. Both mutations were not detected in unpropagated original clinical specimens using either conventional sequencing or pyrosequencing, suggesting that these variants were present in very low proportions (<10%) in clinical specimens and gained dominance after virus propagation in MDCK cells. All virus isolates recovered from the patient were resistant to adamantanes. Our findings highlight the potential for emergence and persistence of multidrug-resistant influenza viruses in oseltamivir-treated immunocompromised subjects and also highlight challenges for drug resistance diagnosis due to the genetic instability of the virus population upon propagation in cell culture.


Antiviral drugs are vital in the management of influenza infections (28), especially in immunocompromised patients, where they significantly reduce the risk of pulmonary complications and influenza-associated mortality (23). Despite antiviral therapy, immunocompromised patients often experience sustained viral replication and prolonged shedding of influenza viruses (37), creating a risk factor for the emergence of drug resistance, which may result in treatment failure and viral transmission to others (4, 24).

Two classes of antiviral agents are currently licensed for the control of influenza infections: M2 ion channel blockers and neuraminidase inhibitors (NAIs). The M2 blockers (amantadine and rimantadine) are effective against influenza A viruses but not influenza B viruses (31). However, their effectiveness has been compromised by the rapid emergence of resistance among influenza A (H3N2) subtypes and among some type A (H1N1) viruses circulating in certain geographic areas (5, 13).

Oseltamivir and zanamivir are the only FDA-approved NAIs for use against type A and type B influenza infections (28). Oseltamivir is administered orally, whereas zanamivir is inhaled (9) and is not recommended for use in severely ill patients and young children (15). An investigational NAI, peramivir, is currently undergoing phase II studies (33). NAIs mimic the natural substrate of neuraminidase (NA), sialic acid (N-acetylneuraminic acid), and competitively bind to the highly conserved NA active site, inhibiting the enzyme's key function of destroying the neuraminic acid-containing receptors, thus preventing the release of progeny virions from infected cells and dissemination to neighboring cells (28).

The highly conserved NA enzyme active site comprises catalytic amino acid residues that directly interact with the substrate (R118, D151, R152, R224, E276, R292, R371, and Y406; NA subtype 2 [N2] numbering) and framework residues (E119, R156, W178, S179, D198N, I222, E227, H274, E277, N294, and E425) which support the catalytic residues (10, 36). Mutations in the NA active site result from single amino acid changes and confer resistance to NAIs in a drug- and NA subtype-specific manner (14).

The frequency of resistance to oseltamivir has previously been low, except in hospitalized children and immunocompromised patients (2). However, during the 2007-2008 and 2008-2009 influenza seasons, the emergence and transmission of oseltamivir-resistant seasonal influenza A (H1N1) viruses with an H274Y mutation (H275Y in NA subtype 1 [N1] numbering) were detected globally in untreated individuals (26, 34), emphasizing the need for close monitoring of oseltamivir resistance. In subtype N2 viruses, mutations at catalytic (R292K) and framework (E119V and N294S) NA residues have been detected in oseltamivir-treated patients (2). An oseltamivir resistance-conferring 4-amino-acid deletion mutation (deletion of residues 245 to 248) was reported in an influenza A (H3N2) virus isolated from an immunocompromised patient treated with the drug (1).

In contrast, zanamivir-resistant mutants are less common than oseltamivir-resistant mutants, partly due to differences in binding to the NA active site between the two drugs (28) and perhaps because of the less frequent prescription and use of zanamivir. Recently, a naturally occurring Q136K mutation which reduced sensitivity to zanamivir but not oseltamivir was detected in influenza A (H3N2) viruses isolated from patients not previously treated with NAIs (11). A similar Q136K mutation which conferred resistance to zanamivir and peramivir but not oseltamivir was detected in the NA of influenza A (H1N1) virus isolates but was not present in original clinical specimens (22, 30).

The major public health concern about antiviral drug resistance is person-to-person transmission of such variants (19). NAI-resistant variants often show compromised fitness (39); however, the recent increase of oseltamivir-resistant influenza A (H1N1) viruses harboring the H274Y (H275Y in N1 numbering) mutation has shown that NAI-resistant viruses can rapidly spread and circulate in the global community (26, 34). NAI-resistant variants of the N2 subtype, such as the R292K (7, 16, 20) and E119G (8) variants, have shown reduced virulence in animal models, although one influenza A (H3N2) E119V variant (A/Wuhan/359/95-like) was transmitted as efficiently as the wild-type virus (21).

Our current algorithm for detection of resistance to NAIs requires testing of cell culture-grown virus in the neuraminidase inhibition (NI) assay and/or identification of established molecular markers of resistance in the NA. In this study, we report the emergence of two NAI-resistant variants of an influenza A (H3N2) virus, with either valine (E119V) or isoleucine (E119I) at position 119, in an oseltamivir-treated immunocompromised child with preexisting resistance to adamantanes. The E119V mutation has been previously studied by use of NI assays as well as molecular cloning and sequence analysis techniques (4, 24, 25) in oseltamivir-treated immunocompromised patients infected with influenza A (H3N2), but the E119I mutation which reduces susceptibility to different NAIs is previously undescribed. The results of this study indicate that although virus variants carrying mutations at residue E119 have been shown to emerge following oseltamivir treatment, their detection could be limited to virus isolates propagated in Madin-Darby canine kidney (MDCK) cells, where such virus variants have an apparent growth advantage over wild-type viruses. The study highlights the potential pitfalls in the current approach to diagnosing NAI resistance, which could lead to its overestimation.

MATERIALS AND METHODS

Patient information.

The patient was a 2.5-year-old male with a history of X-linked lymphoproliferative disorder, confirmed by genetic testing, and a history of recurrent viral infections. He was admitted to Texas Children's Hospital on 18 February 2007 with a high fever, pneumonitis, hepatosplenomegaly, and pancytopenia. Evaluation for etiology revealed that the patient had developed hemophagocytic lymphohistiocytosis syndrome (HLH). On 11 March, the patient developed a fever of 104.7°F and an abnormal breathing pattern. The 3M rapid detection flu A+B enzyme immunoassay on nasal wash secretions was positive, and viral culture grew influenza A virus. Oseltamivir (45 mg, orally) was administered twice daily for 7 days (11 March to 17 March). On 16 March, chemotherapy for HLH consisting of dexamethasone (Decadron), cyclosporine, and VP16 was initiated. On 23 March, the patient developed rhinorrhea and cough, and a viral culture performed on nasal wash secretions once again grew influenza A virus, but antiviral treatment was not administered. Throughout the remainder of March and April, the patient experienced intermittent rhinorrhea, nasal congestion, wheezes, and fever, but viral cultures performed on nasal wash secretions were negative. On 23 May, the patient developed a fever and bilateral parotitis, and viral culture of secretions from Stensen's duct grew influenza A virus. On 28 May, the patient developed a barky cough, croup, and laryngotracheobronchitis, and his condition was severe enough to require intubation for airway protection. Direct laryngoscopy confirmed presence of subglottic swelling and hyperemic mucosa. Nasal wash secretions obtained 28 May and 30 May also grew influenza A virus. On 30 May, 45 mg oseltamivir was administered orally twice daily and continued until 28 August. The patient remained on HLH chemotherapy, including dexamethasone and cyclosporine, and his white blood count remained severely depressed and his absolute neutrophil count (ANC) remained 0. He improved and was extubated on 6 June. However, his intermittent fever and respiratory symptoms, including copious rhinorrhea, persisted through June and July. Nasal wash specimens obtained during July and August 2007 were persistently positive for influenza A virus. During the month of August, the patient remained in the pediatric intensive care unit, intubated, sedated, and on ventilatory and circulatory support. Oseltamivir was continued for his chronic influenza A virus infection. Broad-spectrum antibiotics were administered and dexamethasone and cyclosporine were continued for his HLH. He remained pancytopenic, with an ANC of 0, and his chest imaging (X-ray and CT scans) showed progressive consolidative pneumonia with air bronchograms. The patient expired on 31 August 2007 from multisystem organ failure.

Viruses and cells.

Influenza virus isolates and clinical specimens obtained between 11 March and 14 August 2007 from the oseltamivir-treated immunocompromised patient were submitted to the World Health Organization Collaborating Center for Surveillance, Epidemiology and Control of Influenza at the CDC in Atlanta, GA. Virus isolates (passaged at least once at the originating laboratory) were propagated further in MDCK cells at the CDC. Reference viruses representative of influenza A (H3N2), including A/Washington/01/2007, were also propagated in MDCK cells.

NA inhibitors.

Zanamivir was supplied by GlaxoSmithKline (Uxbridge, United Kingdom), while oseltamivir carboxylate, the active compound of the ethyl ester prodrug oseltamivir phosphate, was supplied by Hoffman-La Roche (Basel, Switzerland). Additional investigational inhibitors were used in the study, including peramivir (BioCryst Pharmaceuticals, Birmingham, AL) and A-315675 (Abbott Laboratories, Abbott Park, IL).

NA inhibition assays.

Susceptibility of viruses to NAIs was assessed using chemiluminescent and fluorescent NI assays, as earlier described (34, 35). The chemiluminescent and fluorescent NI assays use a 1,2-dioxetane derivative of sialic acid (6) and methyl umbelliferone N-acetylneuraminic acid (MUNANA) (32), respectively, as the substrate.

Statistical analysis.

Calculation of 50% inhibitory concentration (IC50) values and curve fitting were performed by Robosage version 7.31 software (GlaxoSmithKline, Research Triangle Park, NC), an add-in for Microsoft Excel (Microsoft Corp., Redmond, WA), using the equation y = Vmax × {1 − [x/(K + x)]}, where y is the response being inhibited, x is the inhibitor concentration, K is the IC50 for the inhibition curve, and Vmax is the maximum rate of metabolism (y = 50% Vmax when x = K) as previously described (34).

RNA extraction and RT-PCR.

Viral RNAs were extracted from 100 μl of viral cell culture supernatant using the QIAamp viral RNA minikit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Reverse transcription-PCR (RT-PCR) was performed using the SuperScript III One-Step HIFI system (Invitrogen, Carlsbad, CA) in accordance with the manufacturer's instructions. Primers for RT-PCR and pyrosequencing (Table 1) were designed from 1,300 aligned NA consensus sequences of human influenza A (H3N2) viruses using Pyrosequencing assay design software (Biotage AB, Uppsala, Sweden) and were synthesized at the CDC Biotechnology Core Facility.

TABLE 1.

Primers for pyrosequencing targeting codon 119 of the neuraminidase gene

Primer Primer sequence (5′ to 3′)
Forward (HuN2NA-F333-biot) TGGGGACATCTGGGTGACA
Reverse (HuN2NA-R914) ATATCTACTATGGGCCTATTGGA
Sequencing (HuN2NA-119-
    R377-seq) GGATCGCATGACACATA

Pyrosequencing assay.

Pyrosequencing assays to detect molecular markers of resistance to adamantanes and mutation at residue 119 in N2 were performed as described earlier (5, 12).

Sequencing by dideoxy chain termination method.

Viral RNA extraction and RT-PCR were performed as described above. Amplified PCR products were purified using ExoSAP-IT reagent (USB, Cleveland, OH), and the sequence template was synthesized using the ABI Prism BigDye terminator kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Purification of the sequencing product was performed using Centri-Sep 96-well spin columns (Princeton Separations, Adelphia, NJ), and sequences were generated in an ABI Prism 3730 genetic analyzer (Applied Biosystems, Foster City, CA). Analysis of the electronic sequence data was performed using Lasergene DNAStar software version 7.0 (DNAStar, Madison, WI).

Plaque purification of variants.

The virus isolate A/Texas/12/2007 (H3N2) (passage X/C3, where X denotes that the virus isolate was grown in the originating laboratory with an unknown passage number and cell culture and C3 denotes that the same virus isolate was passaged an additional three times in MDCK cells at the CDC reference laboratory) was plaque purified in MDCK cells by a standard procedure to separate the E119V and E119I variants. Briefly, MDCK cells were seeded in 6-well plates and incubated at 37°C in 5% CO2 for ∼24 h. Confluent monolayers were rinsed with phosphate-buffered saline (PBS) and overlaid with Dulbecco's modified Eagle medium (DMEM) (1% penicillin-streptomycin solution [pen-strep], 2.5% bovine serum albumin-fraction V [BSA-V]). Six 10-fold serial dilutions of the virus isolate were made in DMEM (1% penn-strep, 2.5% BSA-V). Medium was removed from the 6-well plates, and MDCK monolayers were inoculated with 100 μl of serially diluted virus per well and incubated for 1 h at 37°C (rocked every 10 to 15 min). The inoculum was removed, and infected monolayers were rinsed with PBS. Equal volumes of 1.6% agarose at 56°C and 2× minimum essential medium (MEM) (5% BSA, 2% penn-strep, and 2 μg/ml TPCK [tosyl phenylalanyl chloromethyl ketone]-trypsin) at 37°C were mixed in 50-ml Falcon tubes, and 3 ml of the mixture was added to each well of infected monolayers and incubated at 37°C for 48 to 72 h. When plaques were visible, 100 μl of 5 mg/ml MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] (Sigma-Aldrich) in PBS was overlaid onto the agarose in each well and incubated for 2 to 3 h. Plaques were picked using sterile plastic pipettes and placed in 400 μl DMEM (1% penn-strep and 2.5% BSA, without fetal bovine serum). To amplify the plaques, 200 μl of the above-described inoculum was used to infect tube cultures containing 1 ml MDCK cells for 48 to 72 h. Purified viruses were vortexed and transferred to labeled screw-cap tubes in preparation for testing by the NAI assay and viral RNA extraction for pyrosequencing.

Nucleotide sequence accession numbers.

The NA gene sequences for A/Texas/12/2007 (H3N2) passage X/C3 and its plaque-purified variants A/Texas/12/2007 (H3N2) clone 1 and A/Texas/12/2007 (H3N2) clone 2 have been deposited in the GenBank database under accession numbers FJ445771, FJ445772, and FJ445773, respectively.

RESULTS

Our current protocol for monitoring influenza virus susceptibility to NAIs in community isolates requires additional propagation of submitted virus isolates in MDCK cells prior to testing in the NI assay (34). Accordingly, the virus isolate named A/Texas/12/2007 (H3N2) collected on 9 June 2007 from an immunocompromised patient was additionally passaged twice at the CDC (passage X/C2) and tested in the chemiluminescent NI assay with other community isolates. This virus isolate exhibited an elevated IC50 (9.18 nM) for oseltamivir carboxylate (Table 2) but was sensitive to zanamivir (IC50 = 1.09 nM). Sequencing analysis of its NA gene revealed an E119V mutation (GenBank accession no. EU516020), and this virus was reported as oseltamivir resistant in a virus surveillance study (34). The number of passages a virus isolate has undergone prior to submission to the CDC (denoted by X in this study) is not always certain, but it is usually one or two.

TABLE 2.

Chemiluminescent neuraminidase inhibition assay of A/Texas/12/2007 (H3N2) and plaque-purified clones

Strain designation Passage levelb NA mutation Mean IC50 ±SD (nM)a
Oseltamivir Zanamivir Peramivir A-315675
A/Texas/12/2007 X/C2 E119V 9.18 ± 1.10 1.09 ± 0.01 ND ND
A/Texas/12/2007 X/C3 E119(V/I) 8.06 ± 0.41 1.54 ± 0.47 0.51 ± 0.00 1.35 ± 0.15
A/Texas/12/2007 clone 1 X/C4 E119V 5.49 ± 0.03 1.38 ± 0.45 0.43 ± 0.02 1.25 ± 0.03
A/Texas/12/2007 clone 2 X/C4 E119I 33.25 ± 7.01 12.67 ± 5.33 0.90 ± 0.11 4.96 ± 0.47
A/Washington/01/2007 (sensitive control) None 0.16 ± 0.03 0.76 ± 0.08 0.28 ± 0.02 0.74 ± 0.01
a

Average IC50 of two independent chemiluminescent NI assays; IC50s of test viruses are compared with those of oseltamivir-sensitive control A/Washington/01/2007 (H3N2) to determine the fold difference in IC50. ND, not done due to insufficient specimen volume.

b

X denotes that the virus isolate was grown in the originating laboratory with an unknown passage number and cell culture, and C2, C3, and C4 denote that the same virus isolate was passaged an additional two, three, or four times, respectively, in MDCK cells at the CDC reference laboratory.

To characterize A/Texas/12/2007 (H3N2) in the fluorescent NI assay, which requires a larger volume of test virus than the chemiluminescent NI assay, the virus isolate was propagated for the third time in MDCK cells (passage X/C3) and tested with four NAIs, two of which were investigational. In this assay, the virus exhibited elevated IC50s for oseltamivir (154 nM) and peramivir (33.56 nM) but retained susceptibility to zanamivir and A-315675 (Table 3). In contrast, previously reported influenza A (H3N2) viruses with E119V mutations did not exhibit the reduced susceptibility to peramivir in a fluorescent assay (4, 27).

TABLE 3.

Fluorescent neuraminidase inhibition assay of A/Texas/12/2007 (H3N2) virus and plaque-purified clones

Strain designation Passage levelb NA mutation Mean IC50±SD (nM)a
Oseltamivir Zanamivir Peramivir A-315675
A/Texas/12/2007 X/C3 E119(V/I) 154.00 ± 3.90 3.80 ± 0.27 33.56 ± 12.39 3.00 ± 1.48
A/Texas/12/2007 clone 1 X/C4 E119V 245.50 ± 23.98 5.49 ± 0.32 1.47 ± 0.02 5.45 ± 2.76
A/Texas/12/2007 clone 2 X/C4 E119I 430.59 ± 60.51 18.59 ± 5.80 214.07 ± 10.71 23.94 ± 1.39
A/Washington/01/2007 (sensitive control) None 0.44 ± 0.03 1.60 ± 0.05 0.50 ± 0.01 1.22 ± 0.01
a

Average IC50 of two independent fluorescent NI assays; IC50s of test viruses are compared with those of oseltamivir-sensitive control A/Washington/01/2007 (H3N2) to determine the fold difference in IC50.

b

X denotes that the virus isolate was grown in the originating laboratory with an unknown passage number and cell culture, and C3 and C4 denote that the same virus isolate was passaged an additional three or four times, respectively, in MDCK cells at the CDC reference laboratory.

To further investigate this virus isolate, its NA sequence was analyzed (GenBank accession no. FJ445771), and the results revealed a mix of nucleotides coding for the amino acid at position 119, indicating the potential presence of two variants, E119V and E119I. To separate these virus variants, the isolate A/Texas/12/2007 (H3N2) (passage X/C3) was plaque purified in MDCK cells. The resulting individual plaques (n = 25) were picked and propagated in MDCK cells. Their NA sequences were determined by a pyrosequencing assay targeted at residue 119 in NA subtype N2 (12). A reverse primer, HuN2NA-119-R377-seq (Table 1), was used for pyrosequencing the region of the NA containing residue 119.

The results of the pyrosequencing assay showed that the virus isolate A/Texas/12/2007 (passage X/C3) had the sequence (G/A)TA, complementary to TA(T/C), indicating that glutamic acid (GAA) was replaced by valine (GTA) or isoleucine (ATA) (Fig. 1A). Among the 25 separated clones, 12 exhibited GTA (E119V), while 13 had ATA (E119I) (Fig. 1B and C, respectively). The drug-sensitive control virus, A/Washington/01/2007 (H3N2), had the TTC sequence, complementary to GAA, which encodes glutamic acid (Fig. 1D).

FIG. 1.

FIG. 1.

Pyrograms showing sequence data for detection of base substitutions in the codon of the NA gene for residue E119 of A/Texas/12/2007 (H3N2) (passage X/C3) and its plaque-purified variants. Reverse primer HuN2NA-119-R377-seq (Table 1) was used for sequencing the region containing residue 119; hence, the sequence displayed on the pyrograms is a reverse complement to the original sequence. The panels represent pyrograms for virus isolate A/Texas/12/2007 (H3N2) with the mixed sequence TA(T/C), complementary to (G/A)TA (GTA, valine; ATA, isoleucine) (A), a plaque-purified variant possessing the sequence TAC, complementary to GTA, which codes for valine (B), a plaque-purified variant with the sequence TAT, complementary to ATA, which encodes isoleucine (C), and sensitive wild-type A/Illinois/01/2007 (H3N2) with the sequence TTC, complementary to GAA, which encodes glutamic acid (E119) (D).

The plaque-purified E119V and E119I variants were then tested for drug susceptibility using chemiluminescent and fluorescent NI assays (Tables 2 and 3). In both assays, the oseltamivir IC50 for the E119V variant was elevated, while IC50s for the remaining NAIs remained normal (Tables 2 and 3), which is in accord with previous reports (27, 34). The E119I mutation conferred greater resistance to oseltamivir than E119V, and the E119V variant exhibited reduced susceptibility to zanamivir and two investigational NAIs, peramivir and A-315675, in both assays (Tables 2 and 3). Overall, the observed level of resistance to NAIs was greater in the fluorescent than in the chemiluminescent NI assay. For example, in the fluorescent assay, the confirmed oseltamivir resistance of the E119V and E119I variants was based on 558- and 979-fold increases in IC50s, respectively, compared to 34- and 208-fold increases, respectively, in the chemiluminescent assay.

To investigate in detail the emergence of NAI-resistant variants in relation to the treatment course, consecutive samples (original clinical specimens and virus isolates) obtained from this clinical case between 11 March and 14 August 2007 were analyzed by pyrosequencing (Table 4). Pyrograms of sequence data are provided in Fig. 1S and 2S in the supplemental material. Of note, neither the E119V nor the E119I mutation was detected in five clinical specimens collected prior to or after 9 June, the sampling date for A/Texas/12/2007 (H3N2). Unfortunately, the matching clinical specimen collected on 9 June was not available for testing. However, two virus isolates (passages X and X1, where X1 denotes that the virus isolate was propagated once at the originating laboratory and has an unspecified cell culture) obtained on 9 June were available for testing and contained the mutation E119V but not E119I (Table 4). In addition, the mutation E119V was found in three virus isolates from 11 June, 9 July, and 23 July, almost 2 months after initial sampling of A/Texas/12/2007 (H3N2). However, this mutation was not detected in the only available matching clinical specimen collected on 23 July.

TABLE 4.

Characterization of NA mutation at codon 119 in relation to oseltamivir treatment in original clinical specimens, received isolates, and CDC-grown isolates of influenza A/Texas/12/2007 (H3N2)

Sample Collection date (mo-day)a Specimen typeb Passage historyc Codon 119 sequence Codon 119 mutation Oseltamivir susceptibilityd Oseltamivir treatment periode
1 3-11 NS Original GAA S First
2 3-11 IR X1 GAA S First
3 3-11 IG X1/C2 GAA S First
4 3-25 IR X1 GAA S None
5 3-25 IG X1/C1 GAA S None
6 5-23 IR X1 GAA S None
7 5-23 IG X1/C1 GAA S None
8 5-28 IR X1 GAA S None
9 5-28 IG X1/C1 GAA S None
10 5-31 NS Original GAA S Second
11 5-31 IR X1 GAA S Second
12 5-31 IG X1/C1 GAA S Second
13 6-6 IR X1 GAA S Second
14 6-6 IG X1/C2 GAA S Second
15 6-9 IR X GTA E119V R Second
16 6-9 IG X/C2 GTA E119V R Second
17 6-9 IG X/C3 G/ATA E119V/I R Second
18 6-9 IR X1 GTA E119V R Second
19 6-9 IG X1/C1 GTA E119V R Second
20 6-11 IR X GTA E119V R Second
21 6-11 IG X/C2 GTA E119V R Second
22 6-25 NS Original GAA S Second
23 6-25 IR X1 GAA S Second
24 6-25 IG X1/C2 GAA S Second
25 7-2 IR X1 GAA S Second
26 7-2 IG X1/C2 GAA S Second
27 7-9 IR X1 GTA E119V R Second
28 7-9 IG X1/C1 GTA E119V R Second
29 7-23 NS Original GAA S Second
30 7-23 IR X1 GTA E119V R Second
31 7-23 IG X1/C1 GTA E119V R Second
32 8-14 NS Original GAA S Second
33 8-14 IR X1 GAA S Second
34 8-14 IG X1/C2 GAA S Second
a

Year 2007.

b

NS, nasal swab; IR, received virus isolate (propagated in cell culture at the originating laboratory and then submitted to the CDC); IG, grown virus isolate (grown at the CDC).

c

X1 denotes that the virus isolate was propagated once at the originating laboratory; cell culture unspecified. X denotes that the virus isolate was grown in the originating laboratory with an unknown passage number and cell culture, and C1, C2, and C3 denote that the same virus isolate was passaged an additional one, two, or three times, respectively, in MDCK cells at the CDC reference laboratory. Original, original specimen from nasal swab; not passaged.

d

S, sensitive; R, resistant.

e

The first treatment period lasted from 11 March to 17 March 2007. No treatment was given from 18 March to 29 May. The second treatment lasted from 30 May through 28 August.

To complete the analysis, the additional virus isolates (n = 14) from this patient submitted to the CDC were further propagated once or twice in MDCK cells and subjected to pyrosequencing analysis. In agreement with the earlier results, the E119V mutation was detected in five MDCK cell-grown virus isolates that previously harbored this mutation (Table 4). Of note, only A/Texas/12/2007 (H3N2) virus, which was passaged three times after submission to the CDC (passage X1/C3), exhibited the mixed E119(V/I) mutations.

DISCUSSION

Public health risk assessment of viruses with reduced susceptibility to NAIs requires their accurate identification based on markers of resistance in the viral genome (NA) and/or functional assays. Analysis of viruses recovered from high-risk populations, such as young children and immunocompromised patients shedding virus for extended periods of time, provides an opportunity to improve our understanding of the mechanisms of resistance to NAIs and to refine the criteria for resistance diagnosis.

In the present study, we detected an E119V mutation, previously associated with oseltamivir resistance, in virus isolate A/Texas/12/2007 (H3N2) (passage X/C2) recovered from an immunocompromised patient treated with oseltamivir. Oseltamivir (45 mg, orally, twice daily) was administered from 11 March to 17 March 2007, with no treatment from 18 March to May 29. A similar dose was repeated from 30 May to 28 August. The E119V variants were not detected in virus isolates from 11 March, the first day of treatment; in virus isolates obtained between 25 March and 28 May, a period when oseltamivir was not administered; nor in isolates from 31 May to 6 June, dates corresponding to the first week of prolonged oseltamivir treatment. The E119V mutation was first detected in virus isolates sampled on 9 June, 10 days following the second course of oseltamivir treatment, and was present in a total of five virus isolates sampled between 9 June and 23 July, strongly suggesting that these variants emerged as a result of oseltamivir therapy. To our knowledge, neither E119V nor E119I variants have previously been detected in untreated patients.

Following additional propagation of A/Texas/12/2007 (H3N2) (passage X/C2) with the E119V mutation, a second drug-resistant variant with a novel E119I mutation was detected. This E119I variant exhibited greater resistance to oseltamivir than the E119V variant and exhibited reduced susceptibility to zanamivir and two investigational NAIs, peramivir and A-315675. Overall, the E119I variant exhibited ∼6- and ∼2-fold greater IC50s than the E119V variant in the chemiluminescent and fluorescent NI assays, respectively, suggesting that replacement of an acidic amino residue (Glu) with a nonpolar hydrophobic one (Ile) may cause greater interference with binding of NAIs to the NA active site. Like the majority of influenza A (H3N2) viruses circulating globally (13), all viruses recovered from this patient had the S31N mutation in their M2 protein (data not shown) that confers cross-resistance to adamantanes (amantadine and rimantadine). Therefore, based on laboratory testing, this E119I virus variant was cross-resistant to all four FDA-approved anti-influenza drugs.

The majority of mutations in the NA active site of drug-resistant viruses result from single nucleotide substitutions; however, the E119I framework mutation detected in this study requires two consecutive nucleotide substitutions at codon 119, an uncommon occurrence. Studies have shown that the infectivity and transmissibility of viruses carrying catalytic mutations are impaired in comparison to those of viruses carrying mutations on framework residues, such as E119V, which was transmissible in a ferret model (21). It is unknown at this time whether the E119I framework mutation detected here affects enzyme stability and activity or what effects it may have on virus fitness.

In the present study, we used the chemiluminescent NI assay for initial screening of drug resistance and the fluorescent NI assay to confirm resistance detected with the former assay. The fluorescent NI assay (Table 3) generated higher IC50s than the chemiluminescent assay (Table 2), which was in accord with previous observations (38) and may be attributed to structural differences in the synthetic substrates utilized (6, 32). In our experience and others' (3, 29), the fluorescent NI assay offers a better discrimination between the IC50s of the mutant and wild-type viruses; however, it also requires a higher virus titer than the chemiluminescent assay and therefore necessitates additional propagation of viruses in MDCK cells.

NAI resistance testing is currently conducted in cell-grown viruses, but cell cultures have been shown to provide a growth advantage to particular virus variants, including those with mutations in the NA (12, 22, 30, 35). Our study provides evidence that the E119V and E119I virus variants may have a growth advantage over wild-type viruses when virus isolation takes place in MDCK cells. This phenomenon, though not clearly understood, could be a consequence of different requirements in the NA activity when virus replication occurs in cell culture versus the human host. Because MDCK cells are the most commonly used cell line for influenza virus isolation and propagation, its propensity to select for NA variants poses serious implications for accurate diagnosis of resistance to NAIs. Such a growth advantage also makes it necessary to reanalyze the NA sequence of drug-resistant reference viruses after each additional passage in cell culture.

In the present study, we used the pyrosequencing approach (12), which allows the direct detection of virus variants in clinical specimens at proportions as low as 10%. Using this approach (as well as conventional sequencing), neither the E119V nor the E119I mutation was detected in any of the original clinical specimens obtained from the patient (Table 4). In essence, these mutations may have been present in the unpropagated clinical specimens but in proportions below the level of detection. A more sensitive technique, such as molecular cloning (24), may allow detection of very minor subpopulations of drug-resistant variants (1 to 5%) in clinical specimens, although it is unlikely that it would justify a change in drug prescription.

These findings are in accord with previous observations that the emergence of the NAI-resistant mutants in treated patients was more readily detectable in MDCK-propagated viruses than in matching clinical specimens (17, 18). However, some drug-resistant variants that emerged following treatment were clearly present in propagated virus isolates and original clinical specimens, as shown by pyrosequencing (12) and conventional sequencing (4). Our results highlight the challenges of detecting markers of oseltamivir resistance (established and/or novel) in the virus isolate but not in the matching clinical specimen and how that may affect the accuracy of resistance diagnosis. These findings emphasize the necessity to detect NAI resistance-conferring mutations in original clinical virus specimens prior to their propagation in cell culture to avoid the overestimation of resistance.

A major limitation of this study was that only a few original clinical specimens were submitted to the CDC for further investigation. Of the five submitted original clinical specimens, only one (collected 23 July) matched a virus isolate in which the E119V mutation was detected (Table 4). However, we did not detect a mutation at position 119 in this clinical specimen. Of note, no original clinical material matching the virus isolate with the mixed E119(V/I) mutations was available for confirmation of the presence of the E119V and E119I variants by sensitive techniques such as molecular cloning.

Analysis of viruses in the original clinical specimens reduces the potential for introducing genetic variance in the virus population due to selection by cell culture. For example, a mutation at residue D151 in the NA was detected in cell-grown viruses but not in matching clinical specimens of influenza A (H1N1) viruses (12); however, when present in combination with the H275Y mutation, it enhances resistance to oseltamivir and decreases susceptibility to other NAIs (30). These findings emphasize the importance of collecting and preserving matching clinical and virus isolates obtained on the same sampling date to facilitate efficient and reliable diagnosis of resistance to this class of anti-influenza drugs.

In conclusion, the results of the NAI resistance analysis conducted on consecutive clinical specimens and the corresponding virus isolates resulted in detection of oseltamivir resistance only following virus propagation in cell culture. This outcome of our study highlights the need for definitive criteria for diagnosis of resistance that adequately reflect the susceptibility status of the virus in the human host.

Supplementary Material

[Supplemental material]

Acknowledgments

We thank our collaborators in the WHO Global Influenza Surveillance Network, including the National Influenza Centers, for the submission of virus isolates. We also thank members of the Influenza Virus Surveillance and Diagnostics Branch and the entire Influenza Division for their contributions to this project.

M.O.-A. and T.G.S. received financial support for this work from the Oak Ridge Institute for Science and Education (ORISE), Oak Ridge, TN.

The findings and conclusions of this report are those of the authors and do not necessarily represent the views of the funding agency or the Centers for Disease Control and Prevention. We declare that we have no conflict of interest.

Footnotes

▿

Published ahead of print on 1 March 2010.

†

Supplemental material for this article may be found at http://aac.asm.org/.

REFERENCES

  • 1.Abed, Y., M. Baz, and G. Boivin. 2009. A novel neuraminidase deletion mutation conferring resistance to oseltamivir in clinical influenza A/H3N2 virus. J. Infect. Dis. 199:180-183. [DOI] [PubMed] [Google Scholar]
  • 2.Aoki, F. Y., G. Boivin, and N. Roberts. 2007. Influenza virus susceptibility and resistance to oseltamivir. Antivir. Ther. 12:603-616. [PubMed] [Google Scholar]
  • 3.Barnett, J. M., A. Cadman, D. Gor, M. Dempsey, M. Walters, A. Candlin, M. Tisdale, P. J. Morley, I. J. Owens, R. J. Fenton, A. P. Lewis, E. C. J. Claas, G. F. Rimmelzwaan, R. De Groot, and A. D. M. E. Osterhaus. 2000. Zanamivir susceptibility monitoring and characterization of influenza virus clinical isolates obtained during phase II clinical efficacy studies. Antimicrob. Agents Chemother. 44:78-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Baz, M., Y. Abed, J. McDonald, and G. Boivin. 2006. Characterization of multidrug-resistant influenza A/H3N2 viruses shed during 1 year by an immunocompromised child. Clin. Infect. Dis. 43:1555-1561. [DOI] [PubMed] [Google Scholar]
  • 5.Bright, R. A., M. J. Medina, X. Xu, G. Perez-Oronoz, T. R. Wallis, X. M. Davis, L. Povinelli, N. J. Cox, and A. I. Klimov. 2005. Incidence of adamantane resistance among influenza A (H3N2) viruses isolated worldwide from 1994 to 2005: a cause for concern. Lancet 366:1175-1181. [DOI] [PubMed] [Google Scholar]
  • 6.Buxton, R. C., B. Edwards, R. R. Juo, J. C. Voyta, M. Tisdale, and R. C. Bethell. 2000. Development of a sensitive chemiluminescent neuraminidase assay for the determination of influenza virus susceptibility to zanamivir. Anal. Biochem. 280:291-300. [DOI] [PubMed] [Google Scholar]
  • 7.Carr, J., J. Ives, L. Kelly, R. Lambkin, J. Oxford, D. Mendel, L. Tai, and N. Roberts. 2002. Influenza virus carrying neuraminidase with reduced sensitivity to oseltamivir carboxylate has altered properties in vitro and is compromised for infectivity and replicative ability in vivo. Antiviral Res. 54:79-88. [DOI] [PubMed] [Google Scholar]
  • 8.Colacino, J. M., W. G. Laver, and G. M. Air. 1997. Selection of influenza A and B viruses for resistance to 4-guanidino-Neu5Ac2en in cell culture. J. Infect. Dis. 176(Suppl. 1):S66-S68. [DOI] [PubMed] [Google Scholar]
  • 9.Colman, P. M. 2005. Zanamivir: an influenza virus neuraminidase inhibitor. Expert Rev. Anti Infect. Ther. 3:191-199. [DOI] [PubMed] [Google Scholar]
  • 10.Colman, P. M., J. N. Varghese, and W. G. Laver. 1983. Structure of the catalytic and antigenic sites in influenza virus neuraminidase. Nature 303:41-44. [DOI] [PubMed] [Google Scholar]
  • 11.Dapat, C., Y. Suzuki, R. Saito, Y. Kyaw, Y. Y. Myint, N. Lin, H. N. Oo, K. Y. Oo, N. Win, M. Naito, G. Hasegawa, I. C. Dapat, H. Zaraket, T. Baranovich, M. Nishikawa, T. Saito, and H. Suzuki. 2010. Rare influenza A (H3N2) variants with reduced sensitivity to antiviral drugs. Emerg. Infect. Dis. [Epub ahead of print.] doi: 10.3201/eid1603.091321. [DOI] [PMC free article] [PubMed]
  • 12.Deyde, V. M., M. Okomo-Adhiambo, T. G. Sheu, T. R. Wallis, A. Fry, N. Dharan, A. I. Klimov, and L. V. Gubareva. 2009. Pyrosequencing as a tool to detect molecular markers of resistance to neuraminidase inhibitors in seasonal influenza A viruses. Antiviral Res. 81:16-24. [DOI] [PubMed] [Google Scholar]
  • 13.Deyde, V. M., X. Xu, R. A. Bright, M. Shaw, C. B. Smith, Y. Zhang, Y. Shu, L. V. Gubareva, N. J. Cox, and A. I. Klimov. 2007. Surveillance of resistance to adamantanes among influenza A(H3N2) and A(H1N1) viruses isolated worldwide. J. Infect. Dis. 196:249-257. [DOI] [PubMed] [Google Scholar]
  • 14.Ferraris, O., and B. Lina. 2008. Mutations of neuraminidase implicated in neuraminidase inhibitors resistance. J. Clin. Virol. 41:13-19. [DOI] [PubMed] [Google Scholar]
  • 15.Freund, B., S. Gravenstein, M. Elliott, and I. Miller. 1999. Zanamivir: a review of clinical safety. Drug Saf. 21:267-281. [DOI] [PubMed] [Google Scholar]
  • 16.Gubareva, L. V., M. J. Robinson, R. C. Bethell, and R. G. Webster. 1997. Catalytic and framework mutations in the neuraminidase active site of influenza viruses that are resistant to 4-guanidino-Neu5Ac2en. J. Virol. 71:3385-3390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Gubareva, L. V., M. N. Matrosovich, M. K. Brenner, R. C. Bethell, and R. G. Webster. 1998. Evidence for zanamivir resistance in an immunocompromised child infected with influenza B virus. J. Infect. Dis. 178:1257-1262. [DOI] [PubMed] [Google Scholar]
  • 18.Gubareva, L. V., L. Kaiser, M. N. Matrosovich, Y. Soo-Hoo, and F. G. Hayden. 2001. Selection of influenza virus mutants in experimentally infected volunteers treated with oseltamivir. J. Infect. Dis. 183:523-531. [DOI] [PubMed] [Google Scholar]
  • 19.Hayden, F. G. 2004. Pandemic influenza: is an antiviral response realistic? Pediatr. Infect. Dis. J. 23:S262-S269. [DOI] [PubMed] [Google Scholar]
  • 20.Herlocher, M. L., J. Carr, J. Ives, S. Elias, R. Truscon, N. Roberts, and A. S. Monto. 2002. Influenza virus carrying an R292K mutation in the neuraminidase gene is not transmitted in ferrets. Antiviral Res. 54:99-111. [DOI] [PubMed] [Google Scholar]
  • 21.Herlocher, M. L., R. Truscon, S. Elias, H. L. Yen, N. A. Roberts, S. E. Ohmit, and A. S. Monto. 2004. Influenza viruses resistant to the antiviral drug oseltamivir: transmission studies in ferrets. J. Infect. Dis. 190:1627-1630. [DOI] [PubMed] [Google Scholar]
  • 22.Hurt, A. C., J. K. Holien, M. Parker, A. Kelso, and I. G. Barr. 2009. Zanamivir-resistant influenza viruses with a novel neuraminidase mutation. J. Virol. 83:10366-10373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ison, M. G., and F. G. Hayden. 2002. Viral infections in immunocompromised patients: what's new with respiratory viruses? Curr. Opin. Infect. Dis. 15:355-367. [DOI] [PubMed] [Google Scholar]
  • 24.Ison, M. G., L. V. Gubareva, R. L. Atmar, J. Treanor, and F. G. Hayden. 2006. Recovery of drug-resistant influenza virus from immunocompromised patients: a case series. J. Infect. Dis. 193:760-764. [DOI] [PubMed] [Google Scholar]
  • 25.Kiso, M., K. Mitamura, Y. Sakai-Tagawa, K. Shiraishi, C. Kawakami, K. Kimura, F. G. Hayden, N. Sugaya, and Y. Kawaoka. 2004. Resistant influenza A viruses in children treated with oseltamivir: descriptive study. Lancet 364:759-765. [DOI] [PubMed] [Google Scholar]
  • 26.Meijer, A., A. Lackenby, O. Hungnes, B. Lina, S. van-der-Werf, B. Schweiger, M. Opp, J. Paget, J. van-de-Kassteele, A. Hay, and M. Zambon. 2009. Oseltamivir-resistant influenza virus A (H1N1), Europe, 2007-08 season. Emerg. Infect. Dis. 15:552-560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mishin, V. P., F. G. Hayden, and L. V. Gubareva. 2005. Susceptibilities of antiviral-resistant influenza viruses to novel neuraminidase inhibitors. Antimicrob. Agents Chemother. 49:4515-4520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Moscona, A. 2008. Medical management of influenza infection. Annu. Rev. Med. 59:397-413. [DOI] [PubMed] [Google Scholar]
  • 29.Mungall, B. A., X. Xu, and A. Klimov. 2003. Assaying susceptibility of avian and other influenza A viruses to zanamivir: comparison of fluorescent and chemiluminescent neuraminidase assays. Avian Dis. 47:1141-1144. [DOI] [PubMed] [Google Scholar]
  • 30.Okomo-Adhiambo, M., H. T. Nguyen, K. Sleeman, T. G. Sheu, V. M. Deyde, R. J. Garten, X. Xu, M. W. Shaw, A. I. Klimov, and L. V. Gubareva. 2010. Host cell selection of influenza neuraminidase variants: implications for drug resistance monitoring in A(H1N1) viruses. Antiviral Res. 85:381-388. [DOI] [PubMed] [Google Scholar]
  • 31.Pinto, L. H., and R. A. Lamb. 2006. Influenza virus proton channels. Photochem. Photobiol. Sci. 5:629-632. [DOI] [PubMed] [Google Scholar]
  • 32.Potier, M., L. Mameli, M. Belisle, L. Dallaire, and S. B. Melancon. 1979. Fluorometric assay of neuraminidase with a sodium (4-methylumbelliferyl-alpha-d-N-acetylneuraminate) substrate. Anal. Biochem. 94:287-296. [DOI] [PubMed] [Google Scholar]
  • 33.Schirmer, P., and M. Holodniy. 2009. Oseltamivir for treatment and prophylaxis of influenza infection. Expert Opin. Drug Saf. 8:357-371. [DOI] [PubMed] [Google Scholar]
  • 34.Sheu, T. G., V. M. Deyde, M. Okomo-Adhiambo, R. J. Garten, X. Xu, R. A. Bright, E. N. Butler, T. R. Wallis, A. I. Klimov, and L. V. Gubareva. 2008. Surveillance for neuraminidase inhibitor resistance among human influenza A and B viruses circulating worldwide from 2004 to 2008. Antimicrob. Agents Chemother. 52:3284-3292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tisdale, M. 2000. Monitoring of viral susceptibility: new challenges with the development of influenza NA inhibitors. Rev. Med. Virol. 10:45-55. [DOI] [PubMed] [Google Scholar]
  • 36.Varghese, J. N., W. G. Laver, and P. M. Colman. 1983. Structure of the influenza virus glycoprotein antigen neuraminidase at 2.9 A resolution. Nature 303:35-40. [DOI] [PubMed] [Google Scholar]
  • 37.Weinstock, D. M., L. V. Gubareva, and G. Zuccotti. 2003. Prolonged shedding of multidrug-resistant influenza A virus in an immunocompromised patient. N. Engl. J. Med. 348:867-868. [DOI] [PubMed] [Google Scholar]
  • 38.Wetherall, N. T., T. Trivedi, J. Zeller, C. Hodges-Savola, J. L. McKimm-Breschkin, M. Zambon, and F. G. Hayden. 2003. Evaluation of neuraminidase enzyme assays using different substrates to measure susceptibility of influenza virus clinical isolates to neuraminidase inhibitors: report of the neuraminidase inhibitor susceptibility network. J. Clin. Microbiol. 41:742-750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yen, H.-L., L. M. Herlocher, E. Hoffmann, M. N. Matrosovich, A. S. Monto, R. G. Webster, and E. A. Govorkova. 2005. Neuraminidase inhibitor-resistant influenza viruses may differ substantially in fitness and transmissibility. Antimicrob. Agents Chemother. 49:4075-4084. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES