Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2010 Mar 24;48(5):1787–1794. doi: 10.1128/JCM.02452-09

Human Picobirnaviruses Identified by Molecular Screening of Diarrhea Samples▿ †

Marije van Leeuwen 1, Marisol M W Williams 1, Penelope Koraka 1,2, James H Simon 1, Saskia L Smits 1, Albert D M E Osterhaus 1,2,*
PMCID: PMC2863890  PMID: 20335418

Abstract

The global threat of (re)emerging infectious viruses requires a more effective approach regarding virus surveillance and diagnostic assays, as current diagnostics are often virus species specific and not able to detect highly divergent or unknown viruses. A systematic exploration of viruses that infect humans is the key to effectively counter the potential public health threat caused by new and emerging infectious diseases. The human gut is a known reservoir of a wide variety of microorganisms, including viruses. In this study, Dutch clinical diarrhea samples for which no etiological agent could be identified by available cell culture, serological, or nucleic acid-based tests were gathered. Large-scale molecular RNA virus screening based on host nucleic acid depletion, sequence-independent amplification, and sequencing of partially purified viral RNA from a limited number of clinical diarrhea samples revealed four eukaryotic virus species. Among the detected viruses were a rhinovirus and a new picobirnavirus variant. In total, ∼20% of clinical diarrhea samples contained human picobirnavirus sequences. The Dutch picobirnaviruses belonged to different phylogenetic clades and did not group with other picobirnaviruses according to year of isolation or host species. Interestingly, the average age of patients infected with picobirnavirus was significantly higher than that of uninfected patients. Our data show that sequence-independent amplification of partially purified viral RNA is an efficient procedure for identification of known and highly divergent new RNA viruses in clinical diarrhea samples.


Infectious diseases, both emerging and reemerging, pose a continuous health threat and a burden to humans. Since the 1980s, an increased frequency of infectious outbreaks in humans and animals has been observed. Over 50 (re)emerging pathogens have been identified during the last 40 years, among which are human immunodeficiency virus, hepatitis C virus, H5N1 avian influenza A virus, and severe acute respiratory syndrome (SARS) coronavirus (12). In addition, during the last 5 years, the World Health Organization has verified more than 1,100 epidemic events worldwide (http://www.who.int/whr/en/index.html). Yet, our knowledge of viruses that infect humans is still incomplete, and many acute and chronic diseases with unknown etiology may be caused by as-yet-unidentified viruses.

The majority of viruses known today were first identified by animal experiments, virus replication in tissue culture, or molecular detection methods. For virus identification in clinical samples, laboratories nowadays perform largely viral-species-specific assays to increase the sensitivity of detection and reduce the time needed for diagnosis. Although these diagnostic assays are successful, failure rates in determining the etiological cause can vary significantly (11, 19, 31) because of limited detection of divergent viruses due to the high specificity of the assays. The discovery of new viruses with these assays remains rare. New technologies are currently being employed to increase virus identification; examples are virus microarray and sequence-independent amplification and sequencing of viral nucleic acids, which has already resulted in the identification of novel paramyxo-, parvo-, rhino-, corona-, retro-, picorna-, anello-, and polyomaviruses (1, 10, 15, 17, 22-24, 26, 34-37). These data indicate that a very large number of unidentified human viruses may still exist.

Diarrhea, characterized by frequent loose or liquid bowel movements, is a common cause of death in developing countries and the second-most-common cause of death in infants worldwide (39). In industrialized countries, diarrheal diseases are a significant cause of morbidity among all age groups. In the majority of cases, symptoms are brief, and patients do not require medical attention. Though typically self-limited, infectious diarrhea results in millions of visits to physicians annually (21). Risk factors include consumption of improperly prepared foods or contaminated water and travel or residence in areas of poor sanitation. Diarrhea commonly results from gastroenteritis caused by viral infections, parasites, or bacterial toxins (5, 39). In industrialized countries, most gastroenteritis cases are caused by viruses, such as rota-, calici-, astro-, and adenoviruses (5). However, the etiological cause of a large proportion of diarrhea cases remains unresolved. Therefore, we used sequence-independent amplification of partially purified viral RNA from clinical diarrhea samples that were determined to be negative for known pathogens by conventional diagnostic assays and identified known and new RNA virus variants.

MATERIALS AND METHODS

RNA virus-screening library construction.

The samples included in the study were diarrhea samples submitted to the Diagnostic Unit, Department of Virology, Erasmus Medical Center, Rotterdam, Netherlands, for diagnosis of gastrointestinal infections in 2007. Out of 1,025 samples screened by standard diagnostic assays for rota-, adeno-, astro-, noro-, entero-, and parechovirus, 165 stool samples were consistently found to be negative for these viruses. Of these 165 samples, 84 were available for additional studies. The percentage of patients with diarrhea of unknown etiology per month was determined, as was the percentage of patients per birth date. Data were compared using Student's t test, and differences were considered significant at a P of <0.05. In addition, 17 diarrhea samples (submitted to the Diagnostic Unit, Department of Virology, Erasmus Medical Center, Rotterdam, Netherlands, for diagnosis of gastrointestinal infections in 2007) in which a virus was previously detected were also available.

The 84 diarrhea samples were collected for the present study, made anonymous, annotated with VS numbers, and stored at −80°C until analyzed by random amplification of partially purified viral RNA, performed as described previously with modifications (1). A total of 13 diarrhea samples were suspended in phosphate-buffered saline (PBS) until their weight was 10% of the volume and centrifuged at 14,000 rpm for 5 min. Supernatants were filtered through 0.45-μm spin filters (Ultrafree-MC; Millipore), after which Omnicleave endonuclease (Epicentre Biotechnologies) and magnesium chloride (Applied Biosystems) were added to final concentrations of 2 U/μl and 5 mM, respectively, to degrade DNA and RNA. Viral nucleic acids are generally not degraded by nucleases, as they are protected by stable protein capsids and sometimes also by a lipid envelope. Samples were incubated for 1 h at 37°C. RNA was extracted from half of the samples using the Nucleospin RNA XS kit (Machery-Nagel), according to the instructions of the manufacturer. First-strand synthesis was performed by mixing RNA with 1 μM primer FR26RV-N (5′-GCCGGAGCTCTGCAGATATCNNNNNN-3′) and each deoxynucleoside triphosphate (dNTP) at 0.5 mM, which mixture was incubated at 95°C for 5 min and chilled on ice. First-strand buffer (5×; Invitrogen), dithiothreitol (DTT) (Invitrogen), RNasin (Promega), and Superscript III reverse transcriptase (Invitrogen) were added to final concentrations of 1×, 5 mM, 2 U/μl, and 10 U/μl, respectively. The reaction mixture was incubated for 5 min at 25°C and 45 min at 50°C. After a denaturation step at 94°C for 3 min and chilling on ice, 2.5 units of 3′→5′ Exo− Klenow DNA polymerase (New England Biolabs) was added, and the reaction mixture was incubated at 37°C for 1 h, followed by an enzyme inactivation step at 75°C for 10 min for second-strand synthesis. The reaction mix was used as a template in a 50-μl PCR mixture containing 1× AmpliTaq Gold buffer, 2.5 mM MgCl2, each dNTP at 0.2 mM, 0.8 μM primer FR20RV (5′-GCCGGAGCTCTGCAGATATC-3′), and 2.5 U AmpliTaq Gold (Applied Biosystems). After 10 min at 94°C, 40 cycles of amplification (94°C for 60 s, 65°C for 60 s, 72°C for 2 min) and 1 cycle of elongation (72°C for 10 min) were performed. The PCR products were separated on an agarose gel, and fragments between 200 and 400 bp, 400 and 800 bp, and 800 and 1,500 bp were excised and purified using the Invisorb Spin DNA extraction kit (Invitek GmbH) according to the manufacturer's instructions. Products were cloned into pCR4-TOPO and introduced into chemically competent Escherichia coli TOP-10 according to the manufacturer's instructions (Invitrogen).

Sequencing.

Sequencing templates were produced directly from colonies in a 96-well format by performing a colony PCR. The 25-μl reaction mixture consisted of 1× Thermopol reaction buffer (New England Biolabs), each dNTP at 0.2 mM, 0.2 μM M13 sequencing primers, and 1 unit Taq DNA polymerase (New England Biolabs). After 3 min at 95°C, 30 cycles of amplification (95°C for 30 s, 45°C for 60 s, 72°C for 2 min 30 s) and 1 cycle of elongation (72°C for 10 min) were performed. PCR products were purified using an MSB HTS PCRapace/C kit (Invitek GmbH) according to the manufacturer's instructions. Sequencing was performed on 2-μl purified PCR products using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) and a 3130XL genetic analyzer (Applied Biosystems).

Genome amplification and sequencing.

The picobirnavirus sequence readings for segments 1 and 2 previously detected in stool filtrate VS10 and the rhinovirus sequences in sample VS25 obtained by random amplification were assembled in different contigs, and the nucleic acid between the contigs was obtained by reverse transcription (RT)-PCR (Fig. 1; Table 1). cDNA was synthesized from RNA (see above) using 0.25 μg of random primers (Promega) and each dNTP at 0.8 mM, incubated at 65°C (or 95°C for picobirnavirus) for 5 min, and chilled on ice. First-strand buffer (5×; Invitrogen), DTT (Invitrogen), RNasin (Promega), and Superscript III reverse transcriptase (Invitrogen) were added to final concentrations of 1×, 5 mM, 2 U/μl, and 10 U/μl, respectively. The reaction mixture was incubated for 5 min at 25°C, 45 min at 50°C, and 15 min at 72°C.

FIG. 1.

FIG. 1.

Schematic outlines of the strategies used for PCR amplification. (A) The upper panel shows a schematic representation of the rhinovirus genome. The box represents the open reading frame (ORF) encoding the rhinovirus polyprotein. Indicated are the VPg (black dot) and the poly(A) tail (An). The lower panels show a schematic outline of the RT-PCR assays employed to amplify rhinovirus sequences, using random amplification, specific amplification, and 3′RACE PCR. The orientations and positions of the oligonucleotides on the rhinovirus genome are shown. (B) The upper panel shows a schematic representation of segment 1 of the picobirnavirus genome. The boxes represent the ORF1 and ORF2 sequences. Indicated are the 5′ and 3′ ends of the genomic sequence. The lower panels show a schematic outline of the RT-PCR assays employed to amplify picobirnavirus sequences, using random and specific amplification. The orientations and positions of the oligonucleotides on the picobirnavirus genome are shown. (C) The upper panel shows a schematic representation of segment 2 of the picobirnavirus genome. The box represents the ORF sequence. Indicated are the 5′ and 3′ ends of the genomic sequence. The lower panels show a schematic outline of the RT-PCR assays employed to amplify picobirnavirus sequences, using random and specific amplification. The orientations and positions of the oligonucleotides on the picobirnavirus genome are shown.

TABLE 1.

Oligonucleotide primers

Primer Nucleotide sequence (5′-3′)
VS379a CACTCTTGGTAACTCCAC
VS380a CCAATGGGTGTAGTACTG
VS381a CACCCAATGAAGTGTAC
VS382a CCATGAATGCACCTGAG
VS383a CTCAGGTGCATTCATGG
VS384a CCAGCCATCGTTTGCC
VS385a GGGATGTTGTTCACTAGC
VS386a CCCTGTGGCACATAACAC
VS430a GCGAGCACAGAATTAATACGACTCACTATAGGT12VN
VS431a GCTGATGGCGATGAATGAACACTG
VS432a CGCGGATCCGAATTAATACGACTCACTATAGG
VS459a CCCATTGATGTTACAACTAGTGC
VS460a CTAGTGCTGGGTACCCTTATG
VS320 GAAGTGTTACTGAAAGGAGG
VS322 GATGTTGATAGGTGCAGACAG
VS346 GAAATTTATTTAAGAAAGGAGG
VS326 GACAGACATTGGTCCGACC
VS327 GGAGAACTGCAAGTATCACC
VS351 GGTTTGCTGCACCATC
VS352 TSGTGTGGATGTTYC
VS353 CGGTATGGATGTTTC
VS354 ARTGYTGRHCGAACTT
VS355 AAGCGAGCCCATGTA
a

Primers used for amplification of rhinovirus sequences.

PCR was performed with oligonucleotides directed toward sequences determined by sequence-independent amplification from the newly identified viruses or directed toward 5′ and 3′ sequences from picobirnaviruses (Fig. 1; Table 1), using 1× AmpliTaq Gold buffer, 1.5 mM MgCl2, each dNTP at 0.2 mM, 5 pmol primers, 2 U AmpliTaq Gold (Applied Biosystems), and 1 or 2 μl cDNA. After 5 min at 95°C, 40 cycles of amplification (95°C for 30 s, 45°C for 60 s, and 72°C for 1 min to 2 min 30 s, depending on the size of the amplicon) and 1 cycle of elongation (72°C for 10 min) were performed.

For rapid amplification of cDNA 3′ ends (RACE)-PCR of the rhinovirus genome, cDNA was synthesized using 10 pmol primer VS430 (Table 1) as described above. The first or second PCR mixtures contained 1× AmpliTaq Gold buffer, 2.5 mM MgCl2, each dNTP at 0.2 mM, 20 pmol primers (VS459/431 or VS460/432), 2.5 U AmpliTaq Gold (Applied Biosystems), and 5 μl cDNA or first PCR products, respectively. After 2 min at 95°C, 35 cycles of amplification (95°C for 60 s, 55°C for 45 s, 72°C for 4 min) and 1 cycle of elongation (72°C for 10 min) were performed. All sequences were determined in both directions for at least two clones.

Database searches.

All obtained sequences were screened for homology with known sequences using the Basic Local Alignment Search Tool (BLAST), specifically BLASTN and TBLASTX (2).

Phylogenetic analysis.

All sequences were downloaded from GenBank; accession numbers are available on request. Multiple alignments were created using ClustalX (2.0.10). Sequences were dereplicated to 95% sequence identity with gaps using the online program FastGroup II (40). Phylogenetic analyses were carried out with Molecular Evolutionary Genetics Analysis (MEGA) software, version 4.1beta (33), in a manner similar to that used in previous picobirnavirus studies (7, 30, 32). The average pairwise Jukes-Cantor distance was calculated to determine the appropriateness of creating a neighbor-joining tree. Phylogenetic trees were calculated using neighbor-joining with a Jukes-Cantor model, and bootstrap analysis was performed with 1,000 replicates.

Diagnostic PCRs for human picobirnaviruses.

RT-PCR-grade viral RNA was extracted from aliquots of 101 samples suspended in PBS (10%, wt/vol) from patients with diarrhea, using a Magnapure LC total nucleic acid isolation kit (Roche) according to the manufacturer's instructions. cDNA synthesis was performed on 5 μl total nucleic acid using 0.25 μg of random primers (Promega) and each dNTP at 0.5 mM, which mixture was incubated at 95°C for 5 min and chilled on ice. First-strand buffer (5×; Invitrogen), DTT (Invitrogen), RNasin (Promega), and Superscript III reverse transcriptase (Invitrogen) were added to final concentrations of 1×, 5 mM, 2 U/μl, and 10 U/μl, respectively. The reaction mixture was incubated for 5 min at 25°C, 45 min at 50°C, and 15 min at 72°C. Portions of genomic segment 2 of genogroup I and genogroup II picobirnaviruses were amplified by PCR as described previously, with adaptations (3, 30). Oligonucleotides to amplify genogroup I picobirnaviruses were VS352 and VS354 and to amplify genogroup II picobirnaviruses were VS353 and VS355 (Table 1). Two microliters of cDNA was used in a PCR mixture containing 1× AmpliTaq Gold reaction buffer, 0.075% Triton X-100, 2 mM MgCl2, 200 μM each dNTP, 2 U AmpliTaq Gold with GeneAmp (Roche), and 800 nM VS352 and VS354 or 200 nM VS353 and VS355 primers for genogroup I or II, respectively. The conditions used for PCR amplification were an initial denaturation step at 95°C for 5 min and then 40 cycles of 95°C for 30 s, 45°C for 2 min, and 72°C for 3 min, followed by a single incubation at 72°C for 10 min. All products were visualized using agarose gel electrophoresis. To verify the identities of viruses from positive assays, PCR products were cloned and sequenced (at least two clones in both directions). The percentage of patients with diarrhea that contained picobirnavirus sequences was determined per month. In addition, the birth dates of patients positive and negative for picobirnaviruses were compared using an unpaired Student t test. Differences were considered significant at a P of <0.05.

Nucleotide sequence accession numbers.

All obtained sequences were deposited in the GenBank database under accession numbers GU968923 to GU968948.

RESULTS

Molecular virus screening of clinical diarrhea samples.

From the Diagnostic Unit, Department of Virology, Erasmus Medical Center, Rotterdam, Netherlands, we received 84 diarrhea samples of unknown etiology for further analysis of the potential presence of viral pathogens. The sample admission dates of diarrhea of unknown etiology were evenly distributed across the year (Fig. 2A). The ages of patients with diarrhea of unknown etiology were unevenly distributed, with most patients (58%) being ≤7 years of age (Fig. 2B). Initially, 13 clinical diarrhea samples were analyzed using sequence-independent amplification, with characterization of a total of 541 clones according to nucleotide and translated-nucleotide BLAST searches (2) (Fig. 3). In general, most of the sequences in each sample were unclassified or of bacterial origin. In total, ∼10% of analyzed clones showed similarity to viral sequences.

FIG. 2.

FIG. 2.

Percentages of patients with diarrhea of unknown etiology were determined based on the month of sample admission (A) or by year of birth of the patients (B).

FIG. 3.

FIG. 3.

Sequence classification and distribution in diarrhea samples. Sequences were classified as either eukaryotic, phage, bacterial, unclassified, viral, or other based on BLASTN searches. Unclassified sequences are those sequences with no apparent homology to known sequences, and other sequences are those that did not fall in any of the defined groups. The percentage of each category is shown in a pie chart per diarrhea sample.

The viral sequences matched five different virus species, of which two were DNA viruses. Sequences similar to E. coli bacteriophage rv5 (family Myoviridae) were not analyzed in more detail, since it is a noneukaryotic virus. A Torque teno virus (TT-virus)-like sequence (family Circoviridae) that displayed ∼70% nucleotide identity to known TT-virus sequences was obtained. Because this group of viruses is known to ubiquitously infect humans, is genetically highly diverse, and was found in diarrhea samples previously (14, 27), the TT-virus-like sequence was not analyzed further. The Moloney leukemia virus (MoLV; family Retroviridae) sequence was nearly identical at the nucleotide level to known MoLV polymerase sequences and considered to represent a previously known virus. A potentially new human rhinovirus (HRV) genotype (family Picornaviridae) was detected, with clones displaying ∼80% nucleotide similarity to HRV14 and HRV35. The complete polyprotein-coding sequence of the rhinovirus was determined. By comparison to the recently determined polyprotein sequences of other rhinoviruses (28), we determined that our rhinovirus sequence belonged to species HRV-B and was phylogenetically most closely related to HRV72, with >95% amino acid identity (Fig. 4). In sample VS10, ∼25% of clones showed similarity to a group of unclassified, nonenveloped, small RNA viruses with genomes composed of two segments of double-stranded RNA, called picobirnaviruses. As only limited information is available on picobirnaviruses, a more in-depth study on this virus was performed.

FIG. 4.

FIG. 4.

Neighbor-joining (P distance model) phylogenetic tree showing relationships between all known human clade B rhinovirus serotypes created on the basis of full polyprotein sequences. Branch lengths are proportional to similarity. Key nodes are annotated with bootstrap percentages. Reference sequences from previously published studies are identified by their serotype number and GenBank accession numbers. The rhinovirus from sample VS25 is depicted as VS25 and marked with an arrow.

Picobirnavirus.

A large part of the genome sequence of the identified picobirnavirus was determined by specific PCR targeting of the sequences detected in the sequence-independent amplification procedure. The sequences showed homology to genogroup I picobirnaviruses (3, 30) and were compared to the known complete segment 1 and 2 sequences of picobirnaviruses isolated from humans and rabbits. The sequences obtained for segment 1 of the picobirnavirus from sample VS10 showed only ∼25% amino acid identity to the segment 1 sequences of reference strain HY005102 and the rabbit picobirnavirus (see Fig. S1A in the supplemental material). Segment 2 contained one long open reading frame that showed ∼65% identity at the amino acid level to human prototype strains HY005102 and 1-CHN-97 (see Fig. S1B in the supplemental material). These data showed that the characterized Dutch picobirnavirus genome was highly divergent from the known picobirnavirus genomes.

To estimate the prevalence of picobirnaviruses, diagnostic PCR assays for genogroup I and II picobirnaviruses (3, 30) that target the polymerase gene were performed on the other 83 samples from patients with diarrhea of unknown etiology. In total, 17 samples were confirmed positive for genogroup I picobirnavirus sequences (20%). Mixed infections were detected in samples VS62 and VS142. VS62 contained two different genogroup I picobirnavirus variants. Sample VS142 contained two genogroup I variants and was also positive for the only detected genogroup II variant in our study that was highly similar (98%) to the prototype genogroup II strain 4-GA-91 (30). The medical records of the 17 patients infected with picobirnavirus were reviewed. The sample admission dates of the 17 picobirnavirus-positive samples were distributed relatively evenly over the year (Fig. 5A). Interestingly, although our sample set is skewed for young age, the average age of people infected with picobirnaviruses was significantly higher than the age of uninfected patients with diarrhea of unknown etiology (P < 0.005) (Fig. 5B). In addition, diagnostic PCR assays for genogroup I and II picobirnaviruses were performed on 17 diarrhea samples in which known pathogens were identified by standard diagnostics. Three of these samples were confirmed positive for genogroup I picobirnavirus sequences (17.5%) and also contained either adenovirus or rotavirus. Two patients were younger than 3 years of age, and one was 43 years old. The percentages of picobirnavirus-positive samples were similar between patients with diarrhea of unknown (20%) and known (17.5%) etiological agents (P > 0.8). Therefore, it remains unclear whether picobirnaviruses are the cause of diarrhea in our picobirnavirus-positive samples.

FIG. 5.

FIG. 5.

Percentages of patients with diarrhea of unknown etiology who were positive for picobirnavirus sequences were determined based on month of sample admission (A) or by birth year of the patients (B).

To determine the genetic relationships between the identified genogroup I picobirnaviruses in our samples and previously reported genogroup I human picobirnavirus isolates, a phylogenetic tree was constructed based on a 165-nucleotide fragment of the RNA-dependent RNA polymerase gene, as described previously (7, 30, 32). Prior to tree construction, a total of 76 groups were created from the almost 300 available picobirnavirus sequences using FastGroup II (40). The majority of groups were composed of one or two sequences; seven groups contained five or more sequences, and six groups of sequences contained more than 17 sequences. Since the average pair-wise Jukes-Cantor distance was 0.48, a neighbor-joining tree was created using the Jukes-Cantor model, with a bootstrap replication of 1,000 (Fig. 6). Twelve out of 22 of the determined genogroup I picobirnavirus sequences in this study showed <95% sequence identity to previously described picobirnavirus sequences and are shown as separate branches in the phylogenetic tree. The Dutch genogroup I picobirnavirus nucleotide sequences showed 54 to 99% similarity to each other. They belonged to different phylogenetic clades and did not group with other picobirnaviruses according to year of isolation or host species.

FIG. 6.

FIG. 6.

Neighbor-joining (Jukes-Cantor model) phylogenetic tree of an ∼165-bp fragment of the picobirnavirus RNA-dependent RNA polymerase gene from known human, porcine, and wastewater picobirnaviruses and newly characterized Dutch human picobirnaviruses. Each branch represents a sequence or group of sequences (95% identical with gaps) depending upon the presence of a colored block. Every branch corresponds to the adjacent table, which explains the sources, years of isolation, and locations of the virus variants. Reference sequences from previously published studies are identified by their GenBank accession numbers or by strain name. The designations P, WW, D, S, R, and H stand for porcine, wastewater, dog, snake, rat, and human picobirnavirus, respectively. The different countries of isolation are designated A, Br, Ch, H, I, NL, USA, T, and V for Argentina, Brazil, China, Hungary, India, Netherlands, United States of America, Thailand, and Venezuela, respectively. The sequences from Dutch diarrhea samples are depicted by VS numbers, and arrows show branches in which Dutch picobirnaviruses are present (with or without virus variants from other countries).

DISCUSSION

Viral diagnostic assays of clinical samples are nowadays performed largely using viral-species-specific assays. The genetic diversity of viruses, however, is a confounding factor in molecular diagnostics, preventing detection of virus variants. The intention of this study was to identify known and unknown human viruses through sequence-independent amplification of nucleic acids in a limited set of clinical diarrhea samples that tested negative for known enteric pathogens. Most detected sequences were unclassified or of bacterial origin, which is consistent with the results of previous metagenomic analyses of human fecal samples (14, 37, 41). As our samples were prescreened for the absence of known enteric pathogens, viruses such as rota-, adeno-, calici-, entero-, parecho-, and astroviruses were not found. Bacteriophage, TT-virus, Moloney leukemia virus, rhinovirus, and picobirnavirus sequences were encountered, all of which have been observed in human fecal samples before (14, 37, 41). Despite the use of an RNA purification method, two of these viruses were DNA viruses, possibly due to copurification of viral DNA with RNA. The degree of divergence from known viral sequences based on BLAST searches suggested that some of the identified viruses might represent new virus subtypes or genotypes, among which was the picobirnavirus sequence.

A large part of the genome sequence of a Dutch picobirnavirus (VS10) was obtained. These sequences were highly divergent from other picobirnaviruses for which full-length or segment-length sequences were available, especially in the capsid-coding segment 1 (13). Segment 2, which encodes the RNA-dependent RNA polymerase, was more conserved but still displayed up to 35% diversity at the amino acid level. Phylogenetic analysis of a 165-bp fragment of segment 2, for which ∼300 picobirnavirus sequences were available, indicated that Dutch picobirnaviruses were highly diverse, belonged to different phylogenetic clades, and did not group with other picobirnaviruses according to year of isolation or host species. Our data corroborate previous reports on the high genetic diversity of picobirnaviruses (3, 8, 30, 32).

Picobirnaviruses have been identified in fecal samples from a variety of animals and from humans worldwide (3, 4, 6-9, 16, 25, 30, 38). A total of 20% of our diarrhea samples of unknown etiology were positive for genogroup I picobirnaviruses, and only one sample, which also contained two different genogroup I picobirnaviruses, contained a genogroup II picobirnavirus (3, 30). Our data are in line with previous data showing that genogroup II picobirnaviruses are identified on a less frequent basis than genogroup I viruses (25, 30) and that mixed infections can occur (4). As the sample admission dates of the picobirnavirus-positive samples were distributed relatively evenly over the year, seasonality in infection does not seem to play a major role. An interesting observation was that the average age of people carrying picobirnaviruses is significantly higher than that of picobirnavirus-negative patients in our sample set. Previous surveys for picobirnaviruses using PAGE analyses detected a relatively low percentage of children with picobirnavirus (9, 29), although other reports indicate no age preference in picobirnavirus prevalence (16). Whether children are really less likely to be infected with picobirnaviruses than adults or the elderly remains a subject for future studies. The pathogenicity of picobirnaviruses has not been established. Studies conducted with immunocompromised persons suggest that picobirnaviruses are opportunistic pathogens that may cause diarrhea (18, 20). We showed a picobirnavirus prevalence of ∼20% in diarrhea samples from Dutch patients who were admitted to the hospital. Whether picobirnaviruses were the cause of diarrhea remained unclear.

In conclusion, (re)emerging infectious diseases pose a continuous health threat to and burden on humans, and it is of vital importance that more attention be given to a more effective approach to battle new viral epidemics. Research efforts to mitigate the effects of infectious threats, focusing on improved surveillance and diagnostic capabilities and on the development of vaccines and antiviral agents, are crucial. Our results indicate that sequence-independent amplification of known and unknown RNA viruses in clinical diarrhea samples was an efficient procedure for virus identification. Similar results were obtained previously with respiratory tract and mouse tissue samples (1, 37). Sequence-independent amplification of viral nucleic acids as described in this study provides a relatively simple, nonselective technology with diagnostic capabilities to gain epidemiological baseline information about pathogens and their diversity in humans and animals and may therefore lead to early identification of newly emerging pathogens in the future.

Acknowledgments

We thank G. J. J. van Doornum from the Diagnostic Unit, Department of Virology, Erasmus Medical Center, Rotterdam, Netherlands, for providing diarrhea samples.

This work was funded by EU Framework Project 7 grant 223498 and Nobilon International B.V. A. D. M. E. Osterhaus is part-time chief scientific officer of ViroClinics Biosciences B.V.

Footnotes

▿

Published ahead of print on 24 March 2010.

†

Supplemental material for this article may be found at http://jcm.asm.org/.

REFERENCES

  • 1.Allander, T., M. T. Tammi, M. Eriksson, A. Bjerkner, A. Tiveljung-Lindell, and B. Andersson. 2005. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc. Natl. Acad. Sci. U. S. A. 102:12891-12896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Banyai, K., F. Jakab, G. Reuter, J. Bene, M. Uj, B. Melegh, and G. Szucs. 2003. Sequence heterogeneity among human picobirnaviruses detected in a gastroenteritis outbreak. Arch. Virol. 148:2281-2291. [DOI] [PubMed] [Google Scholar]
  • 4.Banyai, K., V. Martella, A. Bogdan, P. Forgach, F. Jakab, E. Meleg, H. Biro, B. Melegh, and G. Szucs. 2008. Genogroup I picobirnaviruses in pigs: evidence for genetic diversity and relatedness to human strains. J. Gen. Virol. 89:534-539. [DOI] [PubMed] [Google Scholar]
  • 5.Bennet, R., K. O. Hedlund, A. Ehrnst, and M. Eriksson. 1995. Nosocomial gastroenteritis in two infant wards over 26 months. Acta Paediatr. 84:667-671. [DOI] [PubMed] [Google Scholar]
  • 6.Bhattacharya, R., G. C. Sahoo, M. K. Nayak, S. Ghosh, P. Dutta, M. K. Bhattacharya, U. Mitra, D. Gangopadhyay, S. Dutta, S. K. Niyogi, D. R. Saha, T. N. Naik, S. K. Bhattacharya, and T. Krishnan. 2006. Molecular epidemiology of human astrovirus infections in Kolkata, India. Infect. Genet. Evol. 6:425-435. [DOI] [PubMed] [Google Scholar]
  • 7.Bhattacharya, R., G. C. Sahoo, M. K. Nayak, K. Rajendran, P. Dutta, U. Mitra, M. K. Bhattacharya, T. N. Naik, S. K. Bhattacharya, and T. Krishnan. 2007. Detection of genogroup I and II human picobirnaviruses showing small genomic RNA profile causing acute watery diarrhoea among children in Kolkata, India. Infect. Genet. Evol. 7:229-238. [DOI] [PubMed] [Google Scholar]
  • 8.Carruyo, G. M., G. Mateu, L. C. Martinez, F. H. Pujol, S. V. Nates, F. Liprandi, and J. E. Ludert. 2008. Molecular characterization of porcine picobirnaviruses and development of a specific reverse transcription-PCR assay. J. Clin. Microbiol. 46:2402-2405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cascio, A., M. Bosco, E. Vizzi, A. Giammanco, D. Ferraro, and S. Arista. 1996. Identification of picobirnavirus from faeces of Italian children suffering from acute diarrhea. Eur. J. Epidemiol. 12:545-547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chiu, C. Y., A. A. Alizadeh, S. Rouskin, J. D. Merker, E. Yeh, S. Yagi, D. Schnurr, B. K. Patterson, D. Ganem, and J. L. DeRisi. 2007. Diagnosis of a critical respiratory illness caused by human metapneumovirus by use of a pan-virus microarray. J. Clin. Microbiol. 45:2340-2343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chu, C. M., D. Y. Lin, C. T. Yeh, I. S. Sheen, and Y. F. Liaw. 2001. Epidemiological characteristics, risk factors, and clinical manifestations of acute non-A-E hepatitis. J. Med. Virol. 65:296-300. [DOI] [PubMed] [Google Scholar]
  • 12.Dong, J., J. P. Olano, J. W. McBride, and D. H. Walker. 2008. Emerging pathogens: challenges and successes of molecular diagnostics. J. Mol. Diagn. 10:185-197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Duquerroy, S., B. Da Costa, C. Henry, A. Vigouroux, S. Libersou, J. Lepault, J. Navaza, B. Delmas, and F. A. Rey. 2009. The picobirnavirus crystal structure provides functional insights into virion assembly and cell entry. EMBO J. 28:1655-1665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Finkbeiner, S. R., A. F. Allred, P. I. Tarr, E. J. Klein, C. D. Kirkwood, and D. Wang. 2008. Metagenomic analysis of human diarrhea: viral detection and discovery. PLoS Pathog. 4:e1000011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fouchier, R. A., N. G. Hartwig, T. M. Bestebroer, B. Niemeyer, J. C. de Jong, J. H. Simon, and A. D. Osterhaus. 2004. A previously undescribed coronavirus associated with respiratory disease in humans. Proc. Natl. Acad. Sci. U. S. A. 101:6212-6216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gallimore, C. I., H. Appleton, D. Lewis, J. Green, and D. W. Brown. 1995. Detection and characterisation of bisegmented double-stranded RNA viruses (picobirnaviruses) in human faecal specimens. J. Med. Virol. 45:135-140. [DOI] [PubMed] [Google Scholar]
  • 17.Gaynor, A. M., M. D. Nissen, D. M. Whiley, I. M. Mackay, S. B. Lambert, G. Wu, D. C. Brennan, G. A. Storch, T. P. Sloots, and D. Wang. 2007. Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS Pathog. 3:e64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Giordano, M. O., L. C. Martinez, D. Rinaldi, C. Espul, N. Martinez, M. B. Isa, A. R. Depetris, S. I. Medeot, and S. V. Nates. 1999. Diarrhea and enteric emerging viruses in HIV-infected patients. AIDS Res. Hum. Retroviruses 15:1427-1432. [DOI] [PubMed] [Google Scholar]
  • 19.Granerod, J., and N. S. Crowcroft. 2007. The epidemiology of acute encephalitis. Neuropsychol. Rehabil. 17:406-428. [DOI] [PubMed] [Google Scholar]
  • 20.Grohmann, G. S., R. I. Glass, H. G. Pereira, S. S. Monroe, A. W. Hightower, R. Weber, and R. T. Bryan. 1993. Enteric viruses and diarrhea in HIV-infected patients. Enteric Opportunistic Infections Working Group. N. Engl. J. Med. 329:14-20. [DOI] [PubMed] [Google Scholar]
  • 21.Herikstad, H., S. Yang, T. J. Van Gilder, D. Vugia, J. Hadler, P. Blake, V. Deneen, B. Shiferaw, and F. J. Angulo. 2002. A population-based estimate of the burden of diarrhoeal illness in the United States: FoodNet, 1996-1997. Epidemiol. Infect. 129:9-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jones, M. S., A. Kapoor, V. V. Lukashov, P. Simmonds, F. Hecht, and E. Delwart. 2005. New DNA viruses identified in patients with acute viral infection syndrome. J. Virol. 79:8230-8236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kapoor, A., J. Victoria, P. Simmonds, C. Wang, R. W. Shafer, R. Nims, O. Nielsen, and E. Delwart. 2008. A highly divergent picornavirus in a marine mammal. J. Virol. 82:311-320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kistler, A., P. C. Avila, S. Rouskin, D. Wang, T. Ward, S. Yagi, D. Schnurr, D. Ganem, J. L. DeRisi, and H. A. Boushey. 2007. Pan-viral screening of respiratory tract infections in adults with and without asthma reveals unexpected human coronavirus and human rhinovirus diversity. J. Infect. Dis. 196:817-825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Martinez, L. C., M. O. Giordano, M. B. Isa, L. F. Alvarado, J. V. Pavan, D. Rinaldi, and S. V. Nates. 2003. Molecular diversity of partial-length genomic segment 2 of human picobirnavirus. Intervirology 46:207-213. [DOI] [PubMed] [Google Scholar]
  • 26.Mihindukulasuriya, K. A., G. Wu, J. St. Leger, R. W. Nordhausen, and D. Wang. 2008. Identification of a novel coronavirus from a beluga whale by using a panviral microarray. J. Virol. 82:5084-5088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Okamoto, H. 2009. History of discoveries and pathogenicity of TT viruses. Curr. Top. Microbiol. Immunol. 331:1-20. [DOI] [PubMed] [Google Scholar]
  • 28.Palmenberg, A. C., D. Spiro, R. Kuzmickas, S. Wang, A. Djikeng, J. A. Rathe, C. M. Fraser-Liggett, and S. B. Liggett. 2009. Sequencing and analyses of all known human rhinovirus genomes reveal structure and evolution. Science 324:55-59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pereira, H. G., A. C. Linhares, J. A. Candeias, and R. I. Glass. 1993. National laboratory surveillance of viral agents of gastroenteritis in Brazil. Bull. Pan Am. Health Organ. 27:224-233. [PubMed] [Google Scholar]
  • 30.Rosen, B. I., Z. Y. Fang, R. I. Glass, and S. S. Monroe. 2000. Cloning of human picobirnavirus genomic segments and development of an RT-PCR detection assay. Virology 277:316-329. [DOI] [PubMed] [Google Scholar]
  • 31.Saeed, M., S. Z. Zaidi, A. Naeem, M. Masroor, S. Sharif, S. Shaukat, M. Angez, and A. Khan. 2007. Epidemiology and clinical findings associated with enteroviral acute flaccid paralysis in Pakistan. BMC Infect. Dis. 7:6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Symonds, E. M., D. W. Griffin, and M. Breitbart. 2009. Eukaryotic viruses in wastewater samples from the United States. Appl. Environ. Microbiol. 75:1402-1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596-1599. [DOI] [PubMed] [Google Scholar]
  • 34.Urisman, A., R. J. Molinaro, N. Fischer, S. J. Plummer, G. Casey, E. A. Klein, K. Malathi, C. Magi-Galluzzi, R. R. Tubbs, D. Ganem, R. H. Silverman, and J. L. DeRisi. 2006. Identification of a novel Gammaretrovirus in prostate tumors of patients homozygous for R462Q RNASEL variant. PLoS Pathog. 2:e25. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 35.van den Hoogen, B. G., J. C. de Jong, J. Groen, T. Kuiken, R. de Groot, R. A. Fouchier, and A. D. Osterhaus. 2001. A newly discovered human pneumovirus isolated from young children with respiratory tract disease. Nat. Med. 7:719-724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.van der Hoek, L., K. Pyrc, M. F. Jebbink, W. Vermeulen-Oost, R. J. Berkhout, K. C. Wolthers, P. M. Wertheim-van Dillen, J. Kaandorp, J. Spaargaren, and B. Berkhout. 2004. Identification of a new human coronavirus. Nat. Med. 10:368-373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Victoria, J. G., A. Kapoor, K. Dupuis, D. P. Schnurr, and E. L. Delwart. 2008. Rapid identification of known and new RNA viruses from animal tissues. PLoS Pathog. 4:e1000163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wakuda, M., Y. Pongsuwanna, and K. Taniguchi. 2005. Complete nucleotide sequences of two RNA segments of human picobirnavirus. J. Virol. Methods 126:165-169. [DOI] [PubMed] [Google Scholar]
  • 39.Wilson, M. E. 2005. Diarrhea in nontravelers: risk and etiology. Clin. Infect. Dis. 41(Suppl. 8):S541-S546. [DOI] [PubMed] [Google Scholar]
  • 40.Yu, Y., M. Breitbart, P. McNairnie, and F. Rohwer. 2006. FastGroupII: a web-based bioinformatics platform for analyses of large 16S rDNA libraries. BMC Bioinformatics 7:57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zhang, T., M. Breitbart, W. H. Lee, J. Q. Run, C. L. Wei, S. W. Soh, M. L. Hibberd, E. T. Liu, F. Rohwer, and Y. Ruan. 2006. RNA viral community in human feces: prevalence of plant pathogenic viruses. PLoS Biol. 4:e3. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES